GGRNA Home | Help | Advanced search

2020-10-26 19:49:00, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_033026              20288 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens piccolo presynaptic cytomatrix protein (PCLO),
            transcript variant 1, mRNA.
ACCESSION   NM_033026 XM_168530 XM_374484
VERSION     NM_033026.5  GI:160707974
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 20288)
  AUTHORS   Woudstra,S., Bochdanovits,Z., van Tol,M.J., Veltman,D.J.,
            Zitman,F.G., van Buchem,M.A., van der Wee,N.J., Opmeer,E.M.,
            Demenescu,L.R., Aleman,A., Penninx,B.W. and Hoogendijk,W.J.
  TITLE     Piccolo genotype modulates neural correlates of emotion processing
            but not executive functioning
  JOURNAL   Transl Psychiatry 2, E99 (2012)
   PUBMED   22832909
  REMARK    GeneRIF: The PCLO risk allele was found to be specifically
            associated with altered emotion processing, but not with executive
            dysfunction. Moreover, the PCLO risk allele appears to modulate
            amygdala function during fearful facial processing.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 20288)
  AUTHORS   Inoue,K., Ando,N., Suzuki,E., Hayashi,H., Tsuji,D. and Itoh,K.
  TITLE     Genotype distributions and allele frequencies of possible major
            depressive disorder-associated single nucleotide polymorphisms,
            cyclic adenosine monophosphate response element binding protein 1
            rs4675690 and Piccolo rs2522833, in a Japanese population
  JOURNAL   Biol. Pharm. Bull. 35 (2), 265-268 (2012)
   PUBMED   22293360
  REMARK    GeneRIF: In this study, the genotype distributions and allele
            frequencies of PCLO rs2522833 polymorphisms were examined in 267
            Japanese healthy subjects
REFERENCE   3  (bases 1 to 20288)
  AUTHORS   Aragam,N., Wang,K.S. and Pan,Y.
  TITLE     Genome-wide association analysis of gender differences in major
            depressive disorder in the Netherlands NESDA and NTR
            population-based samples
  JOURNAL   J Affect Disord 133 (3), 516-521 (2011)
   PUBMED   21621269
  REMARK    GeneRIF: In major depressive disorder genome-wide association
            study, best femalee-specific SNP was rs2715148 within PCLO gene
REFERENCE   4  (bases 1 to 20288)
  AUTHORS   Choi,K.H., Higgs,B.W., Wendland,J.R., Song,J., McMahon,F.J. and
            Webster,M.J.
  TITLE     Gene expression and genetic variation data implicate PCLO in
            bipolar disorder
  JOURNAL   Biol. Psychiatry 69 (4), 353-359 (2011)
   PUBMED   21185011
  REMARK    GeneRIF: one SNP (rs13438494), in an intron of the piccolo gene,
            was significantly associated with bipolar disorder
REFERENCE   5  (bases 1 to 20288)
  AUTHORS   Kuehner,C., Huffziger,S., Witt,S.H. and Rietschel,M.
  TITLE     PCLO rs2522833 impacts HPA system activity in healthy young adults
  JOURNAL   Transl Psychiatry 1, E10 (2011)
   PUBMED   22832399
  REMARK    GeneRIF: Single-nucleotide polymorphism rs2522833 within the PCLO
            gene might increase vulnerability to major depression both by
            physiological and behavioral pathways.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 20288)
  AUTHORS   Ma,L., Hanson,R.L., Que,L.N., Guo,Y., Kobes,S., Bogardus,C. and
            Baier,L.J.
  TITLE     PCLO variants are nominally associated with early-onset type 2
            diabetes and insulin resistance in Pima Indians
  JOURNAL   Diabetes 57 (11), 3156-3160 (2008)
   PUBMED   18647954
  REMARK    GeneRIF: Variation within PCLO may have a modest effect on
            early-onset type 2 diabetes, possibly as a result of reduced
            insulin action, but has minimal, if any, impact on population-based
            risk for type 2 diabetes.
REFERENCE   7  (bases 1 to 20288)
  AUTHORS   Fenster,S.D. and Garner,C.C.
  TITLE     Gene structure and genetic localization of the PCLO gene encoding
            the presynaptic active zone protein Piccolo
  JOURNAL   Int. J. Dev. Neurosci. 20 (3-5), 161-171 (2002)
   PUBMED   12175852
REFERENCE   8  (bases 1 to 20288)
  AUTHORS   Fenster,S.D., Chung,W.J., Zhai,R., Cases-Langhoff,C., Voss,B.,
            Garner,A.M., Kaempf,U., Kindler,S., Gundelfinger,E.D. and
            Garner,C.C.
  TITLE     Piccolo, a presynaptic zinc finger protein structurally related to
            bassoon
  JOURNAL   Neuron 25 (1), 203-214 (2000)
   PUBMED   10707984
REFERENCE   9  (bases 1 to 20288)
  AUTHORS   Wang,X., Kibschull,M., Laue,M.M., Lichte,B., Petrasch-Parwez,E. and
            Kilimann,M.W.
  TITLE     Aczonin, a 550-kD putative scaffolding protein of presynaptic
            active zones, shares homology regions with Rim and Bassoon and
            binds profilin
  JOURNAL   J. Cell Biol. 147 (1), 151-162 (1999)
   PUBMED   10508862
REFERENCE   10 (bases 1 to 20288)
  AUTHORS   Cases-Langhoff,C., Voss,B., Garner,A.M., Appeltauer,U., Takei,K.,
            Kindler,S., Veh,R.W., De Camilli,P., Gundelfinger,E.D. and
            Garner,C.C.
  TITLE     Piccolo, a novel 420 kDa protein associated with the presynaptic
            cytomatrix
  JOURNAL   Eur. J. Cell Biol. 69 (3), 214-223 (1996)
   PUBMED   8900486
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC093461.4, AC004903.2,
            AC004886.1, AC080093.6, AC004082.1 and AC004006.1.
            On Nov 20, 2007 this sequence version replaced gi:150378538.
            
            Summary: The protein encoded by this gene is part of the
            presynaptic cytoskeletal matrix, which is involved in establishing
            active synaptic zones and in synaptic vesicle trafficking.
