2024-04-20 08:38:57, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033027 3188 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens cysteine-serine-rich nuclear protein 1 (CSRNP1), mRNA. ACCESSION NM_033027 VERSION NM_033027.3 GI:224593753 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3188) AUTHORS Gingras,S., Pelletier,S., Boyd,K. and Ihle,J.N. TITLE Characterization of a family of novel cysteine- serine-rich nuclear proteins (CSRNP) JOURNAL PLoS ONE 2 (8), E808 (2007) PUBMED 17726538 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 3188) AUTHORS Ishiguro,H., Tsunoda,T., Tanaka,T., Fujii,Y., Nakamura,Y. and Furukawa,Y. TITLE Identification of AXUD1, a novel human gene induced by AXIN1 and its reduced expression in human carcinomas of the lung, liver, colon and kidney JOURNAL Oncogene 20 (36), 5062-5066 (2001) PUBMED 11526492 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC092053.3. On Mar 6, 2009 this sequence version replaced gi:17136074. Summary: This gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The Wnt signalling pathway, which is negatively regulated by axin, is important in axis formation in early development and impaired regulation of this signalling pathway is often involved in tumors. A decreased level of expression of this gene in tumors compared to the level of expression in their corresponding normal tissues suggests that this gene product has a tumor suppressor function. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AB053121.1, BC038949.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-174 AC092053.3 141551-141724 175-419 AC092053.3 148440-148684 420-679 AC092053.3 149906-150165 680-994 AC092053.3 150711-151025 995-3188 AC092053.3 151118-153311 FEATURES Location/Qualifiers source 1..3188 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3p22" gene 1..3188 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /note="cysteine-serine-rich nuclear protein 1" /db_xref="GeneID:64651" /db_xref="HGNC:14300" /db_xref="MIM:606458" exon 1..174 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /inference="alignment:Splign:1.39.8" exon 175..419 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /inference="alignment:Splign:1.39.8" CDS 215..1984 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /note="AXIN1 up-regulated 1; TGF-beta induced apoptosis protein 3; axin-1 up-regulated gene 1 protein; TGF-beta-induced apoptosis protein 3" /codon_start=1 /product="cysteine/serine-rich nuclear protein 1" /protein_id="NP_149016.2" /db_xref="GI:224593754" /db_xref="CCDS:CCDS2682.1" /db_xref="GeneID:64651" /db_xref="HGNC:14300" /db_xref="MIM:606458" /translation="
MTGLLKRKFDQLDEDNSSVSSSSSSSGCQSRSCSPSSSVSRAWDSEEEGPWDQMPLPDRDFCGPRSFTPLSILKRARRERPGRVAFDGITVFYFPRCQGFTSVPSRGGCTLGMALRHSACRRFSLAEFAQEQARARHEKLRQRLKEEKLEMLQWKLSAAGVPQAEAGLPPVVDAIDDASVEEDLAVAVAGGRLEEVSFLQPYPARRRRALLRASGVRRIDREEKRELQALRQSREDCGCHCDRICDPETCSCSLAGIKCQMDHTAFPCGCCREGCENPMGRVEFNQARVQTHFIHTLTRLQLEQEAESFRELEAPAQGSPPSPGEEALVPTFPLAKPPMNNELGDNSCSSDMTDSSTASSSASGTSEAPDCPTHPGLPGPGFQPGVDDDSLARILSFSDSDFGGEEEEEEEGSVGNLDNLSCFHPADIFGTSDPGGLASWTHSYSGCSFTSGVLDENANLDASCFLNGGLEGSREGSLPGTSVPPSMDAGRSSSVDLSLSSCDSFELLQALPDYSLGPHYTSQKVSDSLDNIEAPHFPLPGLSPPGDASSCFLESLMGFSEPAAEALDPFIDSQFEDTVPASLMEPVPV
" exon 420..679 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /inference="alignment:Splign:1.39.8" variation 439 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:784517" exon 680..994 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /inference="alignment:Splign:1.39.8" exon 995..3188 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /inference="alignment:Splign:1.39.8" variation 1282 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="c" /replace="t" /db_xref="dbSNP:784519" variation 1453 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="c" /replace="t" /db_xref="dbSNP:1274957" variation 1571 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="a" /replace="g" /db_xref="dbSNP:1274958" variation 2177 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="a" /replace="g" /db_xref="dbSNP:704960" STS 2249..2399 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /standard_name="SHGC-76832" /db_xref="UniSTS:76949" variation 2635 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /replace="c" /replace="t" /db_xref="dbSNP:784501" STS 2899..3132 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /standard_name="RH80080" /db_xref="UniSTS:86336" STS 2954..3166 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" /standard_name="D3S3824" /db_xref="UniSTS:21259" polyA_signal 3164..3169 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" polyA_site 3184 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" polyA_site 3188 /gene="CSRNP1" /gene_synonym="AXUD1; CSRNP-1; FAM130B; TAIP-3; URAX1" ORIGIN
