Home |
Help |
Advanced search
2024-04-20 04:54:57, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033141 5602 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens mitogen-activated protein kinase kinase kinase 9
(MAP3K9), mRNA.
ACCESSION NM_033141 XM_027237
VERSION NM_033141.2 GI:52421789
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5602)
AUTHORS Stark,M.S., Woods,S.L., Gartside,M.G., Bonazzi,V.F.,
Dutton-Regester,K., Aoude,L.G., Chow,D., Sereduk,C., Niemi,N.M.,
Tang,N., Ellis,J.J., Reid,J., Zismann,V., Tyagi,S., Muzny,D.,
Newsham,I., Wu,Y., Palmer,J.M., Pollak,T., Youngkin,D.,
Brooks,B.R., Lanagan,C., Schmidt,C.W., Kobe,B., MacKeigan,J.P.,
Yin,H., Brown,K.M., Gibbs,R., Trent,J. and Hayward,N.K.
TITLE Frequent somatic mutations in MAP3K5 and MAP3K9 in metastatic
melanoma identified by exome sequencing
JOURNAL Nat. Genet. 44 (2), 165-169 (2012)
PUBMED 22197930
REMARK GeneRIF: It was found that 24% of melanoma cell lines have
mutations in the protein-coding regions of either MAP3K5 or MAP3K9.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 5602)
AUTHORS McClay,J.L., Adkins,D.E., Aberg,K., Bukszar,J., Khachane,A.N.,
Keefe,R.S., Perkins,D.O., McEvoy,J.P., Stroup,T.S., Vann,R.E.,
Beardsley,P.M., Lieberman,J.A., Sullivan,P.F. and van den Oord,E.J.
TITLE Genome-wide pharmacogenomic study of neurocognition as an indicator
of antipsychotic treatment response in schizophrenia
JOURNAL Neuropsychopharmacology 36 (3), 616-626 (2011)
PUBMED 21107309
REFERENCE 3 (bases 1 to 5602)
AUTHORS Huet,G., Merot,Y., Percevault,F., Tiffoche,C., Arnal,J.F.,
Boujrad,N., Pakdel,F., Metivier,R. and Flouriot,G.
TITLE Repression of the estrogen receptor-alpha transcriptional activity
by the Rho/megakaryoblastic leukemia 1 signaling pathway
JOURNAL J. Biol. Chem. 284 (49), 33729-33739 (2009)
PUBMED 19826002
REMARK GeneRIF: estrogen receptor-alpha transcriptional activity is
repressed by the Rho/megakaryoblastic leukemia 1 signaling pathway
REFERENCE 4 (bases 1 to 5602)
AUTHORS Durkin,J.T., Holskin,B.P., Kopec,K.K., Reed,M.S., Spais,C.M.,
Steffy,B.M., Gessner,G., Angeles,T.S., Pohl,J., Ator,M.A. and
Meyer,S.L.
TITLE Phosphoregulation of mixed-lineage kinase 1 activity by multiple
phosphorylation in the activation loop
JOURNAL Biochemistry 43 (51), 16348-16355 (2004)
PUBMED 15610029
REFERENCE 5 (bases 1 to 5602)
AUTHORS Figueroa,C., Tarras,S., Taylor,J. and Vojtek,A.B.
TITLE Akt2 negatively regulates assembly of the POSH-MLK-JNK signaling
complex
JOURNAL J. Biol. Chem. 278 (48), 47922-47927 (2003)
PUBMED 14504284
REFERENCE 6 (bases 1 to 5602)
AUTHORS Xu,Z., Maroney,A.C., Dobrzanski,P., Kukekov,N.V. and Greene,L.A.
TITLE The MLK family mediates c-Jun N-terminal kinase activation in
neuronal apoptosis
JOURNAL Mol. Cell. Biol. 21 (14), 4713-4724 (2001)
PUBMED 11416147
REFERENCE 7 (bases 1 to 5602)
AUTHORS Dorow,D.S., Devereux,L., Tu,G.F., Price,G., Nicholl,J.K.,
Sutherland,G.R. and Simpson,R.J.
TITLE Complete nucleotide sequence, expression, and chromosomal
localisation of human mixed-lineage kinase 2
JOURNAL Eur. J. Biochem. 234 (2), 492-500 (1995)
PUBMED 8536694
REFERENCE 8 (bases 1 to 5602)
AUTHORS Gallo,K.A., Mark,M.R., Scadden,D.T., Wang,Z., Gu,Q. and
Godowski,P.J.
