2024-04-19 12:00:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_032447 8967 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens fibrillin 3 (FBN3), mRNA. ACCESSION NM_032447 VERSION NM_032447.3 GI:56237020 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 8967) AUTHORS Yalamanchi,S.K., Sam,S., Cardenas,M.O., Holaday,L.W., Urbanek,M. and Dunaif,A. TITLE Association of fibrillin-3 and transcription factor-7-like 2 gene variants with metabolic phenotypes in PCOS JOURNAL Obesity (Silver Spring) 20 (6), 1273-1278 (2012) PUBMED 22301903 REMARK GeneRIF: The FBN3 risk allele may be associated with changes in basal glucose homeostasis in PCOS. REFERENCE 2 (bases 1 to 8967) AUTHORS Hatzirodos,N., Bayne,R.A., Irving-Rodgers,H.F., Hummitzsch,K., Sabatier,L., Lee,S., Bonner,W., Gibson,M.A., Rainey,W.E., Carr,B.R., Mason,H.D., Reinhardt,D.P., Anderson,R.A. and Rodgers,R.J. TITLE Linkage of regulators of TGF-beta activity in the fetal ovary to polycystic ovary syndrome JOURNAL FASEB J. 25 (7), 2256-2265 (2011) PUBMED 21411746 REMARK GeneRIF: Data show that TGF-beta pathways operate during ovarian fetal development, and fibrillin 3 is highly expressed at a critical stage early in developing human and bovine fetal ovaries. REFERENCE 3 (bases 1 to 8967) AUTHORS Sabatier,L., Miosge,N., Hubmacher,D., Lin,G., Davis,E.C. and Reinhardt,D.P. TITLE Fibrillin-3 expression in human development JOURNAL Matrix Biol. 30 (1), 43-52 (2011) PUBMED 20970500 REMARK GeneRIF: fibrillin-3, compared to the other fibrillins, fulfills both overlapping and distinct functions in human development REFERENCE 4 (bases 1 to 8967) AUTHORS Raja-Khan,N., Kunselman,A.R., Demers,L.M., Ewens,K.G., Spielman,R.S. and Legro,R.S. TITLE A variant in the fibrillin-3 gene is associated with TGF-beta and inhibin B levels in women with polycystic ovary syndrome JOURNAL Fertil. Steril. 94 (7), 2916-2919 (2010) PUBMED 20630504 REMARK GeneRIF: A variant in the fibrillin-3 gene is associated with TGF-beta and inhibin B levels in women with polycystic ovary syndrome. GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 8967) AUTHORS Jordan,C.D., Bohling,S.D., Charbonneau,N.L. and Sakai,L.Y. TITLE Fibrillins in adult human ovary and polycystic ovary syndrome: is fibrillin-3 affected in PCOS? JOURNAL J. Histochem. Cytochem. 58 (10), 903-915 (2010) PUBMED 20855553 REMARK GeneRIF: Loss of fibrillin-3 during folliculogenesis may be an important factor in polycystic ovary syndrome pathogenesis. REFERENCE 6 (bases 1 to 8967) AUTHORS Urbanek,M., Sam,S., Legro,R.S. and Dunaif,A. TITLE Identification of a polycystic ovary syndrome susceptibility variant in fibrillin-3 and association with a metabolic phenotype JOURNAL J. Clin. Endocrinol. Metab. 92 (11), 4191-4198 (2007) PUBMED 17785364 REMARK GeneRIF: fibrillin-3 gene showed the strongest evidence for association with Polycystic ovary syndrome GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 8967) AUTHORS Fu,G.K., Wang,J.T., Yang,J., Au-Young,J. and Stuve,L.L. TITLE Circular rapid amplification of cDNA ends for high-throughput extension cloning of partial genes JOURNAL Genomics 84 (1), 205-210 (2004) PUBMED 15203218 REFERENCE 8 (bases 1 to 8967) AUTHORS Corson,G.M., Charbonneau,N.L., Keene,D.R. and Sakai,L.Y. TITLE Differential expression of fibrillin-3 adds to microfibril variety in human and avian, but not rodent, connective tissues JOURNAL Genomics 83 (3), 461-472 (2004) PUBMED 14962672 REFERENCE 9 (bases 1 to 8967) AUTHORS Uyeda,T., Takahashi,T., Eto,S., Sato,T., Xu,G., Kanezaki,R., Toki,T., Yonesaka,S. and Ito,E. TITLE Three novel mutations of the fibrillin-1 gene and ten single nucleotide polymorphisms of the fibrillin-3 gene in Marfan syndrome patients JOURNAL J. Hum. Genet. 