            Variations in this gene have been associated with bipolar disorder
            and major depressive disorder. Two transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Nov 2011].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-537               AC093461.4         12140-12676         c
            538-2182            AC093461.4         4543-6187           c
            2183-3589           AC004903.2         100914-102320       c
            3590-4306           AC004886.1         75599-76315         c
            4307-9386           AC004886.1         61684-66763         c
            9387-11401          AC004886.1         59304-61318         c
            11402-13589         AC004886.1         24514-26701         c
            13590-13726         AC004886.1         18705-18841         c
            13727-13817         AC004886.1         12479-12569         c
            13818-13943         AC080093.6         26487-26612         c
            13944-14052         AC004082.1         92118-92226         c
            14053-14120         AC004082.1         91546-91613         c
            14121-14335         AC004082.1         90250-90464         c
            14336-14386         AC004082.1         86438-86488         c
            14387-14511         AC004082.1         83197-83321         c
            14512-14538         AC004082.1         80646-80672         c
            14539-14632         AC004082.1         72852-72945         c
            14633-14704         AC004082.1         71568-71639         c
            14705-14885         AC004082.1         69215-69395         c
            14886-15080         AC004082.1         67474-67668         c
            15081-15222         AC004082.1         50667-50808         c
            15223-15296         AC004082.1         46497-46570         c
            15297-15431         AC004082.1         6338-6472           c
            15432-15577         AC004082.1         5618-5763           c
            15578-19271         AC004082.1         1-3694              c
            19272-20288         AC004006.1         118237-119253       c
FEATURES             Location/Qualifiers
     source          1..20288
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q11.23-q21.3"
     gene            1..20288
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="piccolo presynaptic cytomatrix protein"
                     /db_xref="GeneID:27445"
                     /db_xref="HGNC:13406"
                     /db_xref="MIM:604918"
     exon            1..537
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    284..286
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="upstream in-frame stop codon"
     CDS             290..15718
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="isoform 1 is encoded by transcript variant 1;
                     aczonin; protein piccolo; piccolo (presynaptic cytomatrix
                     protein)"
                     /codon_start=1
                     /product="protein piccolo isoform 1"
                     /protein_id="NP_149015.2"
                     /db_xref="GI:150378539"
                     /db_xref="CCDS:CCDS47630.1"
                     /db_xref="GeneID:27445"
                     /db_xref="HGNC:13406"
                     /db_xref="MIM:604918"
                     /translation="
MGNEASLEGEGLPEGLAAAAAAGGGASGAGSPSHTAIPAGMEADLSQLSEEERRQIAAVMSRAQGLPKGSVPPAAAESPSMHRKQELDSSHPPKQSGRPPDPGRPAQPGLSKSRTTDTFRSEQKLPGRSPSTISLKESKSRTDLKEEHKSSMMPGFLSEVNALSAVSSVVNKFNPFDLISDSEASQEETTKKQKVVQKEQGKPEGIIKPPLQQQPPKPIPKQQGPGRDPLQQDGTPKSISSQQPEKIKSQPPGTGKPIQGPTQTPQTDHAKLPLQRDASRPQTKQADIVRGESVKPSLPSPSKPPIQQPTPGKPPAQQPGHEKSQPGPAKPPAQPSGLTKPLAQQPGTVKPPVQPPGTTKPPAQPLGPAKPPAQQTGSEKPSSEQPGPKALAQPPGVGKTPAQQPGPAKPPTQQVGTPKPLAQQPGLQSPAKAPGPTKTPVQQPGPGKIPAQQAGPGKTSAQQTGPTKPPSQLPGPAKPPPQQPGPAKPPPQQPGSAKPPSQQPGSTKPPPQQPGPAKPSPQQPGSTKPPSQQPGSAKPSAQQPSPAKPSAQQSTKPVSQTGSGKPLQPPTVSPSAKQPPSQGLPKTICPLCNTTELLLHVPEKANFNTCTECQTTVCSLCGFNPNPHLTEVKEWLCLNCQMKRALGGDLAPVPSSPQPKLKTAPVTTTSAVSKSSPQPQQTSPKKDAAPKQDLSKAPEPKKPPPLVKQPTLHGSPSAKAKQPPEADSLSKPAPPKEPSVPSEQDKAPVADDKPKQPKMVKPTTDLVSSSSATTKPDIPSSKVQSQAEEKTTPPLKTDSAKPSQSFPPTGEKVSPFDSKAIPRPASDSKIISHPGPSSESKGQKQVDPVQKKEEPKKAQTKMSPKPDAKPMPKGSPTPPGPRPTAGQTVPTPQQSPKPQEQSRRFSLNLGSITDAPKSQPTTPQETVTGKLFGFGASIFSQASNLISTAGQPGPHSQSGPGAPMKQAPAPSQPPTSQGPPKSTGQAPPAPAKSIPVKKETKAPAAEKLEPKAEQAPTVKRTETEKKPPPIKDSKSLTAEPQKAVLPTKLEKSPKPESTCPLCKTELNIGSKDPPNFNTCTECKNQVCNLCGFNPTPHLTEIQEWLCLNCQTQRAISGQLGDIRKMPPAPSGPKASPMPVPTESSSQKTAVPPQVKLVKKQEQEVKTEAEKVILEKVKETLSMEKIPPMVTTDQKQEESKLEKDKASALQEKKPLPEEKKLIPEEEKIRSEEKKPLLEEKKPTPEDKKLLPEAKTSAPEEQKHDLLKSQVQIAEEKLEGRVAPKTVQEGKQPQTKMEGLPSGTPQSLPKEDDKTTKTIKEQPQPPCTAKPDQVEPGKEKTEKEDDKSDTSSSQQPKSPQGLSDTGYSSDGISSSLGEIPSLIPTDEKDILKGLKKDSFSQESSPSSPSDLAKLESTVLSILEAQASTLADEKSEKKTQPHEVSPEQPKDQEKTQSLSETLEITISEEEIKESQEERKDTFKKDSQQDIPSSKDHKEKSEFVDDITTRREPYDSVEESSESENSPVPQRKRRTSVGSSSSDEYKQEDSQGSGEEEDFIRKQIIEMSADEDASGSEDDEFIRNQLKEISSSTESQKKEETKGKGKITAGKHRRLTRKSSTSIDEDAGRRHSWHDEDDEAFDESPELKYRETKSQESEELVVTGGGGLRRFKTIELNSTIADKYSAESSQKKTSLYFDEEPELEMESLTDSPEDRSRGEGSSSLHASSFTPGTSPTSVSSLDEDSDSSPSHKKGESKQQRKARHRPHGPLLPTIEDSSEEEELREEEELLKEQEKQREIEQQQRKSSSKKSKKDKDELRAQRRRERPKTPPSNLSPIEDASPTEELRQAAEMEELHRSSCSEYSPSIESDPEGFEISPEKIIEVQKVYKLPTAVSLYSPTDEQSIMQKEGSQKALKSAEEMYEEMMHKTHKYKAFPAANERDEVFEKEPLYGGMLIEDYIYESLVEDTYNGSVDGSLLTRQEEENGFMQQKGREQKIRLSEQIYEDPMQKITDLQKEFYELESLHSVVPQEDIVSSSFIIPESHEIVDLGTMVTSTEEERKLLDADAAYEELMKRQQMQLTPGSSPTQAPIGEDMTESTMDFDRMPDASLTSSVLSGASLTDSTSSATLSIPDVKITQHFSTEEIEDEYVTDYTREIQEIIAHESLILTYSEPSESATSVPPSDTPSLTSSVSSVCTTDSSSPITTLDSITTVYTEPVDMITKFEDSEEISSSTYFPGSIIDYPEEISVSLDRTAPPDGRASADHIVISLSDMASSIIESVVPKPEGPVADTVSTDLLISEKDPVKKAKKETGNGIILEVLEAYRDKKELEAERTKSSLSETVFDHPPSSVIALPMKEQLSTTYFTSGETFGQEKPASQLPSGSPSVSSLPAKPRPFFRSSSLDISAQPPPPPPPPPPPPPPPPPPPPPPLPPPTSPKPTILPKKKLTVASPVTTATPLFDAVTTLETTAVLRSNGLPVTRICTTAPPPVPPKPSSIPSGLVFTHRPEPSKPPIAPKPVIPQLPTTTQKPTDIHPKPTGLSLTSSMTLNLVTSADYKLPSPTSPLSPHSNKSSPRFSKSLTETYVVITLPSEPGTPTDSSASQAITSWPLGSPSKDLVSVEPVFSVVPPVTAVEIPISSEQTFYISGALQTFSATPVTAPSSFQAAPTSVTQFLTTEVSKTEVSATRSTAPSVGLSSISITIPPEPLALDNIHLEKPQYKEDGKLQLVGDVIDLRTVPKVEVKTTDKCIDLSASTMDVKRQITANEVYGKQISAVQPSIINLSVTSSIVTPVSLATETVTFVTCTASASYTTGTESLVGAEHAMTTPLQLTTSKHAEPPYRIPSDQVFPIAREEAPINLSLGTPAHAVTLAITKPVTVPPVGVTNGWTDSTVSQGITDGEVVDLSTTKSHRTVVTMDESTSSVMTKIIEDEKPVDLTAGRRAVCCDVVYKLPFGRSCTAQQPATTLPEDRFGYRDDHYQYDRSGPYGYRGIGGMKPSMSDTNLAEAGHFFYKSKNAFDYSEGTDTAVDLTSGRVTTGEVMDYSSKTTGPYPETRQVISGAGISTPQYSTARMTPPPGPQYCVGSVLRSSNGVVYSSVATPTPSTFAITTQPGSIFSTTVRDLSGIHTADAVTSLPAMHHSQPMPRSYFITTGASETDIAVTGIDISASLQTITMESLTAETIDSVPTLTTASEVFPEVVGDESALLIVPEEDKQQQQLDLERELLELEKIKQQRFAEELEWERQEIQRFREQEKIMVQKKLEELQSMKQHLLFQQEEERQAQFMMRQETLAQQQLQLEQIQQLQQQLHQQLEEQKIRQIYQYNYDPSGTASPQTTTEQAILEGQYAALEGSQFWATEDATTTASAVVAIEIPQSQGWYTVQSDGVTQYIAPPGILSTVSEIPLTDVVVKEEKQPKKRSSGAKVRGQYDDMGENMTDDPRSFKKIVDSGVQTDDEDATDRSYVSRRRRTKKSVDTSVQTDDEDQDEWDMPTRSRRKARVGKYGDSMTEADKTKPLSKVSSIAVQTVAEISVQTEPVGTIRTPSIRARVDAKVEIIKHISAPEKTYKGGSLGCQTEADSDTQSPQYLSATSPPKDKKRPTPLEIGYSSHLRADSTVQLAPSPPKSPKVLYSPISPLSPGKALESAFVPYEKPLPDDISPQKVLHPDMAKVPPASPKTAKMMQRSMSDPKPLSPTADESSRAPFQYTEGYTTKGSQTMTSSGAQKKVKRTLPNPPPEEISTGTQSTFSTMGTVSRRRICRTNTMARAKILQDIDRELDLVERESAKLRKKQAELDEEEKEIDAKLRYLEMGINRRKEALLKEREKRERAYLQGVAEDRDYMSDSEVSSTRPTRIESQHGIERPRTAPQTEFSQFIPPQTQTESQLVPPTSPYTQYQYSSPALPTQAPTSYTQQSHFEQQTLYHQQVSPYQTQPTFQAVATMSFTPQVQPTPTPQPSYQLPSQMMVIQQKPRQTTLYLEPKITSNYEVIRNQPLMIAPVSTDNTFAVSHLGSKYNSLDLRIGLEERSSMASSPISSISADSFYADIDHHTPRNYVLIDDIGEITKGTAALSTAFSLHEKDLSKTDRLLRTTETRRSQEVTDFLAPLQSSSRLHSYVKAEEDPMEDPYELKLLKHQIKQEFRRGTESLDHLAGLSHYYHADTSYRHFPKSEKYSISRLTLEKQAAKQLPAAILYQKQSKHKKSLIDPKMSKFSPIQESRDLEPDYSSYMTSSTSSIGGISSRARLLQDDITFGLRKNITDQQKFMGSSLGTGLGTLGNTIRSALQDEADKPYSSGSRSRPSSRPSSVYGLDLSIKRDSSSSSLRLKAQEAEALDVSFSHASSSARTKPTSLPISQSRGRIPIVAQNSEEESPLSPVGQPMGMARAAAGPLPPISADTRDQFGSSHSLPEVQQHMREESRTRGYDRDIAFIMDDFQHAMSDSEAYHLRREETDWFDKPRESRLENGHGLDRKLPERLVHSRPLSQHQEQIIQMNGKTMHYIFPHARIKITRDSKDHTVSGNGLGIRIVGGKEIPGHSGEIGAYIAKILPGGSAEQTGKLMEGMQVLEWNGIPLTSKTYEEVQSIISQQSGEAEICVRLDLNMLSDSENSQHLELHEPPKAVDKAKSPGVDPKQLAAELQKVSLQQSPLVLSSVVEKGSHVHSGPTSAGSSSVPSPGQPGSPSVSKKKHGSSKPTDGTKVVSHPITGEIQLQINYDLGNLIIHILQARNLVPRDNNGYSDPFVKVYLLPGRGQVMVVQNASAEYKRRTKHVQKSLNPEWNQTVIYKSISMEQLKKKTLEVTVWDYDRFSSNDFLGEVLIDLSSTSHLDNTPRWYPLKEQTESIDHGKSHSSQSSQQSPKPSVIKSRSHGIFPDPSKDMQVPTIEKSHSSPGSSKSSSEGHLRSHGPSRSQSKTSVTQTHLEDAGAAIAAAEAAVQQLRIQPTKPPNHRPAESSVSTGSSGSSFGSGYSVDSEGSSSTAGETNLFPIPRIGKMGQNGQEPVKQPGVGVGLADTEAKTQVMGEIKIALKKEMKTDGEQLIVEILQCRNITYKFKSPDHLPDLYVKIYVMNISTQKKVIKKKTRVCRHDREPSFNETFRFSLSPAGHSLQILLFSNGGKFMKKTLIGEACIWLDKVDLRKRIVNWHKLLVSPTQTH
"
     misc_feature    2042..2227
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="Piccolo Zn-finger; Region: zf-piccolo; pfam05715"
                     /db_xref="CDD:203315"
     misc_feature    3452..3634
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="Piccolo Zn-finger; Region: zf-piccolo; pfam05715"
                     /db_xref="CDD:203315"
     misc_feature    13775..14050
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(13823..13834,13838..13840,14000..14005,14012..14017)
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    14369..14767
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="C2 domain first repeat contained in
                     Rab3-interacting molecule (RIM) proteins; Region:
                     C2A_RIM1alpha; cd04031"
                     /db_xref="CDD:175997"
     misc_feature    order(14456..14458,14474..14476,14666..14668,14672..14674,
                     14690..14692)
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:175997"
     misc_feature    15302..15691
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="C2 domain; Region: C2; cl14603"
                     /db_xref="CDD:212363"
     exon            538..2182
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            2183..3589
