GGRNA Home | Help | Advanced search

2024-04-19 12:00:28, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_032447               8967 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens fibrillin 3 (FBN3), mRNA.
ACCESSION   NM_032447
VERSION     NM_032447.3  GI:56237020
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8967)
  AUTHORS   Yalamanchi,S.K., Sam,S., Cardenas,M.O., Holaday,L.W., Urbanek,M.
            and Dunaif,A.
  TITLE     Association of fibrillin-3 and transcription factor-7-like 2 gene
            variants with metabolic phenotypes in PCOS
  JOURNAL   Obesity (Silver Spring) 20 (6), 1273-1278 (2012)
   PUBMED   22301903
  REMARK    GeneRIF: The FBN3 risk allele may be associated with changes in
            basal glucose homeostasis in PCOS.
REFERENCE   2  (bases 1 to 8967)
  AUTHORS   Hatzirodos,N., Bayne,R.A., Irving-Rodgers,H.F., Hummitzsch,K.,
            Sabatier,L., Lee,S., Bonner,W., Gibson,M.A., Rainey,W.E.,
            Carr,B.R., Mason,H.D., Reinhardt,D.P., Anderson,R.A. and
            Rodgers,R.J.
  TITLE     Linkage of regulators of TGF-beta activity in the fetal ovary to
            polycystic ovary syndrome
  JOURNAL   FASEB J. 25 (7), 2256-2265 (2011)
   PUBMED   21411746
  REMARK    GeneRIF: Data show that TGF-beta pathways operate during ovarian
            fetal development, and fibrillin 3 is highly expressed at a
            critical stage early in developing human and bovine fetal ovaries.
REFERENCE   3  (bases 1 to 8967)
  AUTHORS   Sabatier,L., Miosge,N., Hubmacher,D., Lin,G., Davis,E.C. and
            Reinhardt,D.P.
  TITLE     Fibrillin-3 expression in human development
  JOURNAL   Matrix Biol. 30 (1), 43-52 (2011)
   PUBMED   20970500
  REMARK    GeneRIF: fibrillin-3, compared to the other fibrillins, fulfills
            both overlapping and distinct functions in human development
REFERENCE   4  (bases 1 to 8967)
  AUTHORS   Raja-Khan,N., Kunselman,A.R., Demers,L.M., Ewens,K.G.,
            Spielman,R.S. and Legro,R.S.
  TITLE     A variant in the fibrillin-3 gene is associated with TGF-beta and
            inhibin B levels in women with polycystic ovary syndrome
  JOURNAL   Fertil. Steril. 94 (7), 2916-2919 (2010)
   PUBMED   20630504
  REMARK    GeneRIF: A variant in the fibrillin-3 gene is associated with
            TGF-beta and inhibin B levels in women with polycystic ovary
            syndrome.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 8967)
  AUTHORS   Jordan,C.D., Bohling,S.D., Charbonneau,N.L. and Sakai,L.Y.
  TITLE     Fibrillins in adult human ovary and polycystic ovary syndrome: is
            fibrillin-3 affected in PCOS?
  JOURNAL   J. Histochem. Cytochem. 58 (10), 903-915 (2010)
   PUBMED   20855553
  REMARK    GeneRIF: Loss of fibrillin-3 during folliculogenesis may be an
            important factor in polycystic ovary syndrome pathogenesis.
REFERENCE   6  (bases 1 to 8967)
  AUTHORS   Urbanek,M., Sam,S., Legro,R.S. and Dunaif,A.
  TITLE     Identification of a polycystic ovary syndrome susceptibility
            variant in fibrillin-3 and association with a metabolic phenotype
  JOURNAL   J. Clin. Endocrinol. Metab. 92 (11), 4191-4198 (2007)
   PUBMED   17785364
  REMARK    GeneRIF: fibrillin-3 gene showed the strongest evidence for
            association with Polycystic ovary syndrome
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 8967)
  AUTHORS   Fu,G.K., Wang,J.T., Yang,J., Au-Young,J. and Stuve,L.L.
  TITLE     Circular rapid amplification of cDNA ends for high-throughput
            extension cloning of partial genes
  JOURNAL   Genomics 84 (1), 205-210 (2004)
   PUBMED   15203218
REFERENCE   8  (bases 1 to 8967)
  AUTHORS   Corson,G.M., Charbonneau,N.L., Keene,D.R. and Sakai,L.Y.
