GGRNA Home | Help | Advanced search

2019-03-23 03:28:17, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_032805               2463 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens zinc finger and SCAN domain containing 10 (ZSCAN10),
            mRNA.
ACCESSION   NM_032805
VERSION     NM_032805.1  GI:14249487
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2463)
  AUTHORS   Sugito,K., Kawashima,H., Uekusa,S., Yoshizawa,S., Hoshi,R.,
            Furuya,T., Kaneda,H., Hosoda,T., Masuko,T., Ohashi,K., Ikeda,T.,
            Koshinaga,T., Fujiwara,K., Igarashi,J., Ghosh,S., Held,W.A. and
            Nagase,H.
  TITLE     Identification of aberrant methylation regions in neuroblastoma by
            screening of tissue-specific differentially methylated regions
  JOURNAL   Pediatr Blood Cancer 60 (3), 383-389 (2013)
   PUBMED   22911660
  REMARK    GeneRIF: We demonstrated that SLC16A5 and ZNF206 displayed altered
            methylation patterns in the neuroblastoma genome
REFERENCE   2  (bases 1 to 2463)
  AUTHORS   Kawashima,H., Sugito,K., Yoshizawa,S., Uekusa,S., Furuya,T.,
            Ikeda,T., Koshinaga,T., Shinojima,Y., Hasegawa,R., Mishra,R.,
            Igarashi,J., Kimura,M., Wang,X., Fujiwara,K., Gosh,S. and Nagase,H.
  TITLE     DNA hypomethylation at the ZNF206-exon 5 CpG island associated with
            neuronal differentiation in mice and development of neuroblastoma
            in humans
  JOURNAL   Int. J. Oncol. 40 (1), 31-39 (2012)
   PUBMED   22011711
  REMARK    GeneRIF: Data indicates that changes in DNA methylation levels at
            the Zfp206-exon 5 might be one of the important factors during
            neuronal development in mice and the hypomethylation of the
            homologous region induced ZNF206 expression in humans.
REFERENCE   3  (bases 1 to 2463)
  AUTHORS   Bernot,A., Heilig,R., Clepet,C., Smaoui,N., Da Silva,C.,
            Petit,J.L., Devaud,C., Chiannilkulchai,N., Fizames,C., Samson,D.,
            Cruaud,C., Caloustian,C., Gyapay,G., Delpech,M. and Weissenbach,J.
  TITLE     A transcriptional Map of the FMF region
  JOURNAL   Genomics 50 (2), 147-160 (1998)
   PUBMED   9653642
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AK027455.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK027455.1, DA728426.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2463
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16p13.3"
     gene            1..2463
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="zinc finger and SCAN domain containing 10"
                     /db_xref="GeneID:84891"
                     /db_xref="HGNC:12997"
                     /db_xref="HPRD:15747"
     exon            1..319
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /inference="alignment:Splign:1.39.8"
     CDS             89..2266
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="zinc finger protein 206"
                     /codon_start=1
                     /product="zinc finger and SCAN domain-containing protein
                     10"
                     /protein_id="NP_116194.1"
                     /db_xref="GI:14249488"
                     /db_xref="CCDS:CCDS10493.1"
                     /db_xref="GeneID:84891"
                     /db_xref="HGNC:12997"
                     /db_xref="HPRD:15747"
                     /translation="
MGPRASLSRLRELCGHWLRPALHTKKQILELLVLEQFLSVLPPHLLGRLQGQPLRDGEEVVLLLEGIHREPSHAGPLDFSCNAGKSCPRADVTLEEKGCASQVPSHSPKKELPAEEPSVLGPSDEPPRPQPRAAQPAEPGQWRLPPSSKQPLSPGPQKTFQALQESSPQGPSPWPEESSRDQELAAVLECLTFEDVPENKAWPAHPLGFGSRTPDKEEFKQEEPKGAAWPTPILAESQADSPGVPGEPCAQSLGRGAAASGPGEDGSLLGSSEILEVKVAEGVPEPNPELQFICADCGVSFPQLSRLKAHQLRSHPAGRSFLCLCCGKSFGRSSILKLHMRTHTDERPHACHLCGHRFRQSSHLSKHLLTHSSEPAFLCAECGRGFQRRASLVQHLLAHAQDQKPPCAPESKAEAPPLTDVLCSHCGQSFQRRSSLKRHLRIHARDKDRRSSEGSGSRRRDSDRRPFVCSDCGKAFRRSEHLVAHRRVHTGERPFSCQACGRSFTQSSQLVSHQRVHTGEKPYACPQCGKRFVRRASLARHLLTHGGPRPHHCTQCGKSFGQTQDLARHQRSHTGEKPCRCSECGEGFSQSAHLARHQRIHTGEKPHACDTCGHRFRNSSNLARHRRSHTGERPYSCQTCGRSFRRNAHLRRHLATHAEPGQEQAEPPQECVECGKSFSRSCNLLRHLLVHTGARPYSCTQCGRSFSRNSHLLRHLRTHARETLY
"
     misc_feature    89..295
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="SCAN oligomerization domain; Region: SCAN; cd07936"
                     /db_xref="CDD:153421"
     misc_feature    order(92..100,104..109,116..121,128..133,137..148,
                     158..163,170..175,182..190,194..199,203..214,269..271,
                     278..283,287..295)
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:153421"
     misc_feature    407..409
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96SZ4.1); phosphorylation site"
     misc_feature    545..547