49 (8), 404-407 (2004) PUBMED 15221638 REFERENCE 10 (bases 1 to 8967) AUTHORS Faivre,L., Megarbane,A., Alswaid,A., Zylberberg,L., Aldohayan,N., Campos-Xavier,B., Bacq,D., Legeai-Mallet,L., Bonaventure,J., Munnich,A. and Cormier-Daire,V. TITLE Homozygosity mapping of a Weill-Marchesani syndrome locus to chromosome 19p13.3-p13.2 JOURNAL Hum. Genet. 110 (4), 366-370 (2002) PUBMED 11941487 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AY165865.1, AC022146.8, CN369190.1, AB053450.2, CD634017.1, AI341180.1 and AC008946.7. On Dec 3, 2004 this sequence version replaced gi:31542627. Summary: This gene encodes a protein that belongs to the fibrillin gene family. Fibrillins are extracellular matrix molecules that assemble into microfibrils in many connective tissues. This gene is most highly expressed in fetal tissues and its protein product is localized to extracellular microfibrils of developing skeletal elements, skin, lung, kidney, and skeletal muscle. This gene is potentially involved in Weill-Marchesani syndrome. While several transcript variants may exist for this gene, their full-length natures have not been described to date. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC153882.1, AY165865.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-2004 AY165865.1 266-2269 2005-2005 AC022146.8 73338-73338 c 2006-3923 AY165865.1 2271-4188 3924-3924 CN369190.1 262-262 3925-4860 AY165865.1 4190-5125 4861-4861 AB053450.2 4861-4861 4862-6197 AY165865.1 5127-6462 6198-6198 AB053450.2 6198-6198 6199-6623 AY165865.1 6464-6888 6624-6624 CD634017.1 481-481 6625-7439 AY165865.1 6890-7704 7440-7440 AI341180.1 460-460 c 7441-7850 AY165865.1 7706-8115 7851-7851 AC008946.7 77916-77916 c 7852-8967 AY165865.1 8117-9232 FEATURES Location/Qualifiers source 1..8967 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19p13" gene 1..8967 /gene="FBN3" /note="fibrillin 3" /db_xref="GeneID:84467" /db_xref="HGNC:18794" /db_xref="HPRD:10538" /db_xref="MIM:608529" exon 1..188 /gene="FBN3" /inference="alignment:Splign:1.39.8" CDS 22..8451 /gene="FBN3" /note="fibrillin-3" /codon_start=1 /product="fibrillin-3 precursor" /protein_id="NP_115823.3" /db_xref="GI:56237021" /db_xref="CCDS:CCDS12196.1" /db_xref="GeneID:84467" /db_xref="HGNC:18794" /db_xref="HPRD:10538" /db_xref="MIM:608529" /translation="
MTLEGLYLARGPLARLLLAWSALLCMAGGQGRWDGALEAAGPGRVRRRGSPGILQGPNVCGSRFHAYCCPGWRTFPGRSQCVVPICRRACGEGFCSQPNLCTCADGTLAPSCGVSRGSGCSVSCMNGGTCRGASCLCQKGYTGTVCGQPICDRGCHNGGRCIGPNRCACVYGFMGPQCERDYRTGPCFGQVGPEGCQHQLTGLVCTKALCCATVGRAWGLPCELCPAQPHPCRRGFIPNIHTGACQDVDECQAVPGLCQGGSCVNMVGSFHCRCPVGHRLSDSSAACEDYRAGACFSVLFGGRCAGDLAGHYTRRQCCCDRGRCWAAGPVPELCPPRGSNEFQQLCAQRLPLLPGHPGLFPGLLGFGSNGMGPPLGPARLNPHGSDARGIPSLGPGNSNIGTATLNQTIDICRHFTNLCLNGRCLPTPSSYRCECNVGYTQDVRGECIDVDECTSSPCHHGDCVNIPGTYHCRCYPGFQATPTRQACVDVDECIVSGGLCHLGRCVNTEGSFQCVCNAGFELSPDGKNCVDHNECATSTMCVNGVCLNEDGSFSCLCKPGFLLAPGGHYCMDIDECQTPGICVNGHCTNTEGSFRCQCLGGLAVGTDGRVCVDTHVRSTCYGAIEKGSCARPFPGTVTKSECCCANPDHGFGEPCQLCPAKDSAEFQALCSSGLGITTDGRDINECALDPEVCANGVCENLRGSYRCVCNLGYEAGASGKDCTDVDECALNSLLCDNGWCQNSPGSYSCSCPPGFHFWQDTEICKDVDECLSSPCVSGVCRNLAGSYTCKCGPGSRLDPSGTFCLDSTKGTCWLKIQESRCEVNLQGASLRSECCATLGAAWGSPCERCEIDPACARGFARMTGVTCDDVNECESFPGVCPNGRCVNTAGSFRCECPEGLMLDASGRLCVDVRLEPCFLRWDEDECGVTLPGKYRMDVCCCSIGAVWGVECEACPDPESLEFASLCPRGLGFASRDFLSGRPFYKDVNECKVFPGLCTHGTCRNTVGSFHCACAGGFALDAQERNCTDIDECRISPDLCGQGTCVNTPGSFECECFPGYESGFMLMKNCMDVDECARDPLLCRGGTCTNTDGSYKCQCPPGHELTAKGTACEDIDECSLSDGLCPHGQCVNVIGAFQCSCHAGFQSTPDRQGCVDINECRVQNGGCDVHCINTEGSYRCSCGQGYSLMPDGRACADVDECEENPRVCDQGHCTNMPGGHRCLCYDGFMATPDMRTCVDVDECDLNPHICLHGDCENTKGSFVCHCQLGYMVRKGATGCSDVDECEVGGHNCDSHASCLNIPGSFSCRCLPGWVGDGFECHDLDECVSQEHRCSPRGDCLNVPGSYRCTCRQGFAGDGFFCEDRDECAENVDLCDNGQCLNAPGGYRCECEMGFDPTEDHRACQDVDECAQGNLCAFGSCENLPGMFRCICNGGYELDRGGGNCTDINECADPVNCINGVCINTPGSYLCSCPQDFELNPSGVGCVDTRAGNCFLETHDRGDSGISCSAEIGVGVTRASCCCSLGRAWGNPCELCPMANTTEYRTLCPGGEGFQPNRITVILEDIDECQELPGLCQGGDCVNTFGSFQCECPPGYHLSEHTRICEDIDECSTHSGICGPGTCYNTLGNYTCVCPAEYLQVNGGNNCMDMRKSVCFRHYNGTCQNELAFNVTRKMCCCSYNIGQAWNRPCEACPTPISPDYQILCGNQAPGFLTDIHTGKPLDIDECGEIPAICANGICINQIGSFRCECPAGFNYNSILLACEDVDECGSRESPCQQNADCINIPGSYRCKCTRGYKLSPGGACVGRNECREIPNVCSHGDCMDTEGSYMCLCHRGFQASADQTLCMDIDECDRQPCGNGTCKNIIGSYNCLCFPGFVVTHNGDCVDFDECTTLVGQVCRFGHCLNTAGSFHCLCQDGFELTADGKNCVDTNECLSLAGTCLPGTCQNLEGSFRCICPPGFQVQSDHCIDIDECSEEPNLCLFGTCTNSPGSFQCLCPPGFVLSDNGHRCFDTRQSFCFTRFEAGKCSVPKAFNTTKTRCCCSKRPGEGWGDPCELCPQEGSAAFQELCPFGHGAVPGPDDSREDVNECAENPGVCTNGVCVNTDGSFRCECPFGYSLDFTGINCVDTDECSVGHPCGQGTCTNVIGGFECACADGFEPGLMMTCEDIDECSLNPLLCAFRCHNTEGSYLCTCPAGYTLREDGAMCRDVDECADGQQDCHARGMECKNLIGTFACVCPPGMRPLPGSGEGCTDDNECHAQPDLCVNGRCVNTAGSFRCDCDEGFQPSPTLTECHDIRQGPCFAEVLQTMCRSLSSSSEAVTRAECCCGGGRGWGPRCELCPLPGTSAYRKLCPHGSGYTAEGRDVDECRMLAHLCAHGECINSLGSFRCHCQAGYTPDATATTCLDMDECSQVPKPCTFLCKNTKGSFLCSCPRGYLLEEDGRTCKDLDECTSRQHNCQFLCVNTVGAFTCRCPPGFTQHHQACFDNDECSAQPGPCGAHGHCHNTPGSFRCECHQGFTLVSSGHGCEDVNECDGPHRCQHGCQNQLGGYRCSCPQGFTQHSQWAQCVDENECALSPPTCGSASCRNTLGGFRCVCPSGFDFDQALGGCQEVDECAGRRGPCSYSCANTPGGFLCGCPQGYFRAGQGHCVSGLGFSPGPQDTPDKEELLSSEACYECKINGLSPRDRPRRSAHRDHQVNLATLDSEALLTLGLNLSHLGRAERILELRPALEGLEGRIRYVIVRGNEQGFFRMHHLRGVSSLQLGRRRPGPGTYRLEVVSHMAGPWGVQPEGQPGPWGQALRLKVQLQLL
" sig_peptide 22..108 /gene="FBN3" mat_peptide 109..8448 /gene="FBN3" /product="fibrillin-3" misc_feature 607..729 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 760..858 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 925..1056 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 1366..1458 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 1486..1608 /gene="FBN3" /note="Calcium-binding EGF domain; Region: EGF_CA; pfam07645" /db_xref="CDD:148962" misc_feature 1612..>1704 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 1675..1746 /gene="FBN3" /note="Complement Clr-like EGF-like; Region: cEGF; pfam12662" /db_xref="CDD:205000" misc_feature 1735..1857 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 1900..2028 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 2065..2187 /gene="FBN3" /note="Calcium-binding EGF domain; Region: EGF_CA; pfam07645" /db_xref="CDD:148962" misc_feature 2476..2592 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 2626..2730 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(2626..2628,2635..2637,2680..2682) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 2794..2916 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 3103..3201 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(3103..3105,3112..3114,3157..3159) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 3232..3336 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(3232..3234,3241..3243,3286..3288) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 3358..3459 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 3427..3495 /gene="FBN3" /note="Complement Clr-like EGF-like; Region: cEGF; pfam12662" /db_xref="CDD:205000" misc_feature 3547..3618 /gene="FBN3" /note="Complement Clr-like EGF-like; Region: cEGF; pfam12662" /db_xref="CDD:205000" misc_feature 3733..3840 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 