  TITLE     Differential expression of fibrillin-3 adds to microfibril variety
            in human and avian, but not rodent, connective tissues
  JOURNAL   Genomics 83 (3), 461-472 (2004)
   PUBMED   14962672
REFERENCE   9  (bases 1 to 8967)
  AUTHORS   Uyeda,T., Takahashi,T., Eto,S., Sato,T., Xu,G., Kanezaki,R.,
            Toki,T., Yonesaka,S. and Ito,E.
  TITLE     Three novel mutations of the fibrillin-1 gene and ten single
            nucleotide polymorphisms of the fibrillin-3 gene in Marfan syndrome
            patients
  JOURNAL   J. Hum. Genet. 49 (8), 404-407 (2004)
   PUBMED   15221638
REFERENCE   10 (bases 1 to 8967)
  AUTHORS   Faivre,L., Megarbane,A., Alswaid,A., Zylberberg,L., Aldohayan,N.,
            Campos-Xavier,B., Bacq,D., Legeai-Mallet,L., Bonaventure,J.,
            Munnich,A. and Cormier-Daire,V.
  TITLE     Homozygosity mapping of a Weill-Marchesani syndrome locus to
            chromosome 19p13.3-p13.2
  JOURNAL   Hum. Genet. 110 (4), 366-370 (2002)
   PUBMED   11941487
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AY165865.1, AC022146.8,
            CN369190.1, AB053450.2, CD634017.1, AI341180.1 and AC008946.7.
            On Dec 3, 2004 this sequence version replaced gi:31542627.
            
            Summary: This gene encodes a protein that belongs to the fibrillin
            gene family. Fibrillins are extracellular matrix molecules that
            assemble into microfibrils in many connective tissues. This gene is
            most highly expressed in fetal tissues and its protein product is
            localized to extracellular microfibrils of developing skeletal
            elements, skin, lung, kidney, and skeletal muscle. This gene is
            potentially involved in Weill-Marchesani syndrome. While several
            transcript variants may exist for this gene, their full-length
            natures have not been described to date. [provided by RefSeq, Jul
            2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC153882.1, AY165865.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2004              AY165865.1         266-2269
            2005-2005           AC022146.8         73338-73338         c
            2006-3923           AY165865.1         2271-4188
            3924-3924           CN369190.1         262-262
            3925-4860           AY165865.1         4190-5125
            4861-4861           AB053450.2         4861-4861
            4862-6197           AY165865.1         5127-6462
            6198-6198           AB053450.2         6198-6198
            6199-6623           AY165865.1         6464-6888
            6624-6624           CD634017.1         481-481
            6625-7439           AY165865.1         6890-7704
            7440-7440           AI341180.1         460-460             c
            7441-7850           AY165865.1         7706-8115
            7851-7851           AC008946.7         77916-77916         c
            7852-8967           AY165865.1         8117-9232
FEATURES             Location/Qualifiers
     source          1..8967
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13"
     gene            1..8967
                     /gene="FBN3"
                     /note="fibrillin 3"
                     /db_xref="GeneID:84467"
                     /db_xref="HGNC:18794"
                     /db_xref="HPRD:10538"
                     /db_xref="MIM:608529"
     exon            1..188
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     CDS             22..8451
                     /gene="FBN3"
                     /note="fibrillin-3"
                     /codon_start=1
                     /product="fibrillin-3 precursor"
                     /protein_id="NP_115823.3"
                     /db_xref="GI:56237021"
                     /db_xref="CCDS:CCDS12196.1"
                     /db_xref="GeneID:84467"
                     /db_xref="HGNC:18794"
                     /db_xref="HPRD:10538"
                     /db_xref="MIM:608529"
                     /translation="
