GGRNA Home | Help | Advanced search

2020-10-26 19:25:57, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_032139               4461 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens ankyrin repeat domain 27 (VPS9 domain) (ANKRD27),
            mRNA.
ACCESSION   NM_032139
VERSION     NM_032139.2  GI:116063533
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4461)
  CONSRTM   GENDEP Investigators; MARS Investigators; STAR*D Investigators
  TITLE     Common genetic variation and antidepressant efficacy in major
            depressive disorder: a meta-analysis of three genome-wide
            pharmacogenetic studies
  JOURNAL   Am J Psychiatry 170 (2), 207-217 (2013)
   PUBMED   23377640
REFERENCE   2  (bases 1 to 4461)
  AUTHORS   Schafer,I.B., Hesketh,G.G., Bright,N.A., Gray,S.R., Pryor,P.R.,
            Evans,P.R., Luzio,J.P. and Owen,D.J.
  TITLE     The binding of Varp to VAMP7 traps VAMP7 in a closed, fusogenically
            inactive conformation
  JOURNAL   Nat. Struct. Mol. Biol. 19 (12), 1300-1309 (2012)
   PUBMED   23104059
  REMARK    GeneRIF: VAMP7-SNARE motif is trapped between Varp and the VAMP7
            longin domain, and hence Varp kinetically inhibits the ability of
            VAMP7 to form SNARE complexes
REFERENCE   3  (bases 1 to 4461)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   4  (bases 1 to 4461)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am. J. Hum. Genet. 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 4461)
  AUTHORS   Burgo,A., Sotirakis,E., Simmler,M.C., Verraes,A., Chamot,C.,
            Simpson,J.C., Lanzetti,L., Proux-Gillardeaux,V. and Galli,T.
  TITLE     Role of Varp, a Rab21 exchange factor and TI-VAMP/VAMP7 partner, in
            neurite growth
  JOURNAL   EMBO Rep. 10 (10), 1117-1124 (2009)
   PUBMED   19745841
  REMARK    GeneRIF: show that TI-VAMP interacts with the Vps9 domain and
            ankyrin-repeat-containing protein Varp, a guanine nucleotide
            exchange factor of the small GTPase Rab21, through a specific
            domain herein called the interacting domain.
REFERENCE   6  (bases 1 to 4461)
  AUTHORS   Wang,F., Zhang,H., Zhang,X., Wang,Y., Ren,F., Zhang,X., Zhai,Y. and
            Chang,Z.
  TITLE     Varp interacts with Rab38 and functions as its potential effector
  JOURNAL   Biochem. Biophys. Res. Commun. 372 (1), 162-167 (2008)
   PUBMED   18477474
  REMARK    GeneRIF: Varp physically interacts with Rab38, and preferentially
            binds to the active GTP-bound form of Rab38 both in vitro and in
            vivo.
REFERENCE   7  (bases 1 to 4461)
  AUTHORS   Zhang,X., He,X., Fu,X.Y. and Chang,Z.
  TITLE     Varp is a Rab21 guanine nucleotide exchange factor and regulates
            endosome dynamics
  JOURNAL   J. Cell. Sci. 119 (PT 6), 1053-1062 (2006)
   PUBMED   16525121
REFERENCE   8  (bases 1 to 4461)
  AUTHORS   Wan,D., Gong,Y., Qin,W., Zhang,P., Li,J., Wei,L., Zhou,X., Li,H.,
            Qiu,X., Zhong,F., He,L., Yu,J., Yao,G., Jiang,H., Qian,L., Yu,Y.,
            Shu,H., Chen,X., Xu,H., Guo,M., Pan,Z., Chen,Y., Ge,C., Yang,S. and
            Gu,J.
  TITLE     Large-scale cDNA transfection screening for genes related to cancer
            development and progression
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (44), 15724-15729 (2004)
   PUBMED   15498874
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2004 Dec 14:101(50):17565]
REFERENCE   9  (bases 1 to 4461)
  AUTHORS   Colland,F., Jacq,X., Trouplin,V., Mougin,C., Groizeleau,C.,
            Hamburger,A., Meil,A., Wojcik,J., Legrain,P. and Gauthier,J.M.
  TITLE     Functional proteomics mapping of a human signaling pathway
  JOURNAL   Genome Res. 14 (7), 1324-1332 (2004)
   PUBMED   15231748
REFERENCE   10 (bases 1 to 4461)
  AUTHORS   Simpson,J.C., Wellenreuther,R., Poustka,A., Pepperkok,R. and
            Wiemann,S.
