2024-04-27 13:47:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_032974 2307 bp mRNA linear PRI 16-JUN-2013 DEFINITION Homo sapiens caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 2, mRNA. ACCESSION NM_032974 VERSION NM_032974.4 GI:330864668 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2307) AUTHORS Lisa-Santamaria,P., Jimenez,A. and Revuelta,J.L. TITLE The protein factor-arrest 11 (Far11) is essential for the toxicity of human caspase-10 in yeast and participates in the regulation of autophagy and the DNA damage signaling JOURNAL J. Biol. Chem. 287 (35), 29636-29647 (2012) PUBMED 22782902 REMARK GeneRIF: The protein factor-arrest 11 (Far11) is essential for the toxicity of human caspase-10 in yeast and participates in the regulation of autophagy and the DNA damage signaling. REFERENCE 2 (bases 1 to 2307) AUTHORS Schleich,K., Warnken,U., Fricker,N., Ozturk,S., Richter,P., Kammerer,K., Schnolzer,M., Krammer,P.H. and Lavrik,I.N. TITLE Stoichiometry of the CD95 death-inducing signaling complex: experimental and modeling evidence for a death effector domain chain model JOURNAL Mol. Cell 47 (2), 306-319 (2012) PUBMED 22683265 REMARK GeneRIF: analysis of stoichiometry of the CD95 death-inducing signaling complex and demonstration of how procaspase-8, procaspase-10, and c-FLIP form DED chains at the DISC, enabling the formation of dimers and efficient activation of caspase-8 REFERENCE 3 (bases 1 to 2307) AUTHORS Ekchariyawat,P., Thitithanyanont,A., Sirisinha,S. and Utaisincharoen,P. TITLE Apoptosis induced by avian H5N1 virus in human monocyte-derived macrophages involves TRAIL-inducing caspase-10 activation JOURNAL Innate Immun 18 (3), 390-397 (2012) PUBMED 21911414 REMARK GeneRIF: induces apoptosis in avian virus H5N1-infected human monocyte-derived macrophages REFERENCE 4 (bases 1 to 2307) AUTHORS Yan,S., Li,Y.Z., Zhu,J.W., Liu,C.L., Wang,P. and Liu,Y.L. TITLE Role of CASP-10 gene polymorphisms in cancer susceptibility: a HuGE review and meta-analysis JOURNAL Genet. Mol. Res. 11 (4), 3998-4007 (2012) PUBMED 23212337 REMARK GeneRIF: This meta-analysis suggests that the rs13006529 T carrier in the CASP-10 gene might be a risk factor for cancer susceptibility, especially for breast cancer. Review article Publication Status: Online-Only REFERENCE 5 (bases 1 to 2307) AUTHORS Qian,J., Qu,H.Q., Yang,L., Yin,M., Wang,Q., Gu,S., Wu,Q., Zhao,X., Wu,W., Wu,J., Tan,X., Chen,W., Wang,H., Wang,J., Fan,W., Chen,H., Han,B., Lu,D., Wei,Q. and Jin,L. TITLE Association between CASP8 and CASP10 polymorphisms and toxicity outcomes with platinum-based chemotherapy in Chinese patients with non-small cell lung cancer JOURNAL Oncologist 17 (12), 1551-1561 (2012) PUBMED 22843554 REMARK GeneRIF: Genetic variations in CASP8 and CASP10 may act as potential predictive biomarkers for platinum-based chemotherapy toxicity in Chinese non-small cell lung cancer patients. REFERENCE 6 (bases 1 to 2307) AUTHORS Ng,P.W., Porter,A.G. and Janicke,R.U. TITLE Molecular cloning and characterization of two novel pro-apoptotic isoforms of caspase-10 JOURNAL J. Biol. Chem. 274 (15), 10301-10308 (1999) PUBMED 10187817 REFERENCE 7 (bases 1 to 2307) AUTHORS Fernandes-Alnemri,T., Takahashi,A., Armstrong,R., Krebs,J., Fritz,L., Tomaselli,K.J., Wang,L., Yu,Z., Croce,C.M., Salveson,G. et al. TITLE Mch3, a novel human apoptotic cysteine protease highly related to CPP32 JOURNAL Cancer Res. 55 (24), 6045-6052 (1995) PUBMED 8521391 REFERENCE 8 (bases 1 to 2307) AUTHORS DuBridge,R.B., Tang,P., Hsia,H.C., Leong,P.M., Miller,J.H. and Calos,M.P. TITLE Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system JOURNAL Mol. Cell. Biol. 7 (1), 379-387 (1987) PUBMED 3031469 REFERENCE 9 (bases 1 to 2307) AUTHORS Clements,G.B., Klein,G. and Povey,S. TITLE Production by EBV infection of an EBNA-positive subline from an EBNA-negative human lymphoma cell line without detectable EBV DNA JOURNAL Int. J. Cancer 16 (1), 125-133 (1975) PUBMED 170210 REFERENCE 10 (bases 1 to 2307) AUTHORS Baumann,K., de Rouffignac,C., Roinel,N., Rumrich,G. and Ullrich,K.J. TITLE Renal phosphate transport: inhomogeneity of local proximal transport rates and sodium dependence JOURNAL Pflugers Arch. 356 (4), 287-298 (1975) PUBMED 1171445 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA456072.1, BC042844.1, BX089180.1 and AC007283.3. On Apr 28, 2011 this sequence version replaced gi:98985797. Summary: This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]. Transcript Variant: This variant (2) contains an alternate 3' terminal exon compared to variant 1, and encodes an isoform (2, also known as FLICE2 and caspase-10/b) that has a distinct C-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U86214.