GGRNA Home | Help | Advanced search

2024-04-27 04:11:34, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_031882               2796 bp    mRNA    linear   PRI 18-JUL-2013
DEFINITION  Homo sapiens protocadherin alpha subfamily C, 1 (PCDHAC1),
            transcript variant 2, mRNA.
ACCESSION   NM_031882
VERSION     NM_031882.3  GI:525313611
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2796)
  AUTHORS   Fox CS, Liu Y, White CC, Feitosa M, Smith AV, Heard-Costa N, Lohman
            K, Johnson AD, Foster MC, Greenawalt DM, Griffin P, Ding J, Newman
            AB, Tylavsky F, Miljkovic I, Kritchevsky SB, Launer L, Garcia M,
            Eiriksdottir G, Carr JJ, Gudnason V, Harris TB, Cupples LA and
            Borecki IB.
  CONSRTM   GIANT Consortium; MAGIC Consortium; GLGC Consortium
  TITLE     Genome-wide association for abdominal subcutaneous and visceral
            adipose reveals a novel locus for visceral fat in women
  JOURNAL   PLoS Genet. 8 (5), E1002695 (2012)
   PUBMED   22589738
REFERENCE   2  (bases 1 to 2796)
  AUTHORS   Wu Q, Zhang T, Cheng JF, Kim Y, Grimwood J, Schmutz J, Dickson M,
            Noonan JP, Zhang MQ, Myers RM and Maniatis T.
  TITLE     Comparative DNA sequence analysis of mouse and human protocadherin
            gene clusters
  JOURNAL   Genome Res. 11 (3), 389-404 (2001)
   PUBMED   11230163
REFERENCE   3  (bases 1 to 2796)
  AUTHORS   Nollet F, Kools P and van Roy F.
  TITLE     Phylogenetic analysis of the cadherin superfamily allows
            identification of six major subfamilies besides several solitary
            members
  JOURNAL   J. Mol. Biol. 299 (3), 551-572 (2000)
   PUBMED   10835267
  REMARK    Review article
REFERENCE   4  (bases 1 to 2796)
  AUTHORS   Yagi T and Takeichi M.
  TITLE     Cadherin superfamily genes: functions, genomic organization, and
            neurologic diversity
  JOURNAL   Genes Dev. 14 (10), 1169-1180 (2000)
   PUBMED   10817752
  REMARK    Review article
REFERENCE   5  (bases 1 to 2796)
  AUTHORS   Wu Q and Maniatis T.
  TITLE     Large exons encoding multiple ectodomains are a characteristic
            feature of protocadherin genes
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3124-3129 (2000)
   PUBMED   10716726
REFERENCE   6  (bases 1 to 2796)
  AUTHORS   Sugino H, Hamada S, Yasuda R, Tuji A, Matsuda Y, Fujita M and Yagi
            T.
  TITLE     Genomic organization of the family of CNR cadherin genes in mice
            and humans
  JOURNAL   Genomics 63 (1), 75-87 (2000)
   PUBMED   10662547
REFERENCE   7  (bases 1 to 2796)
  AUTHORS   Wu Q and Maniatis T.
  TITLE     A striking organization of a large family of human neural
            cadherin-like cell adhesion genes
  JOURNAL   Cell 97 (6), 779-790 (1999)
   PUBMED   10380929
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AA601497.1, HY126945.1,
            BC136785.1 and AC010223.6.
            On Jul 18, 2013 this sequence version replaced gi:14717402.
            
            Summary: This gene is a member of the protocadherin alpha gene
            cluster, one of three related gene clusters tandemly linked on
            chromosome five that demonstrate an unusual genomic organization
            similar to that of B-cell and T-cell receptor gene clusters. The
            alpha gene cluster is composed of 15 cadherin superfamily genes
            related to the mouse CNR genes and consists of 13 highly similar
            and 2 more distantly related coding sequences. The tandem array of
            15 N-terminal exons, or variable exons, are followed by downstream
            C-terminal exons, or constant exons, which are shared by all genes
            in the cluster. The large, uninterrupted N-terminal exons each
            encode six cadherin ectodomains while the C-terminal exons encode
            the cytoplasmic domain. These neural cadherin-like cell adhesion
            proteins are integral plasma membrane proteins that most likely
            play a critical role in the establishment and function of specific
            cell-cell connections in the brain. Alternative splicing has been
            observed and additional variants have been suggested but their
            full-length nature has yet to be determined. [provided by RefSeq,
            Jul 2008].