  TITLE     Systematic subcellular localization of novel proteins identified by
            large-scale cDNA sequencing
  JOURNAL   EMBO Rep. 1 (3), 287-292 (2000)
   PUBMED   11256614
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BI462844.1, AK054561.1 and AA903176.1.
            On Oct 12, 2006 this sequence version replaced gi:14149802.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC045605.1, AK054561.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                BI462844.1         10-20
            12-4446             AK054561.1         1-4435
            4447-4461           AA903176.1         1-15                c
FEATURES             Location/Qualifiers
     source          1..4461
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.11"
     gene            1..4461
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="ankyrin repeat domain 27 (VPS9 domain)"
                     /db_xref="GeneID:84079"
                     /db_xref="HGNC:25310"
     exon            1..126
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    124..126
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="upstream in-frame stop codon"
     exon            127..258
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     CDS             157..3309
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="VPS9-ankyrin-repeat protein; Vps9 domain and
                     ankyrin-repeat-containing protein; VPS9 domain-containing
                     protein"
                     /codon_start=1
                     /product="ankyrin repeat domain-containing protein 27"
                     /protein_id="NP_115515.2"
                     /db_xref="GI:116063534"
                     /db_xref="CCDS:CCDS32986.1"
                     /db_xref="GeneID:84079"
                     /db_xref="HGNC:25310"
                     /translation="
MALYDEDLLKNPFYLALQKCRPDLCSKVAQIHGIVLVPCKGSLSSSIQSTCQFESYILIPVEEHFQTLNGKDVFIQGNRIKLGAGFACLLSVPILFEETFYNEKEESFSILCIAHPLEKRESSEEPLAPSDPFSLKTIEDVREFLGRHSERFDRNIASFHRTFRECERKSLRHHIDSANALYTKCLQQLLRDSHLKMLAKQEAQMNLMKQAVEIYVHHEIYNLIFKYVGTMEASEDAAFNKITRSLQDLQQKDIGVKPEFSFNIPRAKRELAQLNKCTSPQQKLVCLRKVVQLITQSPSQRVNLETMCADDLLSVLLYLLVKTEIPNWMANLSYIKNFRFSSLAKDELGYCLTSFEAAIEYIRQGSLSAKPPESEGFGDRLFLKQRMSLLSQMTSSPTDCLFKHIASGNQKEVERLLSQEDHDKDTVQKMCHPLCFCDDCEKLVSGRLNDPSVVTPFSRDDRGHTPLHVAAVCGQASLIDLLVSKGAMVNATDYHGATPLHLACQKGYQSVTLLLLHYKASAEVQDNNGNTPLHLACTYGHEDCVKALVYYDVESCRLDIGNEKGDTPLHIAARWGYQGVIETLLQNGASTEIQNRLKETPLKCALNSKILSVMEAYHLSFERRQKSSEAPVQSPQRSVDSISQESSTSSFSSMSASSRQEETKKDYREVEKLLRAVADGDLEMVRYLLEWTEEDLEDAEDTVSAADPEFCHPLCQCPKCAPAQKRLAKVPASGLGVNVTSQDGSSPLHVAALHGRADLIPLLLKHGANAGARNADQAVPLHLACQQGHFQVVKCLLDSNAKPNKKDLSGNTPLIYACSGGHHELVALLLQHGASINASNNKGNTALHEAVIEKHVFVVELLLLHGASVQVLNKRQRTAVDCAEQNSKIMELLQVVPSCVASLDDVAETDRKEYVTVKIRKKWNSKLYDLPDEPFTRQFYFVHSAGQFKGKTSREIMARDRSVPNLTEGSLHEPGRQSVTLRQNNLPAQSGSHAAEKGNSDWPERPGLTQTGPGHRRMLRRHTVEDAVVSQGPEAAGPLSTPQEVSASRS
"
     misc_feature    946..1245
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Vacuolar sorting protein 9 (VPS9) domain; Region:
                     VPS9; pfam02204"
                     /db_xref="CDD:145388"
     misc_feature    1342..1434
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 1"
     misc_feature    1528..1911
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1540..1629
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 2"
     misc_feature    1555..1818
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1639..1728
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 3"
     misc_feature    1738..1836
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 4"
     misc_feature    1741..1911
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:205814"
     misc_feature    1846..1935
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 5"
     misc_feature    1849..>1974
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:205814"
     misc_feature    1945..2037
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 6"
     misc_feature    2158..2250
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 7"
     misc_feature    2173..2547
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2368..2745
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2383..2472
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 8"
     misc_feature    2398..2676
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2482..2571
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 9"