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025087, ERS025088 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-136 DA456072.1 18-153 137-545 DA456072.1 155-563 546-1833 BC042844.1 282-1569 1834-2145 BX089180.1 253-564 2146-2307 AC007283.3 7114-7275 c FEATURES Location/Qualifiers source 1..2307 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q33-q34" gene 1..2307 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="caspase 10, apoptosis-related cysteine peptidase" /db_xref="GeneID:843" /db_xref="HGNC:1500" /db_xref="HPRD:03458" /db_xref="MIM:601762" exon 1..411 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 59 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:41429849" variation 213 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:16836789" variation 229..230 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="" /replace="c" /db_xref="dbSNP:34296231" variation 366..367 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="" /replace="c" /db_xref="dbSNP:35190763" misc_feature 407..409 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="upstream in-frame stop codon" exon 412..765 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" CDS 419..1984 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /EC_number="3.4.22.63" /note="isoform 2 preproprotein is encoded by transcript variant 2; caspase 10, apoptosis-related cysteine protease; FADD-like ICE2; apoptotic protease MCH-4; ICE-like apoptotic protease 4; interleukin-1B-converting enzyme 2; caspase-10; CASP-10; FAS-associated death domain protein interleukin-1B-converting enzyme 2" /codon_start=1 /product="caspase-10 isoform 2 preproprotein" /protein_id="NP_116756.2" /db_xref="GI:47078269" /db_xref="CCDS:CCDS2338.1" /db_xref="GeneID:843" /db_xref="HGNC:1500" /db_xref="HPRD:03458" /db_xref="MIM:601762" /translation="
MKSQGQHWYSSSDKNCKVSFREKLLIIDSNLGVQDVENLKFLCIGLVPNKKLEKSSSASDVFEHLLAEDLLSEEDPFFLAELLYIIRQKKLLQHLNCTKEEVERLLPTRQRVSLFRNLLYELSEGIDSENLKDMIFLLKDSLPKTEMTSLSFLAFLEKQGKIDEDNLTCLEDLCKTVVPKLLRNIEKYKREKAIQIVTPPVDKEAESYQGEEELVSQTDVKTFLEALPQESWQNKHAGSNGNRATNGAPSLVSRGMQGASANTLNSETSTKRAAVYRMNRNHRGLCVIVNNHSFTSLKDRQGTHKDAEILSHVFQWLGFTVHIHNNVTKVEMEMVLQKQKCNPAHADGDCFVFCILTHGRFGAVYSSDEALIPIREIMSHFTALQCPRLAEKPKLFFIQACQGEEIQPSVSIEADALNPEQAPTSLQDSIPAEADFLLGLATVPGYVSFRHVEEGSWYIQSLCNHLKKLVPRMLKFLEKTMEIRGRKRTVWGAKQISATSLPTAISAQTPRPPMRRWSSVS
" misc_feature 470..715 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="Death effector domain, repeat 1, of Caspase-10; Region: DED_Caspase_10_repeat1; cd08341" /db_xref="CDD:176752" misc_feature order(515..520,530..532,539..544,548..553,659..661, 671..673) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="putative DED1/DED2 interface [polypeptide binding]; other site" /db_xref="CDD:176752" misc_feature order(521..523,680..682,686..688) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="charge triad; other site" /db_xref="CDD:176752" misc_feature 752..988 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="Death Effector Domain, repeat 2, of Caspase-10; Region: DED_Caspase_10_repeat2; cd08814" /db_xref="CDD:176792" misc_feature order(755..757,764..769,773..778,788..790,866..868, 878..880) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="putative DED1/DED2 interface [polypeptide binding]; other site" /db_xref="CDD:176792" misc_feature 1064..1066 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1073..1075 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /experiment="experimental evidence, no additional details recorded" /note="proteolytic cleavage site; modified site" /db_xref="HPRD:03458" mat_peptide 1076..1663 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /product="caspase-10 isoform 2 large subunit" misc_feature 1241..1909 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="Caspase, interleukin-1 beta converting enzyme (ICE) homologues; Cysteine-dependent aspartate-directed proteases that mediate programmed cell death (apoptosis). Caspases are synthesized as inactive zymogens and activated by proteolysis of the peptide...; Region: CASc; cd00032" /db_xref="CDD:28914" misc_feature order(1316..1318,1493..1495,1613..1615,1634..1636, 1757..1774,1784..1789) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="substrate pocket [chemical binding]; other site" /db_xref="CDD:28914" misc_feature order(1490..1492,1619..1621) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="active site" /db_xref="CDD:28914" misc_feature order(1637..1639,1712..1717,1736..1738,1745..1747, 1754..1756,1823..1825,1841..1843,1859..1861,1898..1900) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:28914" misc_feature order(1640..1642,1709..1711) /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /note="proteolytic cleavage site; other site" /db_xref="CDD:28914" mat_peptide 1664..1981 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /product="caspase-10 isoform 2 small subunit" variation 438 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:200935960" variation 480 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:140813639" variation 507 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="t" /db_xref="dbSNP:201782416" variation 512 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:375838979" variation 544 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:146684884" variation 560 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:200012872" variation 575 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:1804650" variation 592 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:114625983" variation 594 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:139417609" variation 595 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:3900115" variation 644 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="c" /db_xref="dbSNP:146696981" variation 