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     STS             2686..2814
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /standard_name="SHGC-56120"
                     /db_xref="UniSTS:34164"
     exon            3590..4306
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     variation       4236
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201051025"
     exon            4307..9386
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    <5209..5234
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="match to EST AA604136 (NID:g2444706) no72f09.s1"
     exon            9387..11401
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     STS             9812..9947
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /standard_name="SHGC-31231"
                     /db_xref="UniSTS:49830"
     STS             10691..10845
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /standard_name="PCLO"
                     /db_xref="UniSTS:503576"
     exon            11402..13589
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            13590..13726
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            13727..13817
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            13818..13943
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            13944..14052
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14053..14120
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14121..14335
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14336..14386
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14387..14511
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14512..14538
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14539..14632
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14633..14704
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            14705..14885
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    14777..14885
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="match to EST AA081672 (NID:g1623730) zn20h04.r1"
     exon            14886..15080
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    <14886..>15080
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="match to EST AA081672 (NID:g1623730) zn20h04.r1"
     exon            15081..15222
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            15223..15296
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            15297..15431
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            15432..15577
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     exon            15578..20288
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    19766..>20288
                     /gene="PCLO"
                     /gene_synonym="ACZ"
                     /note="CpG_island (%GC=71.3, o/e=0.82, #CpGs=81)"
ORIGIN      
tctgcttctccccggctcggggcgccgaggcggcgtccgggaggtgtcttctgcaaaggttgcctggcgctgtccaacatggaggaggcaccggcagcgggcgttacctgcgagcgggactaacccctgcctggcgttccgggcggcagtgcctggtccagagtccagggactcggctgcctgcacgccccgaggcggaccccggctctgactgctcccctggccgcgggcttctcgactgggacgcggcgcgaggagggagcgcggcggccccgagtctccctgagccatgggcaacgaggcgagcttggaaggggaagggctccccgaagggctggcggcggccgcagcggctggaggaggagctagcggggcggggagcccctctcacaccgcgatcccggccggcatggaggcggatttgagccagctgagcgaagaggagaggagacagatcgccgctgtcatgtcaagggcgcaggggctgcccaagggaagcgtccccccggccgctgcggagtcgccttccatgcacaggaaacaagagttggatagtagtcatcctccaaagcaatcaggaagacccccggaccctgggcgtccagctcaacctggtctcagtaaaagtagaactacagacactttcaggtcagagcagaaattgcctgggaggagtccttccactattagcttgaaagaatcaaagtccagaactgatttaaaggaagagcacaagtctagtatgatgcctggcttcctctcagaggttaacgctttaagtgctgtttcctctgttgtaaataaattcaacccttttgatttgatatcagactctgaggcatcccaggaagaaaccaccaagaaacaaaaagtggttcagaaggagcaaggaaaacctgaaggaatcataaaacctcctttacaacaacagccacccaagccgattcctaagcagcaaggacctggtagggatccgcttcagcaggatggcactcccaaatcaatatcttctcaacaaccagaaaaaattaaatcacaacctccaggtacaggaaagccaattcagggtcctacccagactcctcagacagaccatgcaaaattgccacttcaacgagatgcatccaggcctcagactaaacaggcagacatagtaaggggagaatcagttaaaccctcactgccaagcccatccaaaccacctattcagcaaccaactcctggaaaacctccagcacagcagcctggacatgaaaaatcacagcctgggcctgcaaagcccccagctcagccctcagggctaacaaagccattggctcaacaaccagggacagtgaaacccccagtccagccaccagggacaacaaagcctccagctcagcctcttggtcctgctaagcctccagctcagcagactgggtcagagaagccttcatcggagcagcctgggccaaaggctttagctcagcctcctggagttggaaagactccagctcaacagccagggccagcaaagcctccaacccagcaggtggggacaccaaaacccctagctcaacaacctgggctacagtctccagctaaggcacctgggcctacaaagactccagttcagcagcctgggccaggaaagattccagctcaacaggcaggacccggaaagacttctgcccagcagactggcccaacaaagcctccttcacaactgcctggcccagcaaagcccccacctcaacagcctggcccagcaaagcccccacctcaacagcctggctcagcaaagcccccatctcaacagcctggctcaacaaaacccccacctcaacagcctggcccagcaaagccctcacctcaacagcctggctcaacaaaacccccatctcaacagcctggctcagcaaaaccctcagctcaacagcctagcccagcaaagccctcggctcagcaatctacaaaaccagtaagccaaacaggatctggaaaacctctgcagccaccaacagtgtctccatctgcaaaacagcctccttcacaaggcctccctaaaaccatctgtcctctttgcaataccactgaacttctgttgcatgttccagaaaaggccaattttaacacatgcactgagtgtcaaaccactgtctgtagtctctgtggttttaatcccaatcctcatttaacggaggtaaaagagtggctctgtttgaactgtcaaatgaaaagagctctaggcggggatctggctccagttccgtcatcaccccagcccaaactgaagactgcacctgttaccactacatcagcagtgagcaaatcatccccacagccacagcagacttccccaaagaaggatgctgcaccaaaacaggatctctccaaggcacctgagcctaaaaagccaccaccactagtgaaacaaccaacccttcatggctctccttcagccaaggccaagcagccccctgaggcagattctttgtccaagccagcccctcccaaagaaccttctgtcccatctgagcaggacaaggcccctgttgctgatgataaaccaaagcagcccaagatggtaaagccaaccactgaccttgtatcttcatcatcagcaacaacaaaacctgatattccaagctccaaagtacagtcacaagctgaagagaaaacaacccctcctctaaaaacagactctgccaaaccctcacagagttttccaccaacaggggaaaaagtcagcccatttgattctaaagccatacctcgacctgcatcagattcaaaaattatttcacatcctggtcccagttcagagagcaaaggtcaaaaacaagttgaccccgtacaaaagaaggaagaacccaagaaagcacaaaccaaaatgagtcctaaaccagatgccaagccaatgccaaaagggtcaccaacaccccctggcccacgacctaccgctggccaaactgtccccacacctcaacagtccccaaagcctcaggagcagtcaaggcgtttcagtctgaatctgggaagtattactgatgcccccaaatcacagcctacaactcctcaagagaccgtgactgggaaactctttgggtttggagcatcaatcttcagccaggcatcaaatttaatttccactgcaggccaacctggacctcattcacaaagtggaccaggggccccaatgaaacaagcccctgccccttcacagccacctacttcacaagggccacccaaatccacaggtcaagcaccaccagcacctgcaaaaagtatacctgtgaaaaaggaaacaaaagccccagcagctgaaaaattagagcccaaagctgaacaagctccaacagtaaaaagaacagaaacagaaaaaaagccaccacctattaaggatagcaaatctttaacagctgagcctcaaaaggctgtccttcccacaaaactggagaaatcgcccaaaccagaatcaacctgtcctctctgcaaaactgaactcaacataggttctaaggatcctcctaacttcaatacttgcactgaatgcaagaatcaagtgtgtaatctctgtggatttaaccctacaccacatttgactgagattcaagaatggctttgtttaaattgccaaacccagagagcaatatcaggacagcttggagacatacgcaaaatgccacctgcaccatcaggacccaaagcatctcctatgcctgttcctacagaatcatcatctcagaaaacagcagtgcctccccaagtaaaattagtgaaaaagcaagaacaagaagtaaaaacggaagctgaaaaagtcattctggaaaaagtaaaggaaacactatcaatggaaaaaattcctcctatggtaaccacagatcaaaaacaagaagagagtaaactagagaaagacaaagcttcagctcttcaagaaaaaaagccactccctgaagaaaaaaaactaatccctgaagaagaaaagatacgttctgaagaaaaaaagccactcctagaagaaaaaaagccaacccctgaagacaaaaagctactcccagaggcaaaaacatcagccccagaagaacagaaacatgacttacttaaatctcaagtacaaattgctgaagaaaagcttgaaggcagagtggctccaaagacagtgcaagaagggaaacaaccacagaccaagatggaaggtttaccatctggcacacctcagagtttacctaaagaagatgataagacaaccaaaacaataaaagaacagccacagccaccatgcacagcaaaacctgatcaggtggaacctgggaaagaaaaaacagaaaaggaagatgacaaatcagacacctcaagttctcagcagcctaaaagcccccaaggtctgagcgacacgggatattcttccgatggaatatcaagctcacttggtgaaattccaagtcttattccaactgatgaaaaggatattctcaagggactcaaaaaggactctttttcacaagaaagcagcccttccagcccctcagatttggctaagttagaaagtacagtcctatctattttggaagctcaagcaagtacacttgctgatgaaaagtcagaaaagaaaacacaaccccatgaagtttctcctgaacagcctaaagaccaagagaaaactcagagtttatctgaaaccttggaaattactatttcagaagaggagatcaaagagagtcaagaagaaaggaaagacacttttaaaaaagatagccaacaagatattccttccagcaaggaccataaagagaagtctgagtttgttgatgacataactactagaagagagccttatgattcagttgaagagagtagtgaaagtgaaaactcacctgttccacaaagaaaacgaagaactagtgttggctcatcaagcagtgatgagtataaacaggaagacagccaaggatcaggggaagaggaggacttcattcgaaaacaaatcatagaaatgagtgctgatgaagatgcttcaggttctgaagatgatgagttcatcagaaaccagctcaaagagattagtagcagtactgagagccagaagaaggaagaaacaaagggaaaaggcaaaataacagcagggaaacacagacgactgactcgaaaaagtagcacaagcattgatgaagatgcaggaagacgtcactcatggcatgatgaagacgatgaagcatttgatgaaagtcctgaacttaaatacagagaaactaaaagtcaggaaagtgaagaacttgtagttactggaggaggagggctacgccgatttaaaacaattgagctcaacagtacaatagcagataaatattctgcagagtcatcacagaaaaaaacaagtttgtattttgacgaagagccagaattggaaatggaaagcctgacagactcacctgaagataggtcaaggggagagggatcttcgagtctgcatgcttccagcttcactcctggtacatcccctacatcagtatcatcacttgatgaggacagtgacagtagcccgagtcacaaaaaaggagagagcaaacagcaacgcaaagctcggcacagaccacatggccctcttttgcctactattgaagattcttcagaggaagaagaattgagagaggaagaagaattattaaaggagcaagaaaagcagagggaaatagaacagcaacaaagaaagagttctagtaaaaaatcaaagaaagacaaagatgaacttcgagctcagagaagaagggaaaggccaaagacaccacctagtaatctctctcccattgaagatgcatctccgacagaagagttacgtcaggctgcagaaatggaggagctccatagatcttcttgttctgaatattcacctagcatagagtcagacccagaaggttttgaaataagcccggaaaaaataatagaagtacaaaaagtttataaattgcccacagctgtttcattatactcaccaacagatgagcaatctattatgcagaaagaaggtagccaaaaggcgttaaaaagtgctgaggagatgtatgaagaaatgatgcataaaacacacaaatacaaagcttttccagctgcaaatgaacgagatgaagtgtttgaaaaagagcctttgtatggtgggatgctaatagaggattatatttatgaatctttagtagaagacacgtacaatggatcggtagatggcagtctgctaacaaggcaagaagaagaaaatggatttatgcagcagaaaggaagagagcaaaagataagactttcagaacagatttatgaagatcctatgcagaaaattacagacctccagaaagagttttatgagttagaaagcttacattctgttgtgcctcaggaagatattgtttcaagctcttttatcatcccagaaagccatgagatagtggacctgggtactatggtaacttctacagaagaagaaaggaaactactagatgctgatgctgcctatgaagaacttatgaagaggcaacagatgcaattaacacctggatctagcccaacccaggcccccattggtgaggatatgacagagtccaccatggactttgacagaatgccagatgcctctttgacatcaagtgttctctcaggagcgtctcttacagattcgaccagcagtgcaacactctctatcccagatgttaaaataacccaacatttttcaacagaagaaattgaggatgaatatgtaaccgattatacaagagaaattcaagagataattgcccatgaatcgctgattttgacctactcggagccttcagaaagtgctacatctgtcccaccctctgacacaccttctctcacatcatctgtttcttcggtctgtaccacagatagctcttcacccattactaccctggatagcataaccacagtttatacagagccagtggacatgataactaaatttgaagattctgaggaaatttcttcatcaacttattttccaggcagcattatagactatccagaagaaataagtgtatctttagatcggactgccccaccagatggtagagctagtgctgatcatattgttatttccttatctgatatggcatcttctatcatagaatctgtagtacctaaacctgaagggccagttgctgacactgtttctactgacttacttatatctgaaaaggacccagtgaagaaagccaagaaggaaactgggaatggaatcattctggaagttttggaagcttacagagataaaaaggagttggaggccgaacgaacaaaaagtagcttatccgaaaccgtgtttgatcacccaccttcttctgtaatagcccttccaatgaaagagcagctttcaactacatactttacatctggagagacctttggtcaggaaaaacctgcatctcagttaccatctggcagtccttctgtttcctctcttccagctaaacctcgcccattctttagaagttcttctttggatatatcagctcaacctcctccccctcctccccctccccctcctcctcctcctccaccaccaccccctcctcccccaccacttcctccaccaacttcacctaaaccaactattcttcctaaaaaaaagttaacagttgcatctccagtgactacagctacacctctgtttgatgctgttactactctagagaccacagctgttctgagaagtaatggattacctgttacaagaatatgtactactgcacctcctcctgttcctcctaagccatcttcaattccatctggacttgtatttacccacaggcctgagccaagcaaacctccaatcgcccccaaaccagtgattcctcagcttccaacaactacacaaaaaccaacagatatacaccccaaaccaacaggcctatctttaacttcaagtatgaccttaaatttagtgacttcagcagattataaattgccttcccctacctccccactttccccacactccaacaagtcttcaccaagattttccaaatccctcacagaaacttatgtagttattacattgccatctgaaccagggactccaacagattcttctgctagtcaagcaattaccagttggcccttgggatcaccctccaaagatctggtttctgttgaacctgtgttttctgtagttcctcctgtgacagctgtagaaattccaatttcttcagaacagaccttctacatctctggagctttacagacattttctgctacccctgtcacagcaccctcttcatttcaagcagctcccacatcagttacacagtttctcactactgaagtttccaagactgaggtttcagcaaccagaagtacagctcctagtgttggtctcagcagcatttccataacaattcctccagagcctcttgctctagataacatacatttagagaagcctcagtataaagaagatggaaaattgcaacttgttggtgatgtaattgatttgcgtacagtaccaaaggtagaagttaaaacaactgataaatgtattgatctttctgcttctacaatggatgtgaaaaggcagatcacagcaaatgaagtttatgggaaacaaattagtgctgtccaaccctctattataaatcttagtgtgacatcatcaatagtgactcctgtatctctggccactgagacagtgacctttgtcacatgcacagctagtgcaagttacactacaggcacagaaagcctagtgggtgcagaacatgcaatgacaacaccactccaacttacaacatcaaagcatgctgagcccccatacaggataccaagtgaccaggtctttcctatagctagggaagaagcaccaataaacttatctctaggtactccagcacatgcagtgacattggctattacaaaacctgtcactgtgcctcctgttggtgtcacaaatggatggactgatagcaccgtatcccagggaatcactgatggggaagtagtggatctcagtacaaccaagtctcacagaacagtcgtaacaatggatgagtctacttcaagtgtgatgaccaaaataatagaagatgaaaaacccgttgatttaaccgcagggagaagagctgtgtgctgtgatgtggtttataaattaccatttggaaggagctgcacagcacagcagcctgcaactactcttcctgaggatcgttttggttatagggatgaccactatcagtatgatcgatcagggccatatggttatagagggattgggggaatgaagccttccatgtctgacacaaatttagcagaagctggacattttttctataaaagtaagaatgcttttgattattctgaaggaactgacacagcagtagatctgacttcagggagagttactacaggtgaggtaatggattattcaagcaagactacaggtccatatccagaaacacgacaagtcatttcaggagctgggattagtaccccacagtattccacagcaagaatgacaccaccaccaggaccccagtattgtgtggggagtgttttgaggtcatctaatggtgttgtctattcttcagtagcaactccaacaccctctacatttgctatcaccacacaacctggctccattttcagcaccacagtgagggatttgtctggtattcatacggctgatgcagtgacttcattacctgccatgcaccatagccagccaatgcctagatcatattttataacaacaggtgcatctgaaacggacattgcagtaactggtattgatatcagtgccagtttgcaaactattactatggagtctcttactgctgagacgatagactctgttcccactttaaccacagcatccgaagtgtttcctgaagtggtgggagatgaaagtgctcttttaattgtccctgaagaagataaacaacagcagcagctagacttggagcgtgagctcctggaactggagaaaattaagcaacagcgctttgctgaggaattggagtgggaacgtcaggaaattcaaaggttccgagaacaagaaaagatcatggttcagaaaaagttggaggagctgcagtctatgaagcaacaccttctctttcagcaagaagaagagcggcaagcccagttcatgatgaggcaggagacgttagctcagcaacagttacagcttgagcagatccaacagctgcaacaacagcttcaccagcagctggaggagcaaaagattcggcagatctaccagtataactatgacccttctggaactgcttctccacaaaccactacagagcaggcaattttggaaggtcagtatgctgctctggaaggcagtcaattttgggcaactgaagatgcaaccaccacagcttcagctgttgtggcaattgaaataccacaaagccaaggatggtacaccgttcagtctgatggtgttactcagtacattgccccacctggtatcctgagcactgtttcagaaatacctctaacagatgttgttgtgaaagaggaaaaacaacccaaaaagagaagttctggagctaaagtccgaggacagtatgatgacatgggagaaaatatgacagatgatccccgaagttttaaaaagatagtggacagtggtgtacaaacggatgacgaagatgccacagatcggagctatgtgagtaggagaaggagaactaaaaagagtgtggatacaagcgtccaaactgatgatgaagatcaggatgagtgggatatgcctactagatcaaggaggaaagctcgtgtagggaaatatggtgacagcatgacagaggctgacaagaccaaacccctttccaaagtctccagcatagcagttcaaacggtagcagagatatctgtgcaaactgaaccagttggaaccataagaacaccctccatacgggcacgagtggatgccaaggtagaaataattaaacacatttcagcacctgaaaagacttacaaagggggcagtttaggatgtcaaacagaagcagattcagacacacaaagtcctcaatatctgagtgccacatctccacccaaagacaagaaacgcccaacacctttagagattggttattcatctcacctccgggcagattccacagtacagctggctccttccccacccaaatcccccaaagtcctttactcacccatctcaccactttcaccaggcaaagccttagaatcagcctttgtaccttatgaaaaacccctccctgatgatataagtccacagaaagtactgcatccagatatggctaaagttcccccagcaagtcctaagacagccaagatgatgcagcgttctatgtctgaccccaagcctctgagtccaacagcagacgaaagttccagggctccttttcagtataccgagggctatacgactaaaggttctcaaaccatgacatcctctggagcccagaaaaaagttaaaagaactctgccaaatccacctcctgaggagatttccacaggaactcaatccacattcagcacaatgggcacagtttccaggagaaggatctgcagaaccaacacaatggcacgagccaagattctccaggacatagacagagagcttgatcttgtggaaagggagtctgcaaaacttcgaaagaaacaagcagagcttgatgaagaagaaaaggagattgatgctaagctacgatacctggaaatgggaattaacaggaggaaagaggccctattaaaggagagagaaaagagagaacgagcctacctccagggagtagctgaggatcgtgattacatgtctgacagtgaagtgagtagcacaagaccaacccgaatagaaagtcagcatggcattgagcgaccaagaactgctccccaaactgaattcagccagtttataccaccacaaacccaaacagaatctcaactagttcctccgacaagtccttacacacaataccagtactcttcccctgctcttcctacccaagcacccacctcatacactcaacagtctcattttgagcaacaaactttgtaccatcagcaagtttcaccttatcagactcagccaacattccaagctgtggcaacaatgtccttcacacctcaagttcaacctacaccaaccccacagccttcttatcagttaccttcacagatgatggtgatacaacagaagccacggcaaactacattatatttggagcccaagataacctcaaactatgaagtgattcgcaaccaaccccttatgatagcacctgtttctacggataacacatttgctgtttcccatcttggtagtaagtacaatagtttagacttgagaataggtttggaggaaagaagtagcatggcaagcagtccaatatcaagcatatctgcagattctttctatgcagatattgatcaccatactccacgaaattatgtcctaattgacgacattggagagatcaccaaaggaacagcggcattaagcaccgcatttagccttcatgaaaaggatctgtcaaaaacagaccgtctccttcgaaccactgagacacgccggtctcaagaagtgacagatttcctagcacctttacagtcttcctctagattgcatagttatgtgaaggcggaggaagacccaatggaggatccttacgagttaaagcttctgaaacatcagattaaacaggaatttcgtagagggacagagagcttagatcaccttgctggtctttctcattattaccatgctgatactagctacagacattttccaaaatctgagaagtatagcatcagtagactcacacttgaaaaacaagcagcaaaacaactgccagcagccatactttatcaaaagcagtcaaagcataagaaatcactaattgaccctaaaatgtcaaaattttcacctattcaagaaagtagagaccttgaacctgattattcaagctatatgacttctagcacttcatctattggtggcatttcctccagggcaaggctccttcaagatgacatcacttttggcctcagaaaaaatattacagaccaacaaaaatttatgggatcttctcttggcacaggactgggcacattaggaaataccatacgctcagctctgcaggatgaagcggataagccatacagtagtggcagcaggtccagaccttcctccagaccttcctctgtctatgggcttgatttatcaattaaaagggattcttctagctcttccctaagactgaaagctcaagaggctgaagctctagatgtttcctttagtcatgcatcatcctctgccagaactaagccgaccagtttgccaattagtcaaagtagaggaagaataccaattgtggcccagaattctgaagaagaaagcccactcagtcctgttggccagccaatgggaatggccagggctgcagctggacccctgccaccaatatctgcagacaccagggatcagtttggatcaagccactcattgcctgaagttcagcaacacatgagggaagaatcacggactcgaggctatgaccgtgacatagcattcatcatggatgacttccaacatgccatgtcagacagtgaagcctatcatctgcgtcgtgaggaaacagattggtttgataaacccagggagtctcgtttggaaaatggacatggtctggaccgaaaactgccggaaagattggtccactctagaccactcagtcaacatcaagagcaaattatacagatgaacgggaaaactatgcactacatctttcctcacgcaaggataaaaataacaagagactcaaaggatcacacagtttcaggtaatggattaggaattagaattgtgggtggtaaagaaatcccgggacatagtggagaaattggagcctatattgccaagattcttcctgggggaagtgcggaacagacggggaagcttatggaagggatgcaagtattggaatggaatggaattcccttgacttctaaaacatatgaagaagttcagagtatcattagtcagcaaagtggggaagcagaaatatgtgtaagactggacctcaatatgctatcagattctgaaaattcccagcatctggaacttcatgagccaccaaaagctgtggataaggcgaaatccccaggggttgatcctaagcagttggcagcagaactccagaaggtttcactacagcagtcaccgctggttctgtcatcagttgttgaaaaaggatctcatgttcattcaggtcctacatcagcaggatccagttccgttcccagccctgggcaaccagggtccccctcagtgagcaaaaagaagcacggcagcagcaagcctaccgatggaacaaaggttgtctctcatccaattacaggagaaattcagcttcaaattaactatgatcttggaaatctcataatacatattctccaagcaagaaatcttgttcctcgagacaacaatggttattctgacccttttgtgaaagtgtaccttcttccagggagaggtcaagtcatggttgtccagaatgcaagtgctgagtacaagagaaggactaaacatgtccagaaaagtcttaatcctgagtggaatcaaacagtaatttataaaagtatttccatggaacagctcaagaagaaaacactggaggtgacagtttgggattatgatagattttcatccaacgacttccttggggaggtattgattgatttatctagcacatctcacctcgataacactccaaggtggtatcctctcaaagaacagactgaaagcattgatcatggcaagtctcattccagtcagagcagccagcagtccccaaagccatctgttatcaaaagcagaagccatggtatcttccctgacccatcaaaggacatgcaggttcccaccattgagaaatcccatagtagtcctggtagctcaaaatcatcatcagaaggccatctccgttctcatggaccatctcgcagtcaaagcaaaaccagcgtcactcagacccacctggaagatgcaggggctgccatagctgctgccgaagctgccgtgcaacaactccgcattcaaccaacaaagcctcccaatcaccggcctgcagaaagctctgtgtccaccggctcctcgggcagcagctttggcagtgggtatagcgtggacagtgaaggaagcagcagcactgcaggggagactaatctatttcctattccgaggatagggaagatgggacagaatggacaagagcctgtaaaacagccaggggtaggagtaggactagcagacactgaagctaaaactcaggtaatgggagaaatcaagattgcattgaagaaggaaatgaagacagatggtgaacaactaatagttgaaattctccaatgcagaaatattacatacaaatttaagtctcctgatcatctaccagatttatatgtgaaaatatatgtgatgaatatttctacccaaaaaaaggtgatcaagaaaaaaacaagagtatgcagacatgatcgagagccttcgtttaatgaaacttttcgattcagtctaagtcctgcaggacattctcttcagattttacttttctccaatggagggaagtttatgaaaaagaccttgattggtgaagcctgtatctggcttgacaaagtggatctcagaaaaagaatagtcaactggcacaaacttttggtcagtcctactcaaacgcattgaagaaacatgtcttctcagggtatagaaactgctctaaatagcctcacatcaagactatagttgaatactattgtacaaagctaagttttgagaggcaaacataagagtgggaacaacaagcaaaaacatacttaagaccttgtacatttattgttgtggatcacacaaagatattcaactgaaaaagttcacatactgaaaacaagaagaatggagttctgagaccttgaatttcccatggctgtgaagagaaactgtgaaacaaattttgattacttaagacaataatctttgagtagagttgagctatagcttaagacaggctcaaagattaatgtggttttcatgcagcacaaaggtaattctttatgcaaaggagccttggttgaaaggaaaggactgatgtaacaaatctcagttttcaaaacttcaaaaatcttccttcatcgtcttctattcagacaacttgctgctttcagattctgacataagatatacctacagtatgtgtccagggctggaagtgaggtggctgtgttcttagggaaaatggaagaggagatgtagaaattgtggctttcaggccatattttaccagttttctctgtgtctaaatgttacaagcatatacaacactgactttggaatccatgtggtaaaagcacatttgtttctgtatcatttgaaacaaggtagagtgaagataatactcagtagaaataaaattgaatttatctagaaataaaactatgactggctaacaaagaagaatgttgccccataaaatattggaattttggttgaaaccatcaaaatcttcataatttaccattaagccaagacatcttcagtctatgtaccaaaggacctagagtaaactgatatgttctaggaagcatgataacttactctttgtgaaactgcaaataaatgtattatcctgcacatttcctttctgttgagcgatgcattgacagagaaagaaaattctttctctggcaaacaaaccatattaatcttgtgacattgattaattaaatggatcctcatttcataatattttatgcttttttccttaatgacttaattcatttactgattgtatcatgaaaacatgacactaaactcgagttctctctagtgctctattttcttactttagtgacagtatcacagtgatcaagttcatcaatgttgggaaaatatgtgaaaagtcaacatttacctgagattaaaatatactttgagctattttaataataatgaataaaacaactaatgtccaagtcttaaaatgaagcaccctcttctctatcagcattattaattaaggaagtaacgtgaagttgtggaaaaaacactcagcagggaataaaagcctgtcttctggtcttagttctaccactgactgtgtcactttgcacatgtcacttacactcactttaccccagttttcttatctataggataaaaacaattatatattcttaaccttccaaatgagatgttgtgatgataaatcaatgatccatgaaagatgaaagcacatttccaaatatagttttatacacagaagtgaggaataattattacatatctttttaattctcaaattttatatgtgaaaaacatcatctaaaccaatggcaaggattgacatggataaaagcagtaaattagccacaaaacttattttttatttaaaatataaactttaacctgactaaaggtgaagaattacatgaaaatgcaaattttgctatcccaaattaaatgaataatgctggtcttaccctagtcctatattccacccaaaagaaataaatcaaattgcttctcagagcattctgagcttaaaacctgctgctttatttaagggtgaagtgttagtggaattagagaaaaccaactctagatattggttggatattgaattttctcatttttaaagaaaaaatgctctaaatttgagaggactgtaaagcactaaaaataagagaatttctaatatatcccaggatatatatatatatatatgacttcagaatacaaattcgatcttccccaaactgagaaagataaccataacttttcttccctctattttttaatccccctccactgacaatacaatgtcatttaccattgacattgctctcaaatgagcatgggagagtggaatcatcaaagacattatattgctagtattttatttttagaaactattagatctgctgatggttgccatggatatttccagcagaagctagcacttgaagaagcctataatcatcactcataattggggaagaaaaggtccaaggagatctccttctgacataaaaaggctctggtatttgcccttaaaagaaaaccctgactcatctctgatcctcttttgcagccactcatatccataggtatgcatgagagtttgtatgaccagttagctttcttcattccagttgcaatttcttttagaataatataaatggagggatcaccaaaacaaagattatctctttggtagctatttaacctgaaagcgtaggagtctttccattatagaagcccctccgttccaaggaactagcgatggggctaggtcaatcagcagagttgacaacagggcttctttttgtgcaccagcattccccttcagagagcataagatcctgccagtgtgccaagtttgcagctgaccaaacttctaggttgtactggaattattctatgcaacactgatccttatatgaatgcgtttcttctgaatgatgttgactacccttcttacaacaaaactgtttcttttttattgcaaatagggctcttggtgttttttacttttttgtacatatcacagtacatggtttttcactctttagtttatttcattttattggaattaacttttttttattctaatactgacagagtttgtaatctctatataatacgtaattactccaattacagcacttttaccttgaagagcatctcagtttttcccacaatttcattgagtcatcagagactgatgttgcttcttggtttcaaatttggtcctaaagaaactttcggctgtagaaacaaaagcacagagtgaattttttacaaaagacagggaatatagaatagtcattacagacacaaataaccctagtagcacgaagttggtgttttctctgtttttacttaagattaagaagatttttggtgactctgaactctttatttatatttcagtttaaaatatcaagactaaggggcatcagttatctttactctttaatattgcccatattttaataaattacactaattaaacgcatattttcagcataccagtggaattaattttgtggatcacacacatttaaatagtcatattgtgggaatattatagctggtaaccagctgatattgattcttattataggaatgactgtaatgatagtggtggtagcagtagtgatattagcggtggtggtgatgtgaagtaaaataaaagtatatattatattgtgcccaatttattagaaattatttgatcaatgcttcatttcattaaaatatcataaagatgtttatagtatttttttactttattatttaaatcataactaacaatatttttaaaaacttattttcattgctacaatgtcaaatattccaaaatcagccaactacagctatatatgtgttatgtgtgacagaagtgatcttccttccctctttttgagcttgacatgaaagtgaaagaagactcaatgaataattatgagctatttatttaataattacttgccttgggtgtaatacagtaatgaatgagtgaaacaaatattctcattgaatatgatacaatgctgttttctgtatgtttcatgttctattattaaaggtatccattaggccaaaattatttaatcaaattctttatctgataggtagattgagagcattttcttaatgcattaccttgtacataagtatacacttggtaaagtagacgaagttgaaatattaatttcatttggcatttagcatgtgaatatgattattgtttgattgtgtctgtatatttgtttggtgacgtgctcaggtgctcccactactgattaatgtgtgtgctaatatcctaaaaacacatatgaggtttaagaaaaaattttcttgtctgaaaacataaacatcttaataaaactgattttgaaataaaaactaaagtacttgaagatatgtcttgtttctaactatatgttgcatgccatgttggtgatttgctaatgtgtttttttgtttgtttgttttacccaaatccctttggaaaatctaatggacaaatgcaaattcttggactaaggactgtataaattgacctgaaaatacatgagagttgcatttaaaaaaaaatgcttgtaaatccgtcttgagttttactctatgtaaaaatatgtcttggttttgtgattgtatacaagatgtatcttgataacttatgtaaactgtgccgtataaaggctgttgcctcagccttactaataaatactgaaaatatcacctttga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:27445 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA
            GeneID:27445 -> Molecular function: GO:0005509 [calcium ion binding] evidence: ISS
            GeneID:27445 -> Molecular function: GO:0005522 [profilin binding] evidence: ISS
            GeneID:27445 -> Molecular function: GO:0005544 [calcium-dependent phospholipid binding] evidence: ISS
            GeneID:27445 -> Biological process: GO:0007010 [cytoskeleton organization] evidence: ISS
            GeneID:27445 -> Biological process: GO:0016079 [synaptic vesicle exocytosis] evidence: NAS
            GeneID:27445 -> Biological process: GO:0017157 [regulation of exocytosis] evidence: IEA
            GeneID:27445 -> Biological process: GO:0019933 [cAMP-mediated signaling] evidence: IEA
            GeneID:27445 -> Biological process: GO:0030073 [insulin secretion] evidence: IEA
            GeneID:27445 -> Cellular component: GO:0005856 [cytoskeleton] evidence: NAS
            GeneID:27445 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA
            GeneID:27445 -> Cellular component: GO:0016020 [membrane] evidence: IEA
            GeneID:27445 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:27445 -> Cellular component: GO:0045202 [synapse] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.