            
            Transcript Variant: This variant (2) utilizes the large, first exon
            then continues into the downstream intron 1 sequence before
            terminating. This one-exon transcript encodes a shorter isoform
            (2), compared to isoform 1. This short variant is represented based
            on data in PMID:10380929.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-52                AA601497.1         421-472             c
            53-155              HY126945.1         1-103
            156-982             BC136785.1         1-827
            983-983             AC010223.6         134914-134914       c
            984-1444            BC136785.1         829-1289
            1445-1445           AC010223.6         134452-134452       c
            1446-1667           BC136785.1         1291-1512
            1668-1668           AC010223.6         134229-134229       c
            1669-2714           BC136785.1         1514-2559
            2715-2715           AC010223.6         133182-133182       c
            2716-2796           BC136785.1         2561-2641
FEATURES             Location/Qualifiers
     source          1..2796
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q31"
     gene            1..2796
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="protocadherin alpha subfamily C, 1"
                     /db_xref="GeneID:56135"
                     /db_xref="HGNC:8676"
                     /db_xref="MIM:606320"
     misc_feature    141..143
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="upstream in-frame stop codon"
     CDS             177..2633
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; protocadherin alpha-C1"
                     /codon_start=1
                     /product="protocadherin alpha-C1 isoform 2 precursor"
                     /protein_id="NP_114088.2"
                     /db_xref="GI:14717403"
                     /db_xref="GeneID:56135"
                     /db_xref="HGNC:8676"
                     /db_xref="MIM:606320"
                     /translation="
MVGCGVAVLCLWVSCGAAAGQLEYSVPEETERGVAVGNLSADLRLPAAAMSSRNFRFLSSHRELYFGVDLPSGNLVVREPADREQLCRAKAACVLTYDLVLEDPLELHKIRIHVLDTNDNSPLFPAGDVQLHIPEFLTPGARFTLPNAQDDDEGSNGILSYSLSPSQHFRLDMGSRVDGSEYPELVLEKALDREQRATHLLVLTARDGGLPARSGDAQVTIIVVDTNDNAPVFERSVYRTKVPETAPNGTVLFRVQALDPDEGSNGEVQYSLSNSTQAELRHRFHVHPKSGEVQVAASLGPPETLLEAYIEARDEGVFGLASTAKLLVEVTDVNDHAPELDFLTLSNPVPEDAAPGTVIALFSVKDEDLDSNGRVICGMSSAGPFQLTASFDNYYSLLIDGPLDREQISEYQVLITASDSGSPPLSTRRTITVSVADVNDNTPNFPQPQQELFVAENNGPGASLGRVFAQDPDLGKNGLVSYELLDVISEGPSASSLLAVESSSGAITAKTSFDFEQLRGFHFQVEGRDGGIPPRSATVTINLFVVDRNDNYPVILFPLPRNGSVPVEIVPRSARTGHLVTKVVAEDADSGSNAWLSYHISRASDSSLFRISANIGELRTARLVLPTDAVKQRVVVVVRDHGDPPLSSSVTLGVLLSNSVPQLLPDFEDVWEPGGQLSAQNLYLVIALACISFLFLGCLLFFVCTKLHQSPGCCAQSCCRSTEDLRYGSKMVSNPCMTSATIDVTTVERLSQTYLYRASLGLGSDNNSLLLRGEYNAADLRNLATGVGLNLPISCIQIRNRKGDHANVNAMVSKFYGI
"
     sig_peptide     177..233
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     234..2630
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /product="protocadherin alpha-C1 isoform 2"
     misc_feature    243..536
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    order(258..263,420..422,426..428,522..524,528..533)
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:206637"
     misc_feature    564..863
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    order(579..584,750..752,756..758,849..851,855..860)
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:206637"
     misc_feature    885..1184
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    order(906..911,1074..1076,1080..1082,1170..1172,
                     1176..1181)
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:206637"
     misc_feature    1221..1499
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    order(1227..1232,1386..1388,1392..1394,1485..1487,
                     1491..1496)
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:206637"
