Home |
Help |
Advanced search
2024-04-18 09:35:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_032597 3353 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
(MS4A14), transcript variant 1, mRNA.
ACCESSION NM_032597 XM_495876
VERSION NM_032597.4 GI:387849340
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3353)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun. 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AP003127.2 and AY094610.1.
On May 17, 2012 this sequence version replaced gi:119226216.
Transcript Variant: This variant (1) has multiple coding region
differences, compared to variant 4, which results in a shorter
protein (isoform 1), compared to isoform 4.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AY094610.1, AF367473.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-472 AP003127.2 99935-100406
473-1093 AY094610.1 57-677
1094-3353 AP003127.2 119418-121677
FEATURES Location/Qualifiers
source 1..3353
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.2"
gene 1..3353
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="membrane-spanning 4-domains, subfamily A, member
14"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
exon 1..703
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 31
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:186234557"
variation 39
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:7929046"
variation 40
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:190992915"
variation 51..52
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="a"
/db_xref="dbSNP:377307026"
variation 102
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76333679"
variation 110
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143358541"
variation 149
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3816270"
variation 223
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76174817"
variation 281
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:180800488"
variation 296
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185942516"
variation 379
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:141665394"
misc_feature 410..412
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="upstream in-frame stop codon"
variation 421
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:112785513"
variation 427
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375045470"
variation 432
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:190864604"
variation 472
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:6591579"
variation 517
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368431455"
variation 545
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:367878785"
variation 560
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200592380"
CDS 566..2605
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="isoform 1 is encoded by transcript variant 1;
membrane-spanning 4-domains, subfamily A, member 16;
testes development-related NYD-SP21; MS4A13 protein;
testis development protein NYD-SP21"
/codon_start=1
/product="membrane-spanning 4-domains subfamily A member
14 isoform 1"
/protein_id="NP_115986.3"
/db_xref="GI:119226217"
/db_xref="CCDS:CCDS31569.1"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
/translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIFILTGYLTVTDKKSKLLGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
misc_feature 695..>1024
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="CD20-like family; Region: CD20; pfam04103"
/db_xref="CDD:202888"
misc_feature 713..775
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
transmembrane region"
misc_feature 791..853
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
transmembrane region"
misc_feature 893..955
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
transmembrane region"
misc_feature 986..1048
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
transmembrane region"
variation 569
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201462421"
variation 577
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375301622"
variation 589
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140226757"
variation 601
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200092161"
variation 602
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371634910"
variation 640
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150323558"
variation 653
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200017443"
variation 701
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:138895874"
exon 704..832
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 709
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:141700245"
variation 731
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:72514098"
variation 732..733
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:3217518"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74733740"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:77630012"
variation 747
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147119308"
variation 769
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138517611"
variation 770
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:368053345"
variation 771
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144076317"
variation 794
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:369576834"
variation 796
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144248317"
variation 802
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:2197234"
variation 810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:372708908"
variation 815
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148297999"
variation 827
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375255532"
variation 831
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:141490187"
exon 833..883
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 836
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:367787186"
variation 853
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:77796224"
variation 882
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:139149393"
exon 884..1033
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 884
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375760675"
variation 885
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:202236686"
variation 897
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146613208"
variation 898
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371907012"
variation 907
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:183715072"
variation 927
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76136794"
variation 932
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375247098"
variation 942
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146035561"
variation 961
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:140270120"
variation 1011
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145354751"
exon 1034..3353
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1054
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371774895"
variation 1065
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375761169"
variation 1079
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:143463721"
variation 1094
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:7131283"
variation 1095
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:148391374"
variation 1142
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024994"
variation 1148
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142563385"
variation 1158
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:373780418"
variation 1166
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:116626186"
variation 1171
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140195795"
variation 1197
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:142269991"
variation 1203
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147713621"
variation 1204
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142667482"
variation 1215
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370208539"
variation 1253
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373858678"
variation 1256
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:150268605"
variation 1313
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:117801657"
variation 1316
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149338262"
variation 1352
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:187868937"
variation 1398
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150868984"
variation 1414
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:193025815"
variation 1415
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368158780"
variation 1416
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375278465"
variation 1421
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:114064661"
variation 1437
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:138285006"
variation 1442
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142839945"
variation 1462
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369608879"
variation 1473
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:185708225"
variation 1510
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201469306"
variation 1516
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:114663860"
variation 1525
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:376669252"
variation 1536
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:139364741"
variation 1542
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:149681158"
variation 1562
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150784858"
variation 1612
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370940283"
variation 1641
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:145539034"
variation 1661
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:149868650"
variation 1672
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144883718"
variation 1709
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140428922"
variation 1745
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144301602"
variation 1779
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116345276"
variation 1801
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:112103602"
variation 1833
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369619070"
variation 1861
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373220783"
variation 1873..1874
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="c"
/db_xref="dbSNP:35183103"
variation 1917
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3802959"
variation 1948
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143398166"
variation 1959
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:139435636"
variation 1966
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:145054362"
variation 2004
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140456628"
variation 2018
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:376488191"
variation 2056
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150409796"
variation 2061
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74837900"
variation 2077
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142892172"
variation 2092
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145051590"
variation 2109
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199805024"
variation 2133
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:199505839"
variation 2136
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374402343"
variation 2147
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201227484"
variation 2170
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142235413"
variation 2202
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:113290465"
variation 2206
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:80173276"
variation 2207
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144635507"
variation 2220
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372468983"
variation 2242
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370935983"
variation 2292
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200738251"
variation 2293
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148489703"
variation 2300
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375897716"
variation 2315
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3825020"
variation 2341
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:374558627"
variation 2394
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116224124"
variation 2401
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:73481226"
variation 2411
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200543306"
variation 2415
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144309625"
variation 2416
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201726394"
variation 2423
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200307761"
variation 2430
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:3016727"
variation 2443
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147367847"
variation 2444
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140936913"
variation 2459
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368186934"
variation 2461
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:146179294"
variation 2473
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370794980"
variation 2482
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:375353153"
variation 2502
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:145801550"
variation 2526
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368014397"
variation 2528
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149015522"
variation 2586
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142968938"
variation 2591
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:151183005"
variation 2624
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181547264"
variation 2732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:77025492"
variation 2842
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:184474834"
variation 2942
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:375774697"
variation 2964
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443243"
STS 2994..3187
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/standard_name="RH17567"
/db_xref="UniSTS:70207"
variation 3053
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:78731118"
variation 3132
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375396734"
STS 3150..3249
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/standard_name="SGC34191"
/db_xref="UniSTS:21339"
variation 3168
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:75538311"
variation 3190
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138237921"
variation 3198
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:188971082"
variation 3289..3290
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="aacac"
/db_xref="dbSNP:140068962"
variation 3330
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181921480"
ORIGIN
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttatttttattcttacaggatacctcacagtaaccgataagaaatcaaaacttctgggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.