3859..3966 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(3859..3861,3868..3870,3916..3918) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 3994..4101 /gene="FBN3" /note="EGF domain; Region: EGF_3; pfam12947" /db_xref="CDD:205157" misc_feature 4231..4353 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 4354..4449 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 4537..4656 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 4708..4809 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(4708..4710,4717..4719,4762..4764) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 4996..5127 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 5182..5304 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 5308..5433 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 5560..5664 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 5746..5817 /gene="FBN3" /note="Complement Clr-like EGF-like; Region: cEGF; pfam12662" /db_xref="CDD:205000" misc_feature 5806..5904 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 5926..6027 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(5926..5928,5935..5937,5980..5982) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 6091..6222 /gene="FBN3" /note="TB domain; Region: TB; pfam00683" /db_xref="CDD:201391" misc_feature 6271..6375 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(6271..6273,6280..6282,6325..6327) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 6397..6516 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 6517..6636 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 6640..6765 /gene="FBN3" /note="Calcium-binding EGF domain; Region: EGF_CA; pfam07645" /db_xref="CDD:148962" misc_feature 7108..7218 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature <7228..7350 /gene="FBN3" /note="Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cl00057" /db_xref="CDD:206808" misc_feature 7357..>7449 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" misc_feature 7474..7578 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:28936" misc_feature order(7474..7476,7483..7485,7531..7533) /gene="FBN3" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:28936" misc_feature 7603..7695 /gene="FBN3" /note="Calcium-binding EGF-like domain; Region: EGF_CA; smart00179" /db_xref="CDD:197557" misc_feature 7723..>7818 /gene="FBN3" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cl09941" /db_xref="CDD:209104" exon 189..271 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 272..370 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 371..466 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 377 /gene="FBN3" /replace="c" /replace="g" /db_xref="dbSNP:3813773" exon 467..562 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 563..760 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 600 /gene="FBN3" /replace="c" /replace="g" /db_xref="dbSNP:35460337" variation 737 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35525553" exon 761..886 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 887..1039 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 1040..1222 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 1059 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:34278476" variation 1134 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35999680" exon 1223..1366 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 1367..1486 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 1439 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35277492" exon 1487..1612 