673 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:185792819" variation 689 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:148026756" variation 700 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:370492434" variation 732 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:200530667" variation 743 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:201601111" variation 750 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:199600895" exon 766..859 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 845 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:376343637" variation 858 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:121909776" exon 860..995 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 920 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:371962581" variation 952 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="c" /db_xref="dbSNP:146233833" variation 968 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:200877813" variation 971 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:369231920" exon 996..1102 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1014 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:200079223" variation 1033 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:373077581" variation 1084 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:116125703" variation 1100 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:370134219" variation 1101 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:143882052" variation 1102 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:368583939" exon 1103..1139 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1133 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="t" /db_xref="dbSNP:41473647" exon 1140..1231 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1140 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:149367331" variation 1147 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:374515060" variation 1187 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:121909775" variation 1204 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:368675766" variation 1215 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:148554420" exon 1232..1340 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1234 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:113867411" variation 1264 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:372906837" variation 1271 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:17860403" variation 1274 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:111719534" variation 1297 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="c" /db_xref="dbSNP:369897442" variation 1305 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:146654699" variation 1331 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:149912574" exon 1341..1833 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1348 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="g" /replace="t" /db_xref="dbSNP:149096064" variation 1371 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:138931498" variation 1401 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:200424779" STS 1428..1798 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /standard_name="PMC230316P3" /db_xref="UniSTS:272181" variation 1433 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:111775921" variation 1441 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:114098515" variation 1457 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:115264962" variation 1486 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="g" /replace="t" /db_xref="dbSNP:111489269" variation 1504 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:369304578" variation 1507 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:148290917" variation 1535 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:372719084" variation 1542 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:375798142" variation 1550 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="t" /db_xref="dbSNP:370138285" variation 1615 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:199626441" variation 1634 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:80358239" variation 1645 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:371401141" variation 1646 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:13010627" variation 1659 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:28936699" variation 1672 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:140190607" variation 1685 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:374332152" variation 1714 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:41331850" variation 1715 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:200540853" variation 1748 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:41513147" variation 1755 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:17860405" variation 1765 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:147814983" variation 1768 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="g" /replace="t" /db_xref="dbSNP:370670949" variation 1813 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:199853584" exon 