     misc_feature    2581..2670
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 10"
     misc_feature    2641..2805
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /note="Ankyrin repeats (many copies); Region: Ank_5;
                     pfam13857"
                     /db_xref="CDD:206028"
     misc_feature    2680..2769
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96NW4.2);
                     Region: ANK 11"
     misc_feature    3223..3225
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q96NW4.2); phosphorylation site"
     exon            259..369
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            370..526
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            527..681
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            682..741
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            742..795
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            796..861
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            862..938
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            939..1060
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1061..1139
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1272
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1273..1365
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1366..1493
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       1434
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34938777"
     exon            1494..1576
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1577..1692
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            1693..1785
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       1716
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35109898"
     exon            1786..1983
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       1917
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2302968"
     exon            1984..2043
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2044..2163
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       2070
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34174163"
     variation       2125
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2287669"
     exon            2164..2208
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2209..2331
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2332..2529
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       2438
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2302970"
     exon            2530..2649
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2650..2811
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2812..2923
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            2924..3002
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            3003..3075
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     exon            3076..4453
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /inference="alignment:Splign:1.39.8"
     variation       3417
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201881809"
     variation       3821..3839
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace=""
                     /replace="tttgcaaagcaacactcga"
                     /db_xref="dbSNP:3217228"
     variation       3994
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2277927"
     STS             4251..4408
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /standard_name="D19S661E"
                     /db_xref="UniSTS:150572"
     variation       4319
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10553"
     variation       4348
                     /gene="ANKRD27"
                     /gene_synonym="PP12899; VARP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3180584"
ORIGIN      
