GGRNA Home | Help | Advanced search

2020-10-26 19:25:09, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_032816               2609 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens centrosomal protein 89kDa (CEP89), mRNA.
ACCESSION   NM_032816
VERSION     NM_032816.3  GI:50083292
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2609)
  AUTHORS   Chambers,J.C., Zhang,W., Lord,G.M., van der Harst,P., Lawlor,D.A.,
            Sehmi,J.S., Gale,D.P., Wass,M.N., Ahmadi,K.R., Bakker,S.J.,
            Beckmann,J., Bilo,H.J., Bochud,M., Brown,M.J., Caulfield,M.J.,
            Connell,J.M., Cook,H.T., Cotlarciuc,I., Davey Smith,G., de
            Silva,R., Deng,G., Devuyst,O., Dikkeschei,L.D., Dimkovic,N.,
            Dockrell,M., Dominiczak,A., Ebrahim,S., Eggermann,T., Farrall,M.,
            Ferrucci,L., Floege,J., Forouhi,N.G., Gansevoort,R.T., Han,X.,
            Hedblad,B., Homan van der Heide,J.J., Hepkema,B.G.,
            Hernandez-Fuentes,M., Hypponen,E., Johnson,T., de Jong,P.E.,
            Kleefstra,N., Lagou,V., Lapsley,M., Li,Y., Loos,R.J., Luan,J.,
            Luttropp,K., Marechal,C., Melander,O., Munroe,P.B., Nordfors,L.,
            Parsa,A., Peltonen,L., Penninx,B.W., Perucha,E., Pouta,A.,
            Prokopenko,I., Roderick,P.J., Ruokonen,A., Samani,N.J., Sanna,S.,
            Schalling,M., Schlessinger,D., Schlieper,G., Seelen,M.A.,
            Shuldiner,A.R., Sjogren,M., Smit,J.H., Snieder,H., Soranzo,N.,
            Spector,T.D., Stenvinkel,P., Sternberg,M.J., Swaminathan,R.,
            Tanaka,T., Ubink-Veltmaat,L.J., Uda,M., Vollenweider,P.,
            Wallace,C., Waterworth,D., Zerres,K., Waeber,G., Wareham,N.J.,
            Maxwell,P.H., McCarthy,M.I., Jarvelin,M.R., Mooser,V.,
            Abecasis,G.R., Lightstone,L., Scott,J., Navis,G., Elliott,P. and
            Kooner,J.S.
  TITLE     Genetic loci influencing kidney function and chronic kidney disease
  JOURNAL   Nat. Genet. 42 (5), 373-375 (2010)
   PUBMED   20383145
REFERENCE   2  (bases 1 to 2609)
  AUTHORS   Hahn,Y. and Lee,B.
  TITLE     Human-specific nonsense mutations identified by genome sequence
            comparisons
  JOURNAL   Hum. Genet. 119 (1-2), 169-178 (2006)
   PUBMED   16395595
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC032307.1, BU630455.1, BU196203.1, AL832158.1, BE208545.1,
            AK027546.1 and BU628988.1.
            On Jul 9, 2004 this sequence version replaced gi:37537707.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC136328.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-783               BC032307.1         1-783
            784-975             BU630455.1         375-566             c
            976-1654            BU196203.1         19-697
            1655-1930           AL832158.1         1544-1819
            1931-1932           BE208545.1         283-284
            1933-2600           AK027546.1         1700-2367
            2601-2609           BU628988.1         13-21               c
FEATURES             Location/Qualifiers
     source          1..2609
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.11"
     gene            1..2609
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /note="centrosomal protein 89kDa"
                     /db_xref="GeneID:84902"
                     /db_xref="HGNC:25907"
     exon            1..128
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    51..53
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /note="upstream in-frame stop codon"
     CDS             90..2441
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /note="coiled-coil domain containing 123; coiled-coil
                     domain-containing protein 123, mitochondrial"
                     /codon_start=1
                     /product="centrosomal protein of 89 kDa"
                     /protein_id="NP_116205.3"
                     /db_xref="GI:50083293"
                     /db_xref="CCDS:CCDS32987.1"
                     /db_xref="GeneID:84902"
                     /db_xref="HGNC:25907"
                     /translation="
MLLGFRRGRRSHFKHIIHGLLPAASVAPKAAVPRTPPPRSPNPSPERPRSALAAAILATTLTGRTVAIPQPRQRSRSESDVSSVEQDSFIEPYATTSQLRPRPNWQSEMGRRSSLPSFETLDYGDEEDIETQLSSSGKELGDVSAREDRGGHSDDLYAVPHRNQVPLLHEVNSEDDENISHQDGFPGSPPAPQRTQQKDGKHPVLNLKDEKPPLCEKPPPSPDITGRARQRYTEITREKFEALKEENMDLNNMNQSLTLELNTMKQAMKELQLKLKGMEKEKRKLKEAEKASSQEVAAPELLYLRKQAQELVDENDGLKMTVHRLNVELSRYQTKFRHLSKEESLNIEGLPSKGPIPPWLLDIKYLSPLLLAYEDMMKEKDELNATLKEEMRMFRMRVQEVVKENEELHQELNKSSAVTSEEWRQLQTQAKLVLEENKLLLEQLEIQQRKAKDSHQERLQEVSKLTKQLMLLEAKTHGQEKELAENREQLEILRAKCQELKTHSDGKIAVEVHKSIVNELKSQLQKEEEKERAEMEELMEKLTVLQAQKKSLLLEKNSLTEQNKALEAELERAQKINRKSQKKIEVLKKQVEKAMGNEMSAHQYLANLVGLAENITQERDSLMCLAKCLESEKDGVLNKVIKSNIRLGKLEEKVKGYKKQAALKLGDISHRLLEQQEDFAGKTAQYRQEMRHLHQVLKDKQEVLDQALQQNREMEGELEVIWESTFRENRRIRELLQDTLTRTGVQDNPRALVAPSLNGVSQADLLDGCDVCSYDLKSHAPTC
"
     misc_feature    237..239
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96ST8.3); phosphorylation site"
     misc_feature    <1434..2309
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:162739"
     exon            129..235
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            236..394