TITLE Identification and characterization of SPRK, a novel src-homology 3
domain-containing proline-rich kinase with serine/threonine kinase
activity
JOURNAL J. Biol. Chem. 269 (21), 15092-15100 (1994)
PUBMED 8195146
REFERENCE 9 (bases 1 to 5602)
AUTHORS Dorow,D.S., Devereux,L., Dietzsch,E. and De Kretser,T.
TITLE Identification of a new family of human epithelial protein kinases
containing two leucine/isoleucine-zipper domains
JOURNAL Eur. J. Biochem. 213 (2), 701-710 (1993)
PUBMED 8477742
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AY327900.1, BX648924.1 and BC033197.1.
On Sep 22, 2004 this sequence version replaced gi:50582976.
##Evidence-Data-START##
Transcript exon combination :: AF251442.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025084 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1297 AY327900.1 1-1297
1298-1690 BX648924.1 696-1088
1691-1844 BX648924.1 1233-1386
1845-2026 AY327900.1 1845-2026
2027-4069 BX648924.1 1500-3542
4070-5598 BC033197.1 1837-3365
5599-5602 AY327900.1 5556-5559
FEATURES Location/Qualifiers
source 1..5602
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q24.2"
gene 1..5602
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="mitogen-activated protein kinase kinase kinase 9"
/db_xref="GeneID:4293"
/db_xref="HGNC:6861"
/db_xref="HPRD:15965"
/db_xref="MIM:600136"
CDS 1..3357
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/EC_number="2.7.11.25"
/note="mixed lineage kinase 1 (tyr and ser/thr
specificity)"
/codon_start=1
/product="mitogen-activated protein kinase kinase kinase
9"
/protein_id="NP_149132.2"
/db_xref="GI:52421790"
/db_xref="CCDS:CCDS32112.1"
/db_xref="GeneID:4293"
/db_xref="HGNC:6861"
/db_xref="HPRD:15965"
/db_xref="MIM:600136"
/translation="
MEPSRALLGCLASAAAAAPPGEDGAGAGAEEEEEEEEEAAAAVGPGELGCDAPLPYWTAVFEYEAAGEDELTLRLGDVVEVLSKDSQVSGDEGWWTGQLNQRVGIFPSNYVTPRSAFSSRCQPGGEDPSCYPPIQLLEIDFAELTLEEIIGIGGFGKVYRAFWIGDEVAVKAARHDPDEDISQTIENVRQEAKLFAMLKHPNIIALRGVCLKEPNLCLVMEFARGGPLNRVLSGKRIPPDILVNWAVQIARGMNYLHDEAIVPIIHRDLKSSNILILQKVENGDLSNKILKITDFGLAREWHRTTKMSAAGTYAWMAPEVIRASMFSKGSDVWSYGVLLWELLTGEVPFRGIDGLAVAYGVAMNKLALPIPSTCPEPFAKLMEDCWNPDPHSRPSFTNILDQLTTIEESGFFEMPKDSFHCLQDNWKHEIQEMFDQLRAKEKELRTWEEELTRAALQQKNQEELLRRREQELAEREIDILERELNIIIHQLCQEKPRVKKRKGKFRKSRLKLKDGNRISLPSDFQHKFTVQASPTMDKRKSLINSRSSPPASPTIIPRLRAIQLTPGESSKTWGRSSVVPKEEGEEEEKRAPKKKGRTWGPGTLGQKELASGDEGSPQRREKANGLSTPSESPHFHLGLKSLVDGYKQWSSSAPNLVKGPRSSPALPGFTSLMEMALLAASWVVPIDIEEDEDSEGPGSGESRLQHSPSQSYLCIPFPRGEDGDGPSSDGIHEEPTPVNSATSTPQLTPTNSLKRGGAHHRRCEVALLGCGAVLAATGLGFDLLEAGKCQLLPLEEPEPPAREEKKRREGLFQRSSRPRRSTSPPSRKLFKKEEPMLLLGDPSASLTLLSLSSISECNSTRSLLRSDSDEIVVYEMPVSPVEAPPLSPCTHNPLVNVRVERFKRDPNQSLTPTHVTLTTPSQPSSHRRTPSDGALKPETLLASRSPSSNGLSPSPGAGMLKTPSPSRDPGEFPRLPDPNVVFPPTPRRWNTQQDSTLERPKTLEFLPRPRPSANRQRLDPWWFVSPSHARSTSPANSSSTETPSNLDSCFASSSSTVEERPGLPALLPFQAGPLPPTERTLLDLDAEGQSQDSTVPLCRAELNTHRPAPYEIQQEFWS
"
misc_feature 166..339
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="Src Homology 3 domain of Mixed Lineage Kinases 1,
2, and 3; Region: SH3_MLK1-3; cd12059"
/db_xref="CDD:212992"
misc_feature order(181..183,187..189,196..198,208..210,277..282,
319..321,325..330)
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="peptide ligand binding site [polypeptide binding];
other site"
/db_xref="CDD:212992"
misc_feature 430..1209
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="Tyrosine kinase, catalytic domain; Region: TyrKc;
smart00219"
/db_xref="CDD:197581"
misc_feature 442..1212