     misc_feature    1521..1829
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    order(1542..1547,1716..1718,1722..1724,1815..1817,
                     1821..1826)
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:206637"
     misc_feature    1884..>2042
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /note="Cadherin tandem repeat domain; Region:
                     Cadherin_repeat; cd11304"
                     /db_xref="CDD:206637"
     misc_feature    2226..2288
                     /gene="PCDHAC1"
                     /gene_synonym="PCDH-ALPHA-C1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9H158.2);
                     transmembrane region"
ORIGIN      
caatgccggcgttcgggaggcgcaacgtcggcggtcgctgagtatccagcccgcagcagtgacggccggcaggagcgtgctcttccccgcggctcgtgctctccaggagtccggagcatggtcctgggtcaccgttggtgtagcgtgttggtggaacgtggacgcctagagggaggatggtgggctgtggggtggcagttttatgtttgtgggtttcctgcggcgctgcagcgggacagctcgagtactcagtgccggaggagacggagcggggcgtagccgtaggcaatctctccgcggacttgaggctgccagcggccgctatgtcctcgcggaactttcgcttcctttccagccaccgcgagctctacttcggggtggatctacccagcggcaatttggtggtcagagagccggcggaccgcgaacagctgtgcagggccaaagctgcctgcgtcttgacctacgacctggtgctcgaggacccgctggagctgcacaagattcggattcacgtcctggacaccaatgacaactcacctctctttcctgccggcgacgtgcagctgcacatccccgagttcctgacgcccggagcccgctttactctcccgaatgcccaagatgacgacgagggaagcaatgggatactaagctacagcctaagccccagtcagcactttcgcctggacatgggatcgcgggttgacggcagcgaatacccggagttggtgttggagaaagcactggatcgcgaacagcgcgccacccacctgctggtgcttacagctcgggacggcgggctacctgcccgctcaggagacgcacaagtcaccatcattgtggtggacacaaatgacaacgcgcctgtatttgagcgctccgtataccgcaccaaggttccagagactgcacccaatgggactgtgttattccgagttcaagccttggatccagatgaagggtccaatggggaagtccagtactccctaagcaacagcacgcaagcagagctgcgacaccgctttcacgtgcaccctaaaagtggggaggtgcaagtagctgcttcactaggtccgcctgaaacgctcttggaggcatacattgaggcgagggacgaaggtgtctttggtttagctagcaccgctaaactgctggtggaggtgactgacgtgaacgatcatgcccccgaactggacttcctgactctttcgaacccagtacctgaggacgctgcccctggcacagtgattgctctctttagtgtaaaggatgaagacctcgattctaatggtagggtcatttgtggcatgtctagtgcaggcccttttcagctgacggcttcctttgacaactactacagcctgctgattgatgggcccctggaccgggagcagatcagtgaataccaagtcctgatcacggcctcagatagtggctcacccccacttagcacccgaaggacaatcactgtgtcagttgctgatgtgaatgacaatacaccaaactttcctcaaccccagcaggaacttttcgttgctgaaaacaatggccctggggcctctctaggccgagtgtttgcccaggaccccgacctggggaagaatggccttgtctcttatgagctgttggatgttatctctgaagggccatcagcctctagcttgctggcagtggaatcatccagtggggccatcactgccaaaacttcctttgactttgagcagctcagggggtttcatttccaagtagaaggccgggatggtggcattcctcccagaagtgcaacagtgactataaacttgtttgtggtagataggaatgacaattatccggttatcttgtttcccttgcccagaaatggttctgtcccagtggaaattgtgccccgctctgccaggactggacacttggtcacaaaagtggtagcagaggatgctgacagtggttctaatgcctggctttcctaccacatctcccgggcgtctgactctagtctctttagaatttcagccaatataggtgagctccgtactgctcgcttagttcttcccactgatgcagttaagcagagggtggtggtagtggttcgggaccatggagacccaccactttcctcctctgtcactctgggtgtgctgttgagcaactctgtccctcagttacttccagactttgaagatgtctgggaaccaggagggcagctttctgcccagaacttgtatttagtaattgccttggcttgtatttcctttttatttctggggtgcttacttttcttcgtgtgtaccaagttgcaccagagcccaggctgttgcgctcagagctgctgtcgctctacagaggatctgaggtatggaagtaagatggtttcaaatccttgcatgacatcagccaccatagatgtcactacagttgagagactttctcagacttatctctatcgggcctctctgggacttggttctgataataacagtttgctgttgcgtggggagtacaatgctgccgacctgcgaaatcttgccactggggtaggactgaatttgccaatatcctgtattcagattcggaataggaaaggggatcacgctaatgtcaatgccatggtaagcaaattttatggaatttgattcctttggcccggagatggctgctagctgtgttttgaaatatttcttagacaagcctttcacaacatttcatcaattgaactaaacactccttcttagcacttcctgtgccaagaaatctggaagtatagaagtattagaagattgccctaggcctcaaggg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:56135 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:56135 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
            GeneID:56135 -> Biological process: GO:0007156 [homophilic cell adhesion] evidence: IEA
            GeneID:56135 -> Biological process: GO:0007399 [nervous system development] evidence: TAS
            GeneID:56135 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.