1834..2307 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /inference="alignment:Splign:1.39.8" variation 1836 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:199889956" variation 1837 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:142128351" variation 1869 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="" /replace="g" /db_xref="dbSNP:111919002" variation 1897 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:150915936" variation 1926 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:149458030" variation 1938 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:148642010" variation 1939 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:370819847" variation 1946 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:147791300" variation 1950 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:151011448" variation 1975 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:114536475" variation 1976 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:141197114" variation 2023 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:201178199" variation 2035 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:372429072" variation 2042 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:188527006" variation 2085 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="g" /replace="t" /db_xref="dbSNP:146444964" variation 2150 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="t" /db_xref="dbSNP:375960160" variation 2173 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="c" /replace="g" /db_xref="dbSNP:368996794" variation 2204 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="t" /db_xref="dbSNP:140802408" variation 2235 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="a" /replace="g" /db_xref="dbSNP:116157119" variation 2270..2271 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="" /replace="g" /db_xref="dbSNP:34554492" variation 2295..2296 /gene="CASP10" /gene_synonym="ALPS2; FLICE2; MCH4" /replace="" /replace="c" /db_xref="dbSNP:35923284" ORIGIN
aaggaaatggagatccaaaggaaagcctgaagcactttgtggcttccacgggttcgtttctaggaagcttttgctttacctggggaaaccccaagctctacagtgagaaagttgtaaattagcctttaggagacgctgtttgtcaaagttatcttaaccctggaaaaggggagggaaaaaggcagataagcagtgatgacatcagcaggaaactagtatcaggctacccagtcctgaagattcagttttcacttaaacaaccagcaagtcttgaagtctcttcccaagcaaatgggagcttctttggaccttggagcacacagaggattctactttctttaaaactttgttttcaggcaatttccctgagaaccgtttacttccagaagattggtggagcttgatctgaaggctggccatgaaatctcaaggtcaacattggtattccagttcagataaaaactgtaaagtgagctttcgtgagaagcttctgattattgattcaaacctgggggtccaagatgtggagaacctcaagtttctctgcataggattggtccccaacaagaagctggagaagtccagctcagcctcagatgtttttgaacatctcttggcagaggatctgctgagtgaggaagaccctttcttcctggcagaactcctctatatcatacggcagaagaagctgctgcagcacctcaactgtaccaaagaggaagtggagcgactgctgcccacccgacaaagggtttctctgtttagaaacctgctctacgaactgtcagaaggcattgactcagagaacttaaaggacatgatcttccttctgaaagactcgcttcccaaaactgaaatgacctccctaagtttcctggcatttctagagaaacaaggtaaaatagatgaagataatctgacatgcctggaggacctctgcaaaacagttgtacctaaacttttgagaaacatagagaaatacaaaagagagaaagctatccagatagtgacacctcctgtagacaaggaagccgagtcgtatcaaggagaggaagaactagtttcccaaacagatgttaagacattcttggaagccttaccgcaggagtcctggcaaaataagcatgcaggtagtaatggtaacagagccacaaatggtgcaccaagcctggtctccagggggatgcaaggagcatctgctaacactctaaactctgaaaccagcacaaagagggcagctgtgtacaggatgaatcggaaccacagaggcctctgtgtcattgtcaacaaccacagctttacctccctgaaggacagacaaggaacccataaagatgctgagatcctgagtcatgtgttccagtggcttgggttcacagtgcatatacacaataatgtgacgaaagtggaaatggagatggtcctgcagaagcagaagtgcaatccagcccatgccgacggggactgcttcgtgttctgtattctgacccatgggagatttggagctgtctactcttcggatgaggccctcattcccattcgggagatcatgtctcacttcacagccctgcagtgccctagactggctgaaaaacctaaactctttttcatccaggcctgccaaggtgaagagatacagccttccgtatccatcgaagcagatgctctgaaccctgagcaggcacccacttccctgcaggacagtattcctgccgaggctgacttcctacttggtctggccactgtcccaggctatgtatcctttcggcatgtggaggaaggcagctggtatattcagtctctgtgtaatcatctgaagaaattggtcccaaggatgctgaaatttctggaaaagacaatggaaatcaggggcaggaagagaacagtgtggggtgctaaacagatctcagcaacctccctgcccacggccatctctgcgcagacacctcgaccccccatgcgcaggtggagcagcgtttcctagttctttccagaggcttccttctgcctgccttccagccacatcgcctgagattgacaacgccctacagcaagacggaaacctccctttacagcaccaccttgcgattctgcagccacaaagttgagacttctgaacgtggcactcttctgttcccttactgtttcacgtgtacctgtgtcatctttcttgtttcatcgtaaacatacttctaaaattcccattttctttatttagaaatagaactacaagcggatggttaaacaatttaaacaaatggtccatggggaaaagtgaatttcacactgtcccccaaactttcagtg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:843 -> Molecular function: GO:0004197 [cysteine-type endopeptidase activity] evidence: IEA GeneID:843 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:843 -> Biological process: GO:0006508 [proteolysis] evidence: IEA GeneID:843 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:843 -> Biological process: GO:0006917 [induction of apoptosis] evidence: TAS GeneID:843 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IMP GeneID:843 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: RCA GeneID:843 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:843 -> Biological process: GO:0097190 [apoptotic signaling pathway] evidence: TAS GeneID:843 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:843 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_116756 -> EC 3.4.22.63
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.