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            395..581
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     variation       501
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726543"
     exon            582..684
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            685..713
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            714..756
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            757..975
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            976..1118
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1119..1169
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1170..1253
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1254..1357
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1358..1473
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1474..1654
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1655..1822
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1823..1964
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            1965..2054
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     exon            2055..2224
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     variation       2160
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34626245"
     exon            2225..2605
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /inference="alignment:Splign:1.39.8"
     variation       2348
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745959"
     variation       2425
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745960"
     variation       2439
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745961"
     polyA_signal    2573..2578
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
     polyA_site      2594
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      2605
                     /gene="CEP89"
                     /gene_synonym="CCDC123"
ORIGIN      
cctgcggcgggctttagggagtggtccctggctgtggatagatctgctgatgagtccaggccccggtccattctcctcgcgctgcaaggatgctcctgggatttcggagaggccgcaggagtcatttcaaacacatcatccatggccttttacctgcagccagcgttgctccgaaggcagctgtgccacgcacacctcctccccgcagccccaacccatctccagagagaccaagatctgctctggcagcagccattctggcgacaacattgactgggcggacggttgctattcctcagcctcgccagaggtcccggtctgagagtgatgtgagcagtgttgaacaggacagcttcatcgagccctatgccaccacctcacagctgaggcctcggccaaattggcagagtgagatgggaagaagatcttctttgccatcctttgaaacactggactatggggacgaagaggacattgaaactcagctgtcatccagcggcaaggaattgggggatgtcagtgcccgggaggacagaggaggccacagtgatgacctgtacgctgtgccacacagaaatcaggtgccattgttacatgaggtgaacagtgaagacgatgaaaatatttctcatcaagatgggtttccaggctcccctcctgcaccacagcggacacaacaaaaagatggtaaacaccctgttctgaatttaaaggatgaaaaacctccattatgtgagaaacctccaccctccccagatataactggtagagcacgtcaaagatatacagaaataaccagagaaaagtttgaggcattaaaagaagaaaatatggacctaaacaatatgaatcaaagccttacccttgaactaaacacaatgaaacaagcaatgaaagaactacagttaaaacttaagggaatggaaaaagagaagagaaagctcaaagaggctgagaaggcgtcgtcacaggaagttgctgcacctgaattactttatctgcgaaaacaagctcaagaactggtggatgaaaatgatggattgaaaatgactgtccatcgtttgaatgtagaactcagtcgatatcagacaaaattcaggcatttgtccaaggaagagagcttaaatattgaaggcctcccatccaagggccctataccaccctggttgttggatataaagtacctgtcaccattgttgctggcttatgaagatatgatgaaagagaaggacgagctcaatgccaccctcaaggaggaaatgagaatgtttaggatgcgagtccaagaagtggtgaaagaaaatgaagaattgcaccaagagttaaataagagtagtgctgttaccagtgaggaatggcgtcagcttcagactcaagcaaaactggttttagaggaaaacaagttgttgctggagcagttggagattcagcaaaggaaagccaaggacagccaccaggagcgcctccaagaagtttctaagctgactaaacaactaatgctcctggaggcaaaaacccacggccaggaaaaggagctggcggagaacagggaacagctggagattttacgtgccaaatgccaagaactcaaaacacactcggatggcaaaatcgcagtggaagttcataaatcaattgtgaatgaattaaaaagccaattacagaaggaagaagagaaagaaagggctgagatggaggagttgatggagaagctgacagtcctgcaagcgcagaagaagagcctgctgttagagaagaacagtttgacagagcaaaacaaagcactggaagccgaacttgaacgagcacagaaaatcaataggaaatctcaaaagaaaattgaggtcctcaaaaagcaggtggaaaaagccatggggaacgaaatgtctgctcatcagtacctggcaaaccttgttggcctggcagaaaatataacccaggaacgtgacagtcttatgtgtttggcaaaatgtttagaaagtgagaaggatggagtgcttaataaagtcataaaaagcaacattcgcctgggaaagttagaggaaaaagtcaagggctacaagaagcaggcagcactgaagctgggggacatcagtcaccgtctgctggagcagcaggaggacttcgccggcaagacagcccagtaccggcaggagatgcggcacctgcaccaggtgctgaaggacaagcaggaggtgctggaccaggcgctgcagcagaacagagaaatggaaggtgaacttgaagttatttgggaatctaccttcagggaaaaccgaagaatccgagaacttctccaggacacactcacgaggacaggcgtgcaggacaaccccagagctctggttgcccccagcctcaatggcgtctctcaggcagacctgctggacggctgcgatgtctgctcctatgacctgaagtctcatgcccccacctgctagaatctgcgggagcccgtggtgtagcctcctctggcctgaaaggtctgcctcacacaggccttccctgcagggcagcccatggtggcagccggaggtgcgtaagcccactgaacgctgcagggcagggaagaaataaatggtctcatagtttaatccattgataaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84902 -> Biological process: GO:0042384 [cilium assembly] evidence: IMP
            GeneID:84902 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
            GeneID:84902 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:84902 -> Cellular component: GO:0005758 [mitochondrial intermembrane space] evidence: IEA
            GeneID:84902 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:84902 -> Cellular component: GO:0005814 [centriole] evidence: IDA
            GeneID:84902 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
            GeneID:84902 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.