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 1613..1735 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 1620 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:35202360" variation 1645 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:36124795" exon 1736..2011 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 1854 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:34408601" variation 1950 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:3813774" exon 2012..2065 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 2066..2191 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 2192..2317 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 2318..2437 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 2438..2575 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 2526 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:3813778" exon 2576..2626 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 2623 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35025963" exon 2627..2752 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 2753..2977 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 2833 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35840170" variation 2868 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:34591995" exon 2978..3103 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3104..3232 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3233..3358 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 3268 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:35579498" exon 3359..3484 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3485..3607 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3608..3733 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 3647 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:34684510" exon 3734..3859 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3860..3982 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 3983..4105 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 4068 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:35306870" exon 4106..4231 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4232..4354 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4355..4477 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4478..4639 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 4484 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35442268" exon 4640..4708 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4709..4834 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4835..4960 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 4961..5110 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 5111..5182 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 5169 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35534815" exon 5183..5308 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 5309..5434 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 5435..5560 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 5438 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:3829817" exon 5561..5677 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 5678..5806 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 5807..5926 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 5917 /gene="FBN3" /replace="c" /replace="g" /db_xref="dbSNP:34167077" exon 5927..6052 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6053..6205 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6206..6271 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6272..6397 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6398..6517 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6518..6640 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6641..6775 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6776..6901 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 6902..7108 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 6927 /gene="FBN3" /replace="c" /replace="t" /db_xref="dbSNP:34514496" exon 7109..7234 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 7235..7357 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 7358..7474 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 7433 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:3848570" exon 7475..7603 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 7523 /gene="FBN3" /replace="a" /replace="c" /db_xref="dbSNP:201291150" exon 7604..7723 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 7641 /gene="FBN3" /replace="g" /replace="t" /db_xref="dbSNP:35477781" exon 7724..7958 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 7801 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:35318692" exon 7959..8109 /gene="FBN3" /inference="alignment:Splign:1.39.8" exon 8110..8967 /gene="FBN3" /inference="alignment:Splign:1.39.8" variation 8251 /gene="FBN3" /replace="a" /replace="g" /db_xref="dbSNP:34941422" variation 8387 /gene="FBN3" /replace="a" /replace="c" /db_xref="dbSNP:35794930" polyA_signal 8948..8953 /gene="FBN3" polyA_site 8967 /gene="FBN3" ORIGIN
gcagcctccaggggacacgccatgactctggagggtctgtatttggcaaggggccccctggcccggctcctgctggcctggtcggccctgttgtgcatggcaggtggccaaggccgctgggacggggccttggaggctgcaggtcctggacgtgtgcggaggcggggcagcccaggcatcttgcaggggccgaatgtgtgcggctcccggttccatgcctactgctgtccaggctggaggacattccctggcaggagccagtgtgtcgtacccatctgtaggcgcgcctgcggtgaaggcttctgctcccagcccaacctgtgcacctgtgcggatgggacgctggctcccagctgcggggtgagccgagggtcagggtgcagtgtgagctgtatgaatgggggcacctgccggggggcgtcctgtctgtgtcagaagggctacacaggcaccgtgtgtgggcagcccatctgtgaccgcggctgccacaatgggggtcgctgcattgggcccaaccgctgcgcctgtgtgtatggcttcatgggacctcaatgtgagagagattaccggacgggaccctgctttggccaagtaggccccgaggggtgccagcatcagctgacgggcctcgtgtgcaccaaggcactttgctgtgccactgtgggccgtgcctggggccttccatgtgaactttgccctgcacagccacacccctgccgccgcggcttcatccccaatatccacacgggggcctgccaagatgtggatgagtgccaggctgtgccaggcctgtgccagggaggcagctgcgtcaacatggtgggctccttccattgccgctgtccagttggacaccggctcagtgacagcagcgccgcatgtgaagactaccgggccggcgcctgcttctcagtgcttttcgggggccgctgtgctggagacctcgccggccactacactcgcaggcagtgctgctgtgacaggggcaggtgctgggcagctggcccggtccctgagctgtgtcctcctcggggctccaatgaattccagcaactgtgcgcccagcggctgccgctgctacccggccaccctggcctcttccctggcctcctgggcttcggatccaatggcatgggtccccctcttgggccagcgcgactcaacccccatggctctgatgcgcgtgggatccccagcctgggccctggcaactctaatattggcactgctaccctgaaccagaccattgacatctgccgacacttcaccaacctgtgtctgaatggccgctgcctgcccacgccttccagctaccgctgcgagtgtaacgtgggctacacccaggacgtgcgcggcgagtgcattgatgtagacgaatgcaccagcagcccctgccaccacggtgactgcgtcaacatccccggcacctaccactgccggtgctacccgggcttccaggccacgcccaccaggcaggcatgcgtggatgtggacgagtgcattgtcagtggtggcctttgtcacctgggccgctgtgtcaacacagagggcagcttccagtgtgtctgcaatgcaggcttcgagctcagccctgacggcaagaactgtgtggaccacaacgagtgtgccaccagcaccatgtgcgtcaacggcgtgtgtctcaacgaggatggcagcttctcctgcctctgcaaacccggcttcctgctggcgcctggcggccactactgcatggacattgacgagtgccagacgcccggcatctgcgtgaacggccactgtaccaacaccgagggctccttccgctgccagtgcctgggggggctggcggtaggcacggatggccgcgtgtgcgtggacacccacgtgcgcagcacctgctatggggccatcgagaagggctcctgtgcccgccccttccctggcactgtcaccaagtccgagtgctgctgtgccaatccggaccacggttttggggagccctgccagctttgtcctgccaaagactccgctgagttccaggcactgtgcagcagtgggcttggcattaccacggatggtcgagacatcaacgagtgtgctctggatcctgaggtttgtgccaatggcgtgtgcgagaaccttcggggcagctaccgctgtgtctgcaacctgggttatgaggcaggtgcctcaggcaaggactgcacagacgtggatgagtgtgccctcaacagcctcctgtgtgacaacgggtggtgccagaatagccctggcagctacagctgctcctgcccccccggcttccacttctggcaggacacggagatctgcaaagatgtcgacgaatgcctgtccagcccgtgtgtgagtggcgtctgtcggaacctggccggctcctacacctgcaaatgtggccctggcagccggctggacccctctggtaccttctgtctagacagcaccaagggcacctgctggctgaagatccaggagagccgctgtgaggtgaaccttcagggagccagcctgcggtctgagtgctgcgccaccctcggggcagcctgggggagcccctgcgaacgctgcgagatcgaccctgcctgtgcccggggctttgcccggatgacgggtgtcacctgcgatgatgtgaacgagtgtgagtccttcccgggagtctgtcccaacgggcgttgcgtcaacactgctgggtctttccgctgtgagtgtccagagggcctgatgctggacgcctcaggccggctgtgcgtggatgtgagattggaaccatgtttcctgcgatgggatgaggatgagtgtggggtcaccctgcctggcaagtaccggatggacgtctgctgctgctccatcggggccgtgtggggagtcgagtgcgaggcctgcccggatcccgagtctctggagttcgccagcctgtgcccgcgggggctgggcttcgccagccgggacttcctgtctggccgaccattctataaagatgtgaatgaatgcaaggtgttccctggcctctgcacgcacggtacctgcagaaacacggtgggcagcttccactgcgcctgtgcggggggcttcgccctggatgcccaggaacggaactgcacagatatcgacgagtgtcgcatctctcctgacctctgcggccagggcacctgtgtcaacacgccgggcagctttgagtgcgagtgttttcccggctacgagagtggcttcatgctgatgaagaactgcatggacgtggacgagtgtgcaagggacccgctgctctgccggggaggcacttgcaccaacacggatgggagctacaagtgccagtgtccccctgggcatgagctgacggccaagggcactgcctgtgaggacatcgatgagtgctccctgagtgatggcctgtgtccccatggccagtgtgtcaatgtcatcggtgccttccagtgctcctgccatgccggcttccagagcacacctgaccgccagggctgcgtggacatcaacgaatgccgggtccagaatggtgggtgtgacgtgcactgtattaacactgagggcagctaccggtgcagctgtgggcagggctactcgctgatgcccgacggaagggcatgtgcagacgtggacgagtgtgaagagaacccccgcgtttgtgaccaaggccactgcaccaacatgccagggggtcaccgctgcctgtgctatgatggcttcatggccacgccagacatgaggacatgtgttgatgtggatgagtgtgacctgaaccctcacatctgcctccatggggactgcgagaacacgaagggttcctttgtctgccactgtcagctgggctacatggtcaggaagggggccacaggctgctctgatgtggatgaatgcgaggttggaggacacaactgtgacagtcacgcctcctgtctcaacatcccggggagtttcagctgtaggtgcctgccaggctgggtgggggatggcttcgaatgtcacgacctggatgaatgcgtctcccaggagcaccggtgcagcccaagaggtgactgtctcaatgtccctggctcctaccgctgcacctgccgccagggctttgccggggatggcttcttctgcgaagacagggatgaatgtgccgagaacgtggacctctgtgacaacgggcagtgcctcaatgcgcccggcgggtaccgctgtgaatgtgagatgggctttgaccccaccgaggaccaccgggcctgccaggatgtggacgagtgtgcgcaagggaacctctgtgcatttgggagctgtgagaacctgcctggaatgttccgctgcatctgcaatggtggctacgaactggaccgagggggtggcaactgcacagacatcaacgagtgtgcagacccagtaaactgcatcaacggcgtgtgcattaacacccccggcagctacctctgcagctgcccccaggattttgagctgaaccccagcggagtgggctgcgtggacactcgggccgggaactgtttcctggagacgcatgaccgaggggacagtggcatttcctgcagtgccgagatcggagttggtgtcacccgagcttcctgctgttgctccctgggccgggcttggggcaatccctgtgagctgtgccctatggccaacaccactgagtacagaaccctgtgcccgggtggtgagggcttccagcctaaccgcatcactgtcattctggaagacatcgacgagtgccaagagctgccagggctgtgtcaggggggtgactgcgtcaacacgtttggcagtttccagtgtgagtgcccacctggctaccacctcagtgagcacacccgcatctgtgaggatattgacgaatgctccacacactccggcatctgtggccctggcacctgctacaacaccctggggaactacacctgtgtctgccctgcagagtacctccaagtcaatggtggcaacaactgcatggatatgaggaagagtgtctgcttccggcactataacggcacatgtcaaaatgagctggccttcaacgtgacccggaaaatgtgttgctgctcctacaacattggccaggcctggaatagaccctgtgaggcctgccccactcccatcagtcctgactaccagatcctgtgtggaaatcaggccccgggattcctcactgacatccacacggggaagccccttgacattgatgagtgtggggagatccccgccatctgtgccaatggcatctgcataaaccagatcgggagtttccgctgcgagtgccccgcaggcttcaactacaacagcatcctgctggcttgtgaagatgtcgatgagtgtggcagcagggagagtccctgccagcagaatgctgactgcatcaacatccccggtagctaccgctgcaagtgcacccgagggtacaaactgtcgccaggcggggcttgtgtgggacggaatgagtgtcgggagatcccgaatgtctgtagccatggtgactgcatggacacagaaggcagctacatgtgtctgtgtcaccgtggattccaggcctctgcagaccagaccctgtgcatggacattgacgagtgtgaccggcagccttgtggaaatgggacctgcaagaacatcattggctcctacaactgcctctgcttccctggctttgtggtgacacacaatggggattgtgtggattttgatgagtgtactaccctggtggggcaggtgtgccgatttggccattgcctcaacacagctggttccttccactgcctctgccaggatggctttgagctcacagctgatgggaagaactgtgtggacaccaatgagtgcctcagccttgcaggaacctgcctacccggcacttgccagaacctcgagggctccttccgctgcatctgtccccctggcttccaggtgcagagtgaccactgcattgatatcgacgagtgctcagaggagcccaacctctgcctctttggcacctgtaccaacagccctgggagcttccagtgcctctgcccacctggctttgtcctctctgacaatgggcaccgttgctttgacacacggcagagtttctgcttcacccgttttgaggctgggaagtgctcggtgcccaaagctttcaacaccaccaagacccgctgctgctgcagtaagaggcctggggagggctggggagacccctgcgaactgtgtccccaggagggcagcgctgcctttcaggagctctgcccctttggccacggggcagtcccaggcccggatgactcccgagaagacgtgaatgagtgtgcagagaaccctggcgtctgcactaacggcgtctgtgtcaacaccgatggatccttccgctgtgagtgtccctttggctacagcctggacttcactggcatcaactgtgtggacacagacgagtgctctgtcggccacccctgtgggcaagggacatgcaccaatgtcatcggaggcttcgaatgtgcctgtgctgacggctttgagcctggcctcatgatgacctgcgaggacatcgacgaatgctccctgaacccgctgctctgtgccttccgctgccacaataccgagggctcctacctgtgcacctgtccagccggctacaccctgcgggaggatggggccatgtgtcgagatgtggacgagtgtgcagatggtcagcaggactgccacgcccggggcatggagtgcaagaacctcatcggtaccttcgcgtgcgtctgtcccccaggcatgcggcccctgcctggctctggggagggctgcacagatgacaatgaatgccacgctcagcctgacctctgtgtcaacggccgctgtgtcaacaccgcgggcagcttccggtgcgactgtgatgagggattccagcccagccccacccttaccgagtgccacgacatccggcaggggccctgctttgccgaggtgctgcagaccatgtgccggtctctgtccagcagcagtgaggctgtcaccagggccgagtgctgctgtgggggtggccggggctgggggccccgctgcgagctctgtcccctgcccggcacctctgcctacaggaagctgtgcccccatggctcaggctacactgctgagggccgagatgtagatgaatgccgtatgcttgctcacctgtgtgctcatggggagtgcatcaacagccttggctccttccgctgccactgtcaggccgggtacacaccggatgctactgctactacctgcctggatatggatgagtgcagccaggtccccaagccatgtaccttcctctgcaaaaacacgaagggcagtttcctgtgcagctgtccccgaggctacctgctggaggaggatggcaggacctgcaaagacctggacgaatgcacctcccggcagcacaactgtcagttcctctgtgtcaacactgtgggcgccttcacctgccgctgtccgcccggcttcacccagcaccaccaggcctgcttcgacaatgatgagtgctcagcccagcctggcccatgtggtgcccacgggcactgccacaacaccccgggcagcttccgctgtgaatgccaccaaggcttcaccctggtcagctcaggccatggctgtgaagatgtgaatgaatgtgatgggccccaccgctgccagcatggctgtcagaaccagctagggggctaccgctgcagctgcccccagggtttcacccagcactcccagtgggcccagtgtgtggatgagaatgagtgtgccctgtcgccccccacctgcgggagcgcctcctgtcgcaacactcttggtggcttccgctgcgtctgcccctctggctttgactttgatcaggccctcgggggctgccaggaggtggatgagtgcgccggacggcgtggcccctgtagctacagctgtgccaacacgcctggtggcttcctgtgcggctgtcctcaaggctacttccgggctgggcaagggcactgtgtctccggcctgggcttcagccccggaccccaggacaccccggacaaagaggagctgctctcgtctgaagcctgctacgaatgcaagatcaatggcctctcccctcgggaccggccacgacgcagtgcccacagggaccaccaggtgaacctggccacccttgactccgaggccctgctgaccttgggcctgaacctctcacacctgggccgggccgagcgcatcctggagctccggccggccctggagggtctagagggccggatccgctacgtcatcgtccgcggaaacgagcaaggtttctttcgcatgcatcacctccgtggcgtcagctccctgcagctggggcggaggcggccggggcctggaacctaccggctggaggtggtgagccacatggcaggaccctggggtgtccagccagaggggcagccagggccatggggccaggccttgaggctgaaggtgcagctgcagttgctttagttgggaggagcctcagtgggccccagctgtccagagaagggggattctggaactgggaaggactgatccccagaagcgatggctgaccagattgaaccccgaaactcaggaagagtgaaatgctacacgacaacctcaggcaagcccggcctctgcctgggcctctgtgccagccccgggggccccccagttactcagtctttcctggagacagcaagaagctgcaatgtgcaatccccctgcccccacagccaaggtcaggaagaggccctgtggtcaccgtgtctggccaatctcaggctttcacttctgtactgcactgtggcttgccctggcggggggcagggggttggcaggacatggcaatgggcaactggggtgggcacagggcttattcctcggagtagaagggtgtacagggggcccagactccacagtgacttgccacatttgccccccatttggagaatgcttttatatcaaaagtggagacgataataaagttattttgggtta
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:84467 -> Molecular function: GO:0005201 [extracellular matrix structural constituent] evidence: IEA GeneID:84467 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA GeneID:84467 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.