gggcggggctgggcgcaggcagtctcccgccgccgccgccgctgccggacgcgcagagcgaggggcggctggaccgacggctgccgggccgagcgcacagagtcgcggcgcagggggcgtccccggccgggacgcgggtcgcgtcgttgtcctccgcgagcgtccggattgcaggctgtctgtccccagaccccagagcacgtccggcaccaccatgactgggctgttgaagaggaaatttgaccagctggatgaggacaactcctcggtctcctcctcctcctcttcctctgggtgccagtctcgctcctgctccccaagctcttctgtctcccgtgcctgggactcagaggaggaaggcccctgggatcagatgcccctgcctgaccgtgacttctgcggccccagaagtttcacccccctgtctatcctgaagcgggctcgccgggagcgcccaggccgtgtagcctttgatgggatcaccgtcttctacttcccccgctgccagggcttcaccagtgtgcccagccgtggtggctgtactctgggtatggcccttcgccacagtgcttgccgtcgcttctctttggctgagtttgcgcaggagcaagcccgtgcacggcacgagaagctccgccagcgcttgaaagaggagaagttggagatgctgcagtggaagctttcggcagctggggtaccccaggcagaggcagggctgccacctgtggtggatgccattgatgacgcctctgtggaggaggacttggcagtcgctgtggcaggtggccggttggaagaagtgagcttcctacagccctacccagcccggcgacgtcgagctctgctgagggcttcaggtgtgcgaaggatcgatcgggaggagaagcgggagctgcaggcactgcgccaatcccgggaggattgtggctgtcactgcgataggatctgcgaccctgagacctgcagctgcagcctggcaggcatcaagtgccagatggaccacacagcattcccctgtggctgctgcagggagggctgtgagaaccccatgggccgtgtggaatttaatcaggcaagagttcagacccatttcatccacacactcacccgcctgcagttggaacaggaggctgagagctttagggagctggaggcccctgcccagggcagcccacccagccctggtgaggaggccctggtccctactttcccactggccaagccccccatgaacaatgagctgggagacaacagctgcagcagcgacatgactgattcttctacagcatcttcatcagcatcgggcactagtgaggctcctgactgccccacccacccaggcctgcctggccctggcttccagcctggcgttgatgatgacagcctggcacgcatcttgagtttcagtgactctgacttcggtggggaggaggaggaagaggaggaagggagcgtggggaacctggacaacctcagctgcttccatccagctgacatctttggtactagtgaccctggtggcctggccagctggacccacagctattctggctgtagcttcacatcaggcgtcctggatgagaatgccaacctggatgccagctgcttcctaaatggtggccttgaagggtcaagggaaggcagccttcctggcacctcagtgccacccagcatggacgctggccggagtagctcagtggatctcagcttgtcttcttgtgactcctttgagttactccaggctctgccagattatagtctggggcctcactacacatcacagaaggtgtctgacagcctggacaacatcgaggcacctcacttccccctgcctggcctgtctccacctggggatgccagcagttgcttcctggagtccctcatgggcttctccgagccagccgccgaagccctagatccctttattgacagccagtttgaggacactgtcccagcatctctaatggagcctgtgccggtgtgaggaccaggatgtcttttcccagccccaagagacctgttgctgctttcttgtaattatggggctccccagagtctgcgtaacagtctcccactggctggctcacccacaggtgccatgtgcacactcctggttttcaaacaattctctggatttatttatttgttttaacttttctgtgctgaagagaggactggggggagggggcttcccctttcagctgcccggccccccacacccacagcttgctcttctatctccacaacgtgagcctggaagaggagaaaatgtggctcctctggagcttggcagaccacttttcggtctttgcgtgatgttccttagcccaaagacggtgagacagggctgaaatcaggtggcttctgccaccctgagccctagacccatgggtggctaaatccactggactgtgaagactataatttatttccataatttatttggagattgaggaggctttggttgcacttctttggctggtgggtaatgccaggggtggggtgggcacaggccctcaagagccccttttgccttgtagtcctacaccttgccctgcctgggctttggtgcagactaggtgtggatttgagctctgtgatctatgtctgctgcctggctcctagatggctctgtgggcaggtgctggccaaggacatcatctaggcagggggagagcctgggctgaacagctgtgaccaaaactcccttctgccccaccctgccccctccacttcctgccctctgttccatcttcccccttcccaaaggccacagcctttattccaggcccagggatgtaggagggggaaggaggaaacaggaagcccagagagggcaaagggcctacctcggggcgcgaaccatgccccagactattatctcagggctttctgggcactgcacttcagcgtggcccacctgcccatgccctgaggccagttggcgaggggtggctcctgagggtttttataccctttgtttgctaatgtttaattttgcatcataatttctacattgtccctgagtgtcagaactataatttattccatttctctctgtgtctgtgccaagaaacgcaggctctgggcctgccccttgcccaggaggccttgccagcctgtgtgcttgtgggaacaccttgtacctgagcttacaggtaccaataaagaggctttatttttagcaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:64651 -> Molecular function: GO:0003674 [molecular_function] evidence: ND GeneID:64651 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA GeneID:64651 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: ISS GeneID:64651 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:64651 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS GeneID:64651 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA GeneID:64651 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: ISS GeneID:64651 -> Biological process: GO:0048008 [platelet-derived growth factor receptor signaling pathway] evidence: IEA GeneID:64651 -> Biological process: GO:0048705 [skeletal system morphogenesis] evidence: IEA GeneID:64651 -> Biological process: GO:0060021 [palate development] evidence: IEA GeneID:64651 -> Biological process: GO:0060325 [face morphogenesis] evidence: IEA GeneID:64651 -> Cellular component: GO:0005575 [cellular_component] evidence: ND GeneID:64651 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:64651 -> Cellular component: GO:0005634 [nucleus] evidence: ISS GeneID:64651 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.