MTLEGLYLARGPLARLLLAWSALLCMAGGQGRWDGALEAAGPGRVRRRGSPGILQGPNVCGSRFHAYCCPGWRTFPGRSQCVVPICRRACGEGFCSQPNLCTCADGTLAPSCGVSRGSGCSVSCMNGGTCRGASCLCQKGYTGTVCGQPICDRGCHNGGRCIGPNRCACVYGFMGPQCERDYRTGPCFGQVGPEGCQHQLTGLVCTKALCCATVGRAWGLPCELCPAQPHPCRRGFIPNIHTGACQDVDECQAVPGLCQGGSCVNMVGSFHCRCPVGHRLSDSSAACEDYRAGACFSVLFGGRCAGDLAGHYTRRQCCCDRGRCWAAGPVPELCPPRGSNEFQQLCAQRLPLLPGHPGLFPGLLGFGSNGMGPPLGPARLNPHGSDARGIPSLGPGNSNIGTATLNQTIDICRHFTNLCLNGRCLPTPSSYRCECNVGYTQDVRGECIDVDECTSSPCHHGDCVNIPGTYHCRCYPGFQATPTRQACVDVDECIVSGGLCHLGRCVNTEGSFQCVCNAGFELSPDGKNCVDHNECATSTMCVNGVCLNEDGSFSCLCKPGFLLAPGGHYCMDIDECQTPGICVNGHCTNTEGSFRCQCLGGLAVGTDGRVCVDTHVRSTCYGAIEKGSCARPFPGTVTKSECCCANPDHGFGEPCQLCPAKDSAEFQALCSSGLGITTDGRDINECALDPEVCANGVCENLRGSYRCVCNLGYEAGASGKDCTDVDECALNSLLCDNGWCQNSPGSYSCSCPPGFHFWQDTEICKDVDECLSSPCVSGVCRNLAGSYTCKCGPGSRLDPSGTFCLDSTKGTCWLKIQESRCEVNLQGASLRSECCATLGAAWGSPCERCEIDPACARGFARMTGVTCDDVNECESFPGVCPNGRCVNTAGSFRCECPEGLMLDASGRLCVDVRLEPCFLRWDEDECGVTLPGKYRMDVCCCSIGAVWGVECEACPDPESLEFASLCPRGLGFASRDFLSGRPFYKDVNECKVFPGLCTHGTCRNTVGSFHCACAGGFALDAQERNCTDIDECRISPDLCGQGTCVNTPGSFECECFPGYESGFMLMKNCMDVDECARDPLLCRGGTCTNTDGSYKCQCPPGHELTAKGTACEDIDECSLSDGLCPHGQCVNVIGAFQCSCHAGFQSTPDRQGCVDINECRVQNGGCDVHCINTEGSYRCSCGQGYSLMPDGRACADVDECEENPRVCDQGHCTNMPGGHRCLCYDGFMATPDMRTCVDVDECDLNPHICLHGDCENTKGSFVCHCQLGYMVRKGATGCSDVDECEVGGHNCDSHASCLNIPGSFSCRCLPGWVGDGFECHDLDECVSQEHRCSPRGDCLNVPGSYRCTCRQGFAGDGFFCEDRDECAENVDLCDNGQCLNAPGGYRCECEMGFDPTEDHRACQDVDECAQGNLCAFGSCENLPGMFRCICNGGYELDRGGGNCTDINECADPVNCINGVCINTPGSYLCSCPQDFELNPSGVGCVDTRAGNCFLETHDRGDSGISCSAEIGVGVTRASCCCSLGRAWGNPCELCPMANTTEYRTLCPGGEGFQPNRITVILEDIDECQELPGLCQGGDCVNTFGSFQCECPPGYHLSEHTRICEDIDECSTHSGICGPGTCYNTLGNYTCVCPAEYLQVNGGNNCMDMRKSVCFRHYNGTCQNELAFNVTRKMCCCSYNIGQAWNRPCEACPTPISPDYQILCGNQAPGFLTDIHTGKPLDIDECGEIPAICANGICINQIGSFRCECPAGFNYNSILLACEDVDECGSRESPCQQNADCINIPGSYRCKCTRGYKLSPGGACVGRNECREIPNVCSHGDCMDTEGSYMCLCHRGFQASADQTLCMDIDECDRQPCGNGTCKNIIGSYNCLCFPGFVVTHNGDCVDFDECTTLVGQVCRFGHCLNTAGSFHCLCQDGFELTADGKNCVDTNECLSLAGTCLPGTCQNLEGSFRCICPPGFQVQSDHCIDIDECSEEPNLCLFGTCTNSPGSFQCLCPPGFVLSDNGHRCFDTRQSFCFTRFEAGKCSVPKAFNTTKTRCCCSKRPGEGWGDPCELCPQEGSAAFQELCPFGHGAVPGPDDSREDVNECAENPGVCTNGVCVNTDGSFRCECPFGYSLDFTGINCVDTDECSVGHPCGQGTCTNVIGGFECACADGFEPGLMMTCEDIDECSLNPLLCAFRCHNTEGSYLCTCPAGYTLREDGAMCRDVDECADGQQDCHARGMECKNLIGTFACVCPPGMRPLPGSGEGCTDDNECHAQPDLCVNGRCVNTAGSFRCDCDEGFQPSPTLTECHDIRQGPCFAEVLQTMCRSLSSSSEAVTRAECCCGGGRGWGPRCELCPLPGTSAYRKLCPHGSGYTAEGRDVDECRMLAHLCAHGECINSLGSFRCHCQAGYTPDATATTCLDMDECSQVPKPCTFLCKNTKGSFLCSCPRGYLLEEDGRTCKDLDECTSRQHNCQFLCVNTVGAFTCRCPPGFTQHHQACFDNDECSAQPGPCGAHGHCHNTPGSFRCECHQGFTLVSSGHGCEDVNECDGPHRCQHGCQNQLGGYRCSCPQGFTQHSQWAQCVDENECALSPPTCGSASCRNTLGGFRCVCPSGFDFDQALGGCQEVDECAGRRGPCSYSCANTPGGFLCGCPQGYFRAGQGHCVSGLGFSPGPQDTPDKEELLSSEACYECKINGLSPRDRPRRSAHRDHQVNLATLDSEALLTLGLNLSHLGRAERILELRPALEGLEGRIRYVIVRGNEQGFFRMHHLRGVSSLQLGRRRPGPGTYRLEVVSHMAGPWGVQPEGQPGPWGQALRLKVQLQLL
"
     sig_peptide     22..108
                     /gene="FBN3"
     mat_peptide     109..8448
                     /gene="FBN3"
                     /product="fibrillin-3"
     misc_feature    607..729
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    760..858
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    925..1056
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    1366..1458
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    1486..1608
                     /gene="FBN3"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:148962"
     misc_feature    1612..>1704
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    1675..1746
                     /gene="FBN3"
                     /note="Complement Clr-like EGF-like; Region: cEGF;
                     pfam12662"
                     /db_xref="CDD:205000"
     misc_feature    1735..1857
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    1900..2028
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    2065..2187
                     /gene="FBN3"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:148962"
     misc_feature    2476..2592
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    2626..2730
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(2626..2628,2635..2637,2680..2682)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    2794..2916