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96SZ4.1); phosphorylation site"
     misc_feature    725..727
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q96SZ4.1); phosphorylation site"
     misc_feature    1094..1168
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1484..>2242
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="FOG: Zn-finger [General function prediction only];
                     Region: COG5048"
                     /db_xref="CDD:34653"
     misc_feature    1529..1606
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1616..1690
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1697..1768
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1781..1858
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1865..1942
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    1949..2026
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    2135..2212
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     exon            320..587
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /inference="alignment:Splign:1.39.8"
     exon            588..652
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /inference="alignment:Splign:1.39.8"
     exon            653..710
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /inference="alignment:Splign:1.39.8"
     exon            711..2463
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /inference="alignment:Splign:1.39.8"
     variation       742
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3810808"
     STS             2259..2395
                     /gene="ZSCAN10"
                     /gene_synonym="ZNF206"
                     /standard_name="RH91869"
                     /db_xref="UniSTS:89322"
ORIGIN      
cagcccagaggaccccaggcgaccagagtccaggctgaggcccgaggtggctcaccagctgttcagatgcttccagtatcaggaggacatggggccacgggcgtccctgagccggctccgggagctctgcggccactggctgcggccggctctgcacaccaagaaacagatcctggagctgctggtgctggagcagttcctgagtgtgctgcctccgcacctcctgggccgcctgcaggggcagccgctcagggatggggaggaggtggtgctgctgctcgagggcatccaccgggagcccagccacgcggggccgctggattttagttgtaatgctggcaagagttgtccccgtgcagacgtcaccttggaggaaaaggggtgtgcttcccaggtccccagccacagccccaagaaggaattgcctgcggaagagccttcagtgctgggcccatcggatgagcctccccgaccccagccaagggctgcccagcctgctgagccgggacagtggaggcttcccccaagttcaaagcagccgctgagcccggggccccagaagacattccaggccctgcaagaaagcagtccccagggcccctcaccatggccagaggagagttcccgagatcaggagctggcggctgtgctggagtgcctgacctttgaggatgtgccagagaataaggcgtggcctgcacaccccctgggattcggaagcagaaccccagacaaggaggaatttaaacaagaagagcccaaaggggctgcctggcccactcccatcttagcagagtcccaggcagatagtcctggggtgccgggagagccttgcgcccagtcgctcggacggggcgctgcggctagcggccctggcgaagatgggtcccttcttggcagcagtgaaattttggaggtcaaagtggctgagggcgtccccgagcccaatccggagttgcagttcatctgcgcggactgcggggtgagcttcccgcagctgtctcgcctgaaggcgcaccagctgcgctcgcacccggctgggcgctccttcctgtgcctttgctgcgggaagagcttcggccgcagctccattctcaagctgcacatgcgcactcacacggacgagcggccgcacgcctgccacctgtgcggccaccgcttccgccagagctcgcacctgagcaagcacctgctgacccactcctccgaacccgccttcctgtgcgcagagtgcggccgcggcttccagcgccgcgccagccttgtgcagcacctgctggcgcacgcccaggaccagaagccgccctgcgctcctgagagtaaggccgaagcgccgccactgaccgatgtcctgtgctcccactgcggccagagcttccagcgccgctccagcctcaagcgccacctgcggatccacgccagggacaaggaccgccggtcctccgaaggctccggcagccgccgccgggactccgaccggaggcccttcgtgtgcagcgactgcggcaaggccttccggcgcagcgagcacctggtggcccaccggagggtgcacacgggcgagcggcccttctcctgccaggcttgcggccgcagcttcacgcagagctcgcagctggtcagccaccaacgggtgcacacgggcgagaagccctacgcctgtccgcagtgcgggaagcgctttgtgcgccgggccagccttgcccgccacctgctgacccacggtggccctcggccccaccactgcacccagtgcgggaagagtttcggccagacccaggatctggcccgccaccagcgcagccacacgggcgagaagccctgccgctgcagcgagtgcggtgagggcttcagccagagcgcccacctggcgcgccaccagcgcatccacacaggggagaagccccacgcctgcgacacctgcggccaccgtttccgcaatagctccaacctggcccgccatcgccgcagccacacgggcgagcggccctacagctgtcagacgtgcggtcgcagcttccggcgcaacgcgcatctgcggcggcacctggctacccatgcggagcccgggcaggagcaggccgagcccccgcaggagtgcgtggagtgcgggaagagcttcagccgcagctgcaatctgctgcgacacctgctggtgcacacgggcgccaggccctactcctgcacgcagtgtggccgcagcttcagccgcaactcccacctgctgcgccacctgcgcacccacgcccgcgagacgctgtactagcttggcccgccttccgccagccgcgccctgcgccacctacccggggtcctccacagcggaggcctgcaggaatgtcccttcccaccacaccccacttccctctccttccactttcacagctgtccttccctggccgaggcattgctttctggcctcagctatgtaattaaaacgcccgaagtaaaatggccttctcc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84891 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: ISS
            GeneID:84891 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: ISS
            GeneID:84891 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:84891 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:84891 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: ISS
            GeneID:84891 -> Cellular component: GO:0005634 [nucleus] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.