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="Catalytic domain of Protein Tyrosine Kinases;
Region: PTKc; cd00192"
/db_xref="CDD:173624"
misc_feature order(448..462,472..474,505..507,511..513,658..669,
676..681,802..804,814..819,823..825,880..882,961..963,
1060..1062)
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="active site"
/db_xref="CDD:173624"
misc_feature order(448..453,457..462,472..474,505..507,511..513,
658..669,676..681,814..819,823..825,880..882)
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173624"
misc_feature order(877..897,916..918)
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173624"
misc_feature 910..912
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P80192.3); phosphorylation site"
misc_feature 913..915
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P80192.3); phosphorylation site"
misc_feature 922..924
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P80192.3); phosphorylation site"
misc_feature 934..936
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P80192.3); phosphorylation site"
misc_feature 934..936
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[4]
/db_xref="HPRD:15965"
misc_feature 1288..1353
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P80192.3);
Region: Leucine-zipper 1"
misc_feature 1393..1458
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P80192.3);
Region: Leucine-zipper 2"
exon 1..406
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
variation 79
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:36280"
variation 104..106
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace=""
/replace="agg"
/db_xref="dbSNP:3832971"
exon 407..820
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 821..1001
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1002..1150
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1151..1326
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1327..1567
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
variation 1356
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1990032"
exon 1568..1690
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1691..1844
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1845..1913
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 1914..2026
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 2027..2068
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
exon 2069..2872
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
variation 2276
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="c"
/db_xref="dbSNP:200664597"
variation 2298
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="t"
/db_xref="dbSNP:3814873"
variation 2317
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3814874"
variation 2676
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3829955"
exon 2873..5602
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/inference="alignment:Splign:1.39.8"
STS 3457..4099
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/standard_name="MAP3K9_3244.2"
/db_xref="UniSTS:471490"
variation 4027
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2286053"
variation 4067
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2286054"
polyA_site 4069
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
STS 5389..5519
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/standard_name="D15S1477"
/db_xref="UniSTS:474482"
STS 5422..5512
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/standard_name="D8S2279"
/db_xref="UniSTS:473907"
variation 5599