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    3103..3201
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(3103..3105,3112..3114,3157..3159)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    3232..3336
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(3232..3234,3241..3243,3286..3288)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    3358..3459
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    3427..3495
                     /gene="FBN3"
                     /note="Complement Clr-like EGF-like; Region: cEGF;
                     pfam12662"
                     /db_xref="CDD:205000"
     misc_feature    3547..3618
                     /gene="FBN3"
                     /note="Complement Clr-like EGF-like; Region: cEGF;
                     pfam12662"
                     /db_xref="CDD:205000"
     misc_feature    3733..3840
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    3859..3966
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(3859..3861,3868..3870,3916..3918)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    3994..4101
                     /gene="FBN3"
                     /note="EGF domain; Region: EGF_3; pfam12947"
                     /db_xref="CDD:205157"
     misc_feature    4231..4353
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    4354..4449
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    4537..4656
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    4708..4809
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(4708..4710,4717..4719,4762..4764)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    4996..5127
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    5182..5304
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    5308..5433
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    5560..5664
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    5746..5817
                     /gene="FBN3"
                     /note="Complement Clr-like EGF-like; Region: cEGF;
                     pfam12662"
                     /db_xref="CDD:205000"
     misc_feature    5806..5904
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    5926..6027
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(5926..5928,5935..5937,5980..5982)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    6091..6222
                     /gene="FBN3"
                     /note="TB domain; Region: TB; pfam00683"
                     /db_xref="CDD:201391"
     misc_feature    6271..6375
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(6271..6273,6280..6282,6325..6327)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    6397..6516
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    6517..6636
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    6640..6765
                     /gene="FBN3"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:148962"
     misc_feature    7108..7218
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    <7228..7350
                     /gene="FBN3"
                     /note="Von Willebrand factor type A (vWA) domain was
                     originally found in the blood coagulation protein von
                     Willebrand factor (vWF). Typically, the vWA domain is made
                     up of approximately 200 amino acid residues folded into a
                     classic a/b para-rossmann type of...; Region: vWFA;
                     cl00057"
                     /db_xref="CDD:206808"
     misc_feature    7357..>7449
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     misc_feature    7474..7578
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:28936"
     misc_feature    order(7474..7476,7483..7485,7531..7533)
                     /gene="FBN3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28936"
     misc_feature    7603..7695
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:197557"
     misc_feature    7723..>7818
                     /gene="FBN3"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cl09941"
                     /db_xref="CDD:209104"
     exon            189..271
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            272..370