gtaaggggtgggctatagggccagatcgccgcgcgagggtggtgggcatcgaggtcccagcagcggacgagggaggtgccgccgtcgcccaggatgggctgggaatgaagcgatgtagccttttaagagatttgctctgacccatctgaagtccatatggctctgtatgatgaagacctcctgaaaaatcctttctatctggctctgcaaaagtgccgccctgacttgtgcagcaaagtggcccaaatccatggcattgtcttagtaccctgcaaaggaagcctgtcgagcagcatccagtctacttgtcagtttgagtcctacattttgatacctgtggaagagcattttcagaccttaaatggaaaggatgtctttattcaagggaacaggattaaattaggagctggttttgcctgtcttctctcagtgcccattctctttgaagaaactttctacaatgaaaaagaagagagtttcagcatcctgtgtatagcccatcctttggaaaagagagagagttcagaagagcctttggcaccctcagatcccttttccctgaaaaccattgaagatgtgagagagttcttgggaagacactccgagcgatttgacaggaacatcgcctctttccatcgaacattccgagaatgcgagagaaagagcctccgtcaccacatagactcagcgaatgctctctacaccaaatgcctccagcagcttctgagggactctcacctgaaaatgctcgccaagcaggaggcccagatgaacctgatgaagcaggcagtggagatatacgtccatcatgaaatttacaacctgatctttaaatacgtggggaccatggaggcaagtgaggatgcggcctttaacaaaatcacaagaagccttcaagatcttcagcagaaagatattggtgtgaaaccggagttcagctttaacatacctcgtgccaaaagagagctggctcagctgaacaaatgcacctccccacagcagaagcttgtctgcttgcgaaaagtggtgcagctcattacacagtctccaagccagagagtgaacctggagaccatgtgtgctgatgatctgctatcagtcctgttatacttgcttgtgaaaacggagatccctaattggatggcaaatttgagttacatcaaaaacttcaggtttagcagcttggcaaaggatgaactgggatactgcctgacctcattcgaagctgccattgaatatattcggcaaggaagcctctctgctaaaccccctgagtctgagggatttggagacaggctgttccttaagcagagaatgagcttactctctcagatgacttcgtctcccaccgactgcctgtttaagcacattgcatcaggtaaccagaaagaagtggagagacttctgagccaagaggaccatgataaagataccgtccaaaagatgtgtcaccctctctgcttctgcgatgactgtgagaaactcgtctctgggaggttgaatgatccctcagttgtcactccattctccagagacgacagggggcacacccctctccatgtggctgctgtctgtgggcaggcatccctcatcgacctcctggtttccaagggcgccatggtaaatgccacagactaccatggagccactccgctccacctggcctgtcagaagggctaccagagcgtgacgctgctgctgctgcactacaaggccagcgcggaagtgcaggacaacaatgggaatacgccactccacctggcctgcacctacggccacgaggactgtgtgaaggctctggtttactacgacgtggagtcgtgcagacttgacattggcaatgagaaaggagacacccctctacacattgctgcccgctggggctaccaaggcgtcatagagacattgctgcagaacggagcgtccaccgagatccagaacagactgaaggagacgcccctcaagtgtgcattaaactcaaagattctgtctgtaatggaagcctatcacctgtccttcgagaggaggcagaagtcgtccgaggcccctgtgcagtccccgcagcgctccgtggactccatcagccaagagtcctccacttccagcttctcctccatgtcagccagctcaaggcaggaggagaccaagaaggactacagagaggtagaaaaacttttgagagcagttgctgatggagatctagaaatggtgcgttacctgttggaatggacagaggaggacctggaggatgcggaggacactgtcagtgcagcggaccccgaattctgtcacccgttgtgccagtgccccaagtgtgccccagctcagaagaggctggcgaaggttcctgccagtgggcttggtgtgaacgtgaccagccaggacggctcctccccgctgcatgtcgccgccctgcacggccgggcggacctcatccccctcctgctgaagcacggggccaacgcaggtgccaggaacgcagaccaagccgtcccgctccacctggcctgccagcagggccactttcaggtggtgaagtgtctgttagattcgaatgcaaaacccaataagaaggacctcagtggaaacacgcccctcatttacgcctgctccggtggccatcacgagcttgtggcactgctgctacagcacggggcctccattaacgcttctaacaataagggcaacacagcgctgcacgaggctgtgattgaaaagcacgtcttcgtggtagagctgcttctgctccacggagcgtcagttcaggtgctgaacaagcggcagcgcacggctgtagactgtgctgaacagaattcaaaaataatggaattgcttcaggtggtaccaagctgtgttgcttcattagatgatgtggctgaaactgaccgcaaggagtatgtcactgttaagatcaggaaaaaatggaactcaaaactgtatgatctaccagatgagccttttacaagacagttttactttgtccactcagctggtcagtttaagggaaagacttcaagggagattatggcaagagatagaagtgtccctaatttaaccgaaggttctttgcatgagccagggaggcaaagtgtcacactgagacagaataacctgccagctcagagtggatctcatgctgctgagaaaggcaacagcgactggccagagaggcctggactgacacagactggccctggacacagacggatgctgcggagacacacggtagaggatgcggtcgtgtcccagggcccggaggctgctggccccctctccactccccaagaggttagtgcttcccggtcctaacaggaatgaggagttgttgaacccactgctaggaagcaaggatgcaacaagatgatgctgagcgtgaacacatctgagaactaaatgtgcttccatgagactggcttgagaagtcttcagcaccaagttcctgaaagcttttctgtggcaggaaagaatgcaacaaaaaagttaaccaccaccatctctctcctcttcaaagctaatgaatacaattgaaacagacaaaaattccagtagcatccagatccttaagccagaggtgcatgcttctttttaagtatgagggtttgttggtcacagtgggagaggtttcaccaccgcattctgacctcctcctcccaaaaggtgctaaacctctctgacctgtgtacattcacaaaccacagctagaattcctccacctaggattaagctggagagaagtaagtaatttaggtttcatggtactgtagaggccaggctgaaatgtcatatctgaaggaagaaagcagcagctggacaatgtttctttgcaaagcaacactcgaaccaaaagatgcctcaatcccattttgatattcattttagtgaaaggatgcatcagacctgttccacatcatgcacatgggaaagggtggttatcattttccttctaacaagtaggtacagatattcggttactacacgtgcacctgtagcagtatttctagaaacatccctttttgttgagaacctcccttgaatgtctgtcacactcacacctgacgggatggttactggattagagagtagatttggcacatcttttcttagtcttttgattcaaattcaaaacttaacagcacaaaccaggtcagagttactttcggttagaatttattgccatttattcctttttataaatttctatagattatactgttatttttatgttattggcctagagctacacgtatatgggtttgtcctgagtccgttttcaaatgaccttgtgatagggaaatggttttgtccatgttcttggaaatacttgtgtatgtacagaaggaagggagggattatttttctacaaagtaatttatgatttctaattttctaatgtgccttggatatgtgccaaatgatggaaaagaaacagtaaactttatgattcttgactgtgaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84079 -> Molecular function: GO:0005085 [guanyl-nucleotide exchange factor activity] evidence: IDA
            GeneID:84079 -> Molecular function: GO:0005096 [GTPase activator activity] evidence: IEA
            GeneID:84079 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:84079 -> Biological process: GO:0045022 [early endosome to late endosome transport] evidence: IDA
            GeneID:84079 -> Cellular component: GO:0005764 [lysosome] evidence: IDA
            GeneID:84079 -> Cellular component: GO:0005769 [early endosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.