/gene="MAP3K9"
/gene_synonym="MEKK9; MLK1; PRKE1"
/replace=""
/replace="aa"
/db_xref="dbSNP:71105728"
ORIGIN
atggagccctccagagcgcttctcggctgcctagcgagcgccgccgctgccgccccgccgggggaggatggagcaggggccggggccgaggaggaggaggaggaggaggaggaggcggcggcggcggtgggccccggggagctgggctgcgacgcgccgctgccctactggacggccgtgttcgagtacgaggcggcgggcgaggacgagctgaccctgcggctgggcgacgtggtggaggtgctgtccaaggactcgcaggtgtccggcgacgagggctggtggaccgggcagctgaaccagcgggtgggcatcttccccagcaactacgtgaccccgcgcagcgccttctccagccgctgccagcccggcggcgaggaccccagttgctacccgcccattcagttgttagaaattgattttgcggagctcaccttggaagagattattggcatcgggggctttgggaaggtctatcgtgctttctggataggggatgaggttgctgtgaaagcagctcgccacgaccctgatgaggacatcagccagaccatagagaatgttcgccaagaggccaagctcttcgccatgctgaagcaccccaacatcattgccctaagaggggtatgtctgaaggagcccaacctctgcttggtcatggagtttgctcgtggaggacctttgaatagagtgttatctgggaaaaggattcccccagacatcctggtgaattgggctgtgcagattgccagagggatgaactacttacatgatgaggcaattgttcccatcatccaccgcgaccttaagtccagcaacatattgatcctccagaaggtggagaatggagacctgagcaacaagattctgaagatcactgattttggcctggctcgggaatggcaccgaaccaccaagatgagtgcggcagggacgtatgcttggatggcacccgaagtcatccgggcctccatgttttccaaaggcagtgatgtgtggagctatggggtgctactttgggagttgctgactggtgaggtgccctttcgaggcattgatggcttagcagtcgcttatggagtggccatgaacaaactcgcccttcctattccttctacgtgcccagaaccttttgccaaactcatggaagactgctggaatcctgatccccactcacgaccatctttcacgaatatcctggaccagctaaccaccatagaggagtctggtttctttgaaatgcccaaggactccttccactgcctgcaggacaactggaaacacgagattcaggagatgtttgaccaactcagggccaaagaaaaggaacttcgcacctgggaggaggagctgacgcgggctgcactgcagcagaagaaccaggaggaactgctgcggcgtcgggagcaggagctggccgagcgggagattgacatcctggaacgggagctcaacatcatcatccaccagctgtgccaggagaagccccgggtgaagaaacgcaagggcaagttcaggaagagccggctgaagctcaaggatggcaaccgcatcagcctcccttctgatttccagcacaagttcacggtgcaggcctcccctaccatggataaaaggaagagtcttatcaacagccgctccagtcctcctgcaagccccaccatcattcctcgccttcgagccatccagttgacaccaggtgaaagcagcaaaacctggggcaggagctcagtcgtcccaaaggaggaaggggaggaggaggagaagagggccccaaagaagaagggacggacgtgggggccagggacgcttggtcagaaggagcttgcctcgggagatgaaggatcccctcagagacgtgagaaagctaatggtttaagtaccccatcagaatctccacatttccacttgggcctcaagtccctggtagatggatataagcagtggtcgtccagtgcccccaacctggtgaagggcccaaggagtagcccggccctgccagggttcaccagccttatggagatggccttgctggcagccagttgggtggtgcccatcgacattgaagaggatgaggacagtgaaggcccagggagtggagagagtcgcctacagcattcacccagccagtcctacctctgtatcccattccctcgtggagaggatggcgatggcccctccagtgatggaatccatgaggagcccaccccagtcaactcggccacgagtacccctcagctgacgccaaccaacagcctcaagcggggcggtgcccaccaccgccgctgcgaggtggctctgctcggctgtggggctgttctggcagccacaggcctagggtttgacttgctggaagctggcaagtgccagctgcttcccctggaggagcctgagccaccagcccgggaggagaagaaaagacgggagggtctttttcagaggtccagccgtcctcgtcggagcaccagccccccatcccgaaagcttttcaagaaggaggagcccatgctgttgctaggagacccctctgcctccctgacgctgctctccctctcctccatctccgagtgcaactccacacgctccctgctgcgctccgacagcgatgaaattgtcgtgtatgagatgccagtcagcccagtcgaggcccctcccctgagtccatgtacccacaaccccctggtcaatgtccgagtagagcgcttcaaacgagatcctaaccaatctctgactcccacccatgtcaccctcaccaccccctcgcagcccagcagtcaccggcggactccttctgatggggcccttaagccagagactctcctagccagcaggagcccctccagcaatgggttgagccccagtcctggagcaggaatgttgaaaacccccagtcccagccgagacccaggtgaattcccccgtctccctgaccccaatgtggtcttccccccaaccccaaggcgctggaacactcagcaggactctaccttggagagacccaagactctggagtttctgcctcggccgcgtccttctgccaaccggcaacggctggacccttggtggtttgtgtcccccagccatgcccgcagcacctccccagccaacagctccagcacagagacgcccagcaacctggactcctgctttgctagcagtagcagcactgtagaggagcggcctggacttccagccctgctcccgttccaggcagggccgctgcccccgactgagcggacgctcctggacctggatgcagaggggcagagtcaggacagcaccgtgccgctgtgcagagcggaactgaacacacacaggcctgccccttatgagatccagcaggagttctggtcttagcacgaaaaggattggggcgggcaagggggacagccagcggagatgaggggagctggcgggcacagccctttctcagggttggaccccctgagatccagccctacttcttgcactgataatgcactttgaagatggaagggatggaaacagggccacttcagagggtctcctgccctgcagggcctttctacccgtgtccactggaggggctgtggccatcagctctggctgtgtaggggaggaaggggtgcatgcatgtcccccaccctccacagtcttccttgcctttagagtgaccctgcagagtcactcagccaaatctgtctgctgctccctctcctcagccagttgggtgtgcgcagagctgtcatagggtccctttgtcagccccgagttcagcttcccaaacaccagtgttggatattctgtgattgattttggtcctcctccgctgtcccccaacacccaggaatgggaatctggcttggttcgagataggagcttttctgtgtcctaagccctttcatgctagcaggaagactgaaagcaaggtggcccagtgtggggtcatagggcttgatagacctggcactgcctatctgcacttccaggtgccccacctatttatctgagcccacaggtggaaaggggaactgcctcagtgagaacggggggacggggatgttaggaaaaatacagtaaagttgcaatgaagaggttcatgaagtatgtccttgttctttttggaaactctcggcaaagggcaaaccagcaagtattgagggtacccatctagctacttggggtcaggacctcgtcagaccaggttcggatacaatcatctgctcatcccaggaatagtttcttgggggactcactcactggtgccagttctaagtcagagacaaaattccactgtctgttccttttgctgtctgaactttatgtgttactcccttcctttggtcttcactctaatccctggagtttgtgggcttttggttatgtttggttagtagatatcaccgcaatgccctagaacagctatgaagcagaataccatatggccacctggacattgggacttgggaattcactctcaactgggccatccatgttgtgatgcccttgaagtaaaatggagccagcaggagtaccttctgtaaatgcatgtggcaaagtgctatttatagggtgcccagggagccgctgatgtacaataaccttgaggtcccccatactgaaaactgaccaaggcctgtgcacaggtagcccctcatgctgggctctggaccatgagctgagtaggaaggatagcagaggccaaccctgaccttcctggaagttgtttccttaacttgaatgttgagcttcctctaaagctttctcgtgtatgtcttctccatgccactactctgaggcctcctgtgttatgtgtgaacagttgtctttatgtgggaatgacgacttgattgggagtagagtctcaaggtcattcccctcttccctcaagactctctgaatgctgctccactgtcttttgtcttggaggtcactcagcaggttccttgcatttgctgcctggatgtgcagctggcaacagtgatgaattggtcactgctctttctctataactgggatagatgtcctgccttggggtcactaaaggggtgaccttgttccttgctttatgagcccattagcactttggttcaaggggcccaccaagtcttggacgggaaggcgctactggttttattgcccaaggttttgttattgcttctcttctgtgtccttctctttgttcagtgaagccaatatgtaagatactgtttttgtccccattcccctactcctgagctaggaggaaaaaatgtgaatcttaccagcagttccagccaaccaagtgattcttcttcattcttgatggggagaagtacatacaaagtttgttctgacagggcgcggtggctcacgcctgtaatcccagcgctttgggaggcagaggcaggtggatcacctgaggtcgggagttcgagaccagcctgaccaacatggagatatcctgtctctactaaaaatacaaaaaaattagccaggcatggtggcacgtgcctgtaatcccagctactcgcaaggctgaggcaggagaatcgcttgaacctgggaggcggaggttgcagtgagccaagattgcgccattgcactccagcctgggcaacaagagagaaactctgtctcaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:4293 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:4293 -> Molecular function: GO:0004706 [JUN kinase kinase kinase activity] evidence: ISS
GeneID:4293 -> Molecular function: GO:0004708 [MAP kinase kinase activity] evidence: NAS
GeneID:4293 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
GeneID:4293 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:4293 -> Molecular function: GO:0005524 [ATP binding] evidence: NAS
GeneID:4293 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: ISS
GeneID:4293 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:4293 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:4293 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:4293 -> Biological process: GO:0006468 [protein phosphorylation] evidence: NAS
GeneID:4293 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:4293 -> Biological process: GO:0007256 [activation of JNKK activity] evidence: ISS
GeneID:4293 -> Biological process: GO:0007257 [activation of JUN kinase activity] evidence: ISS
GeneID:4293 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:4293 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_149132 -> EC 2.7.11.25
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.