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            371..466
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       377
                     /gene="FBN3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813773"
     exon            467..562
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            563..760
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       600
                     /gene="FBN3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35460337"
     variation       737
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35525553"
     exon            761..886
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            887..1039
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            1040..1222
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       1059
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34278476"
     variation       1134
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35999680"
     exon            1223..1366
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            1367..1486
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       1439
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35277492"
     exon            1487..1612
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            1613..1735
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       1620
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35202360"
     variation       1645
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36124795"
     exon            1736..2011
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       1854
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34408601"
     variation       1950
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813774"
     exon            2012..2065
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            2066..2191
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            2192..2317
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            2318..2437
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            2438..2575
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       2526
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813778"
     exon            2576..2626
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       2623
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35025963"
     exon            2627..2752
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            2753..2977
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       2833
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35840170"
     variation       2868
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34591995"
     exon            2978..3103
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3104..3232
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3233..3358
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       3268
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35579498"
     exon            3359..3484
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3485..3607
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3608..3733
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       3647
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34684510"
     exon            3734..3859
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3860..3982
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            3983..4105
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       4068
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35306870"
     exon            4106..4231
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4232..4354
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4355..4477
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4478..4639
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       4484
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35442268"
     exon            4640..4708
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4709..4834
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4835..4960
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            4961..5110
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            5111..5182
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       5169
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35534815"
     exon            5183..5308
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            5309..5434
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            5435..5560
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       5438
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829817"
     exon            5561..5677
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            5678..5806
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            5807..5926
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       5917
                     /gene="FBN3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34167077"
     exon            5927..6052
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6053..6205
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6206..6271
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6272..6397
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6398..6517
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6518..6640
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6641..6775
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6776..6901
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            6902..7108
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       6927
                     /gene="FBN3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34514496"
     exon            7109..7234
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            7235..7357
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            7358..7474
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       7433
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3848570"
     exon            7475..7603
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       7523
                     /gene="FBN3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201291150"
     exon            7604..7723
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       7641
                     /gene="FBN3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35477781"
     exon            7724..7958
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       7801
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35318692"
     exon            7959..8109
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     exon            8110..8967
                     /gene="FBN3"
                     /inference="alignment:Splign:1.39.8"
     variation       8251
                     /gene="FBN3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34941422"
     variation       8387
                     /gene="FBN3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35794930"
     polyA_signal    8948..8953
                     /gene="FBN3"
     polyA_site      8967
                     /gene="FBN3"
ORIGIN      
gcagcctccaggggacacgccatgactctggagggtctgtatttggcaaggggccccctggcccggctcctgctggcctggtcggccctgttgtgcatggcaggtggccaaggccgctgggacggggccttggaggctgcaggtcctggacgtgtgcggaggcggggcagcccaggcatcttgcaggggccgaatgtgtgcggctcccggttccatgcctactgctgtccaggctggaggacattccctggcaggagccagtgtgtcgtacccatctgtaggcgcgcctgcggtgaaggcttctgctcccagcccaacctgtgcacctgtgcggatgggacgctggctcccagctgcggggtgagccgagggtcagggtgcagtgtgagctgtatgaatgggggcacctgccggggggcgtcctgtctgtgtcagaagggctacacaggcaccgtgtgtgggcagcccatctgtgaccgcggctgccacaatgggggtcgctgcattgggcccaaccgctgcgcctgtgtgtatggcttcatgggacctcaatgtgagagagattaccggacgggaccctgctttggccaagtaggccccgaggggtgccagcatcagctgacgggcctcgtgtgcaccaaggcactttgctgtgccactgtgggccgtgcctggggccttccatgtgaactttgccctgcacagccacacccctgccgccgcggcttcatccccaatatccacacgggggcctgccaagatgtggatgagtgccaggctgtgccaggcctgtgccagggaggcagctgcgtcaacatggtgggctccttccattgccgctgtccagttggacaccggctcagtgacagcagcgccgcatgtgaagactaccgggccggcgcctgcttctcagtgcttttcgggggccgctgtgctggagacctcgccggccactacactcgcaggcagtgctgctgtgacaggggcaggtgctgggcagctggcccggtccctgagctgtgtcctcctcggggctccaatgaattccagcaactgtgcgcccagcggctgccgctgctacccggccaccctggcctcttccctggcctcctgggcttcggatccaatggcatgggtccccctcttgggccagcgcgactcaacccccatggctctgatgcgcgtgggatccccagcctgggccctggcaactctaatattggcactgctaccctgaaccagaccattgacatctgccgacacttcaccaacctgtgtctgaatggccgctgcctgcccacgccttccagctaccgctgcgagtgtaacgtgggctacacccaggacgtgcgcggcgagtgcattgatgtagacgaatgcaccagcagcccctgccaccacggtgactgcgtcaacatccccggcacctaccactgccggtgctacccgggcttccaggccacgcccaccaggcaggcatgcgtggatgtggacgagtgcattgtcagtggtggcctttgtcacctgggccgctgtgtcaacacagagggcagcttccagtgtgtctgcaatgcaggcttcgagctcagccctgacggcaagaactgtgtggaccacaacgagtgtgccaccagcaccatgtgcgtcaacggcgtgtgtctcaacgaggatggcagcttctcctgcctctgcaaacccggcttcctgctggcgcctggcggccactactgcatggacattgacgagtgccagacgcccggcatctgcgtgaacggccactgtaccaacaccgagggctccttccgctgccagtgcctgggggggctggcggtaggcacggatggccgcgtgtgcgtggacacccacgtgcgcagcacctgctatggggccatcgagaagggctcctgtgcccgccccttccctggcactgtcaccaagtccgagtgctgctgtgccaatccggaccacggttttggggagccctgccagctttgtcctgccaaagactccgctgagttccaggcactgtgcagcagtgggcttggcattaccacggatggtcgagacatcaacgagtgtgctctggatcctgaggtttgtgccaatggcgtgtgcgagaaccttcggggcagctaccgctgtgtctgcaacctgggttatgaggcaggtgcctcaggcaaggactgcacagacgtggatgagtgtgccctcaacagcctcctgtgtgacaacgggtggtgccagaatagccctggcagctacagctgctcctgcccccccggcttccacttctggcaggacacggagatctgcaaagatgtcgacgaatgcctgtccagcccgtgtgtgagtggcgtctgtcggaacctggccggctcctacacctgcaaatgtggccctggcagccggctggacccctctggtaccttctgtctagacagcaccaagggcacctgctggctgaagatccaggagagccgctgtgaggtgaaccttcagggagccagcctgcggtctgagtgctgcgccaccctcggggcagcctgggggagcccctgcgaacgctgcgagatcgaccctgcctgtgcccggggctttgcccggatgacgggtgtcacctgcgatgatgtgaacgagtgtgagtccttcccgggagtctgtcccaacgggcgttgcgtcaacactgctgggtctttccgctgtgagtgtccagagggcctgatgctggacgcctcaggccggctgtgcgtggatgtgagattggaaccatgtttcctgcgatgggatgaggatgagtgtggggtcaccctgcctggcaagtaccggatggacgtctgctgctgctccatcggggccgtgtggggagtcgagtgcgaggcctgcccggatcccgagtctctggagttcgccagcctgtgcccgcgggggctgggcttcgccagccgggacttcctgtctggccgaccattctataaagatgtgaatgaatgcaaggtgttccctggcctctgcacgcacggtacctgcagaaacacggtgggcagcttccactgcgcctgtgcggggggcttcgccctggatgcccaggaacggaactgcacagatatcgacgagtgtcgcatctctcctgacctctgcggccagggcacctgtgtcaacacgccgggcagctttgagtgcgagtgttttcccggctacgagagtggcttcatgctgatgaagaactgcatggacgtggacgagtgtgcaagggacccgctgctctgccggggaggcacttgcaccaacacggatgggagctacaagtgccagtgtccccctgggcatgagctgacggccaagggcactgcctgtgaggacatcgatgagtgctccctgagtgatggcctgtgtccccatggccagtgtgtcaatgtcatcggtgccttccagtgctcctgccatgccggcttccagagcacacctgaccgccagggctgcgtggacatcaacgaatgccgggtccagaatggtgggtgtgacgtgcactgtattaacactgagggcagctaccggtgcagctgtgggcagggctactcgctgatgcccgacggaagggcatgtgcagacgtggacgagtgtgaagagaacccccgcgtttgtgaccaaggccactgcaccaacatgccagggggtcaccgctgcctgtgctatgatggcttcatggccacgccagacatgaggacatgtgttgatgtggatgagtgtgacctgaaccctcacatctgcctccatggggactgcgagaacacgaagggttcctttgtctgccactgtcagctgggctacatggtcaggaagggggccacaggctgctctgatgtggatgaatgcgaggttggaggacacaactgtgacagtcacgcctcctgtctcaacatcccggggagtttcagctgtaggtgcctgccaggctgggtgggggatggcttcgaatgtcacgacctggatgaatgcgtctcccaggagcaccggtgcagcccaagaggtgactgtctcaatgtccctggctcctaccgctgcacctgccgccagggctttgccggggatggcttcttctgcgaagacagggatgaatgtgccgagaacgtggacctctgtgacaacgggcagtgcctcaatgcgcccggcgggtaccgctgtgaatgtgagatgggctttgaccccaccgaggaccaccgggcctgccaggatgtggacgagtgtgcgcaagggaacctctgtgcatttgggagctgtgagaacctgcctggaatgttccgctgcatctgcaatggtggctacgaactggaccgagggggtggcaactgcacagacatcaacgagtgtgcagacccagtaaactgcatcaacggcgtgtgcattaacacccccggcagctacctctgcagctgcccccaggattttgagctgaaccccagcggagtgggctgcgtggacactcgggccgggaactgtttcctggagacgcatgaccgaggggacagtggcatttcctgcagtgccgagatcggagttggtgtcacccgagcttcctgctgttgctccctgggccgggcttggggcaatccctgtgagctgtgccctatggccaacaccactgagtacagaaccctgtgcccgggtggtgagggcttccagcctaaccgcatcactgtcattctggaagacatcgacgagtgccaagagctgccagggctgtgtcaggggggtgactgcgtcaacacgtttggcagtttccagtgtgagtgcccacctggctaccacctcagtgagcacacccgcatctgtgaggatattgacgaatgctccacacactccggcatctgtggccctggcacctgctacaacaccctggggaactacacctgtgtctgccctgcagagtacctccaagtcaatggtggcaacaactgcatggatatgaggaagagtgtctgcttccggcactataacggcacatgtcaaaatgagctggccttcaacgtgacccggaaaatgtgttgctgctcctacaacattggccaggcctggaatagaccctgtgaggcctgccccactcccatcagtcctgactaccagatcctgtgtggaaatcaggccccgggattcctcactgacatccacacggggaagccccttgacattgatgagtgtggggagatccccgccatctgtgccaatggcatctgcataaaccagatcgggagtttccgctgcgagtgccccgcaggcttcaactacaacagcatcctgctggcttgtgaagatgtcgatgagtgtggcagcagggagagtccctgccagcagaatgctgactgcatcaacatccccggtagctaccgctgcaagtgcacccgagggtacaaactgtcgccaggcggggcttgtgtgggacggaatgagtgtcgggagatcccgaatgtctgtagccatggtgactgcatggacacagaaggcagctacatgtgtctgtgtcaccgtggattccaggcctctgcagaccagaccctgtgcatggacattgacgagtgtgaccggcagccttgtggaaatgggacctgcaagaacatcattggctcctacaactgcctctgcttccctggctttgtggtgacacacaatggggattgtgtggattttgatgagtgtactaccctggtggggcaggtgtgccgatttggccattgcctcaacacagctggttccttccactgcctctgccaggatggctttgagctcacagctgatgggaagaactgtgtggacaccaatgagtgcctcagccttgcaggaacctgcctacccggcacttgccagaacctcgagggctccttccgctgcatctgtccccctggcttccaggtgcagagtgaccactgcattgatatcgacgagtgctcagaggagcccaacctctgcctctttggcacctgtaccaacagccctgggagcttccagtgcctctgcccacctggctttgtcctctctgacaatgggcaccgttgctttgacacacggcagagtttctgcttcacccgttttgaggctgggaagtgctcggtgcccaaagctttcaacaccaccaagacccgctgctgctgcagtaagaggcctggggagggctggggagacccctgcgaactgtgtccccaggagggcagcgctgcctttcaggagctctgcccctttggccacggggcagtcccaggcccggatgactcccgagaagacgtgaatgagtgtgcagagaaccctggcgtctgcactaacggcgtctgtgtcaacaccgatggatccttccgctgtgagtgtccctttggctacagcctggacttcactggcatcaactgtgtggacacagacgagtgctctgtcggccacccctgtgggcaagggacatgcaccaatgtcatcggaggcttcgaatgtgcctgtgctgacggctttgagcctggcctcatgatgacctgcgaggacatcgacgaatgctccctgaacccgctgctctgtgccttccgctgccacaataccgagggctcctacctgtgcacctgtccagccggctacaccctgcgggaggatggggccatgtgtcgagatgtggacgagtgtgcagatggtcagcaggactgccacgcccggggcatggagtgcaagaacctcatcggtaccttcgcgtgcgtctgtcccccaggcatgcggcccctgcctggctctggggagggctgcacagatgacaatgaatgccacgctcagcctgacctctgtgtcaacggccgctgtgtcaacaccgcgggcagcttccggtgcgactgtgatgagggattccagcccagccccacccttaccgagtgccacgacatccggcaggggccctgctttgccgaggtgctgcagaccatgtgccggtctctgtccagcagcagtgaggctgtcaccagggccgagtgctgctgtgggggtggccggggctgggggccccgctgcgagctctgtcccctgcccggcacctctgcctacaggaagctgtgcccccatggctcaggctacactgctgagggccgagatgtagatgaatgccgtatgcttgctcacctgtgtgctcatggggagtgcatcaacagccttggctccttccgctgccactgtcaggccgggtacacaccggatgctactgctactacctgcctggatatggatgagtgcagccaggtccccaagccatgtaccttcctctgcaaaaacacgaagggcagtttcctgtgcagctgtccccgaggctacctgctggaggaggatggcaggacctgcaaagacctggacgaatgcacctcccggcagcacaactgtcagttcctctgtgtcaacactgtgggcgccttcacctgccgctgtccgcccggcttcacccagcaccaccaggcctgcttcgacaatgatgagtgctcagcccagcctggcccatgtggtgcccacgggcactgccacaacaccccgggcagcttccgctgtgaatgccaccaaggcttcaccctggtcagctcaggccatggctgtgaagatgtgaatgaatgtgatgggccccaccgctgccagcatggctgtcagaaccagctagggggctaccgctgcagctgcccccagggtttcacccagcactcccagtgggcccagtgtgtggatgagaatgagtgtgccctgtcgccccccacctgcgggagcgcctcctgtcgcaacactcttggtggcttccgctgcgtctgcccctctggctttgactttgatcaggccctcgggggctgccaggaggtggatgagtgcgccggacggcgtggcccctgtagctacagctgtgccaacacgcctggtggcttcctgtgcggctgtcctcaaggctacttccgggctgggcaagggcactgtgtctccggcctgggcttcagccccggaccccaggacaccccggacaaagaggagctgctctcgtctgaagcctgctacgaatgcaagatcaatggcctctcccctcgggaccggccacgacgcagtgcccacagggaccaccaggtgaacctggccacccttgactccgaggccctgctgaccttgggcctgaacctctcacacctgggccgggccgagcgcatcctggagctccggccggccctggagggtctagagggccggatccgctacgtcatcgtccgcggaaacgagcaaggtttctttcgcatgcatcacctccgtggcgtcagctccctgcagctggggcggaggcggccggggcctggaacctaccggctggaggtggtgagccacatggcaggaccctggggtgtccagccagaggggcagccagggccatggggccaggccttgaggctgaaggtgcagctgcagttgctttagttgggaggagcctcagtgggccccagctgtccagagaagggggattctggaactgggaaggactgatccccagaagcgatggctgaccagattgaaccccgaaactcaggaagagtgaaatgctacacgacaacctcaggcaagcccggcctctgcctgggcctctgtgccagccccgggggccccccagttactcagtctttcctggagacagcaagaagctgcaatgtgcaatccccctgcccccacagccaaggtcaggaagaggccctgtggtcaccgtgtctggccaatctcaggctttcacttctgtactgcactgtggcttgccctggcggggggcagggggttggcaggacatggcaatgggcaactggggtgggcacagggcttattcctcggagtagaagggtgtacagggggcccagactccacagtgacttgccacatttgccccccatttggagaatgcttttatatcaaaagtggagacgataataaagttattttgggtta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84467 -> Molecular function: GO:0005201 [extracellular matrix structural constituent] evidence: IEA
            GeneID:84467 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:84467 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.