Home |
Help |
Advanced search
2024-04-24 22:37:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_031882 2796 bp mRNA linear PRI 18-JUL-2013
DEFINITION Homo sapiens protocadherin alpha subfamily C, 1 (PCDHAC1),
transcript variant 2, mRNA.
ACCESSION NM_031882
VERSION NM_031882.3 GI:525313611
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2796)
AUTHORS Fox CS, Liu Y, White CC, Feitosa M, Smith AV, Heard-Costa N, Lohman
K, Johnson AD, Foster MC, Greenawalt DM, Griffin P, Ding J, Newman
AB, Tylavsky F, Miljkovic I, Kritchevsky SB, Launer L, Garcia M,
Eiriksdottir G, Carr JJ, Gudnason V, Harris TB, Cupples LA and
Borecki IB.
CONSRTM GIANT Consortium; MAGIC Consortium; GLGC Consortium
TITLE Genome-wide association for abdominal subcutaneous and visceral
adipose reveals a novel locus for visceral fat in women
JOURNAL PLoS Genet. 8 (5), E1002695 (2012)
PUBMED 22589738
REFERENCE 2 (bases 1 to 2796)
AUTHORS Wu Q, Zhang T, Cheng JF, Kim Y, Grimwood J, Schmutz J, Dickson M,
Noonan JP, Zhang MQ, Myers RM and Maniatis T.
TITLE Comparative DNA sequence analysis of mouse and human protocadherin
gene clusters
JOURNAL Genome Res. 11 (3), 389-404 (2001)
PUBMED 11230163
REFERENCE 3 (bases 1 to 2796)
AUTHORS Nollet F, Kools P and van Roy F.
TITLE Phylogenetic analysis of the cadherin superfamily allows
identification of six major subfamilies besides several solitary
members
JOURNAL J. Mol. Biol. 299 (3), 551-572 (2000)
PUBMED 10835267
REMARK Review article
REFERENCE 4 (bases 1 to 2796)
AUTHORS Yagi T and Takeichi M.
TITLE Cadherin superfamily genes: functions, genomic organization, and
neurologic diversity
JOURNAL Genes Dev. 14 (10), 1169-1180 (2000)
PUBMED 10817752
REMARK Review article
REFERENCE 5 (bases 1 to 2796)
AUTHORS Wu Q and Maniatis T.
TITLE Large exons encoding multiple ectodomains are a characteristic
feature of protocadherin genes
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3124-3129 (2000)
PUBMED 10716726
REFERENCE 6 (bases 1 to 2796)
AUTHORS Sugino H, Hamada S, Yasuda R, Tuji A, Matsuda Y, Fujita M and Yagi
T.
TITLE Genomic organization of the family of CNR cadherin genes in mice
and humans
JOURNAL Genomics 63 (1), 75-87 (2000)
PUBMED 10662547
REFERENCE 7 (bases 1 to 2796)
AUTHORS Wu Q and Maniatis T.
TITLE A striking organization of a large family of human neural
cadherin-like cell adhesion genes
JOURNAL Cell 97 (6), 779-790 (1999)
PUBMED 10380929
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AA601497.1, HY126945.1,
BC136785.1 and AC010223.6.
On Jul 18, 2013 this sequence version replaced gi:14717402.
Summary: This gene is a member of the protocadherin alpha gene
cluster, one of three related gene clusters tandemly linked on
chromosome five that demonstrate an unusual genomic organization
similar to that of B-cell and T-cell receptor gene clusters. The
alpha gene cluster is composed of 15 cadherin superfamily genes
related to the mouse CNR genes and consists of 13 highly similar
and 2 more distantly related coding sequences. The tandem array of
15 N-terminal exons, or variable exons, are followed by downstream
C-terminal exons, or constant exons, which are shared by all genes
in the cluster. The large, uninterrupted N-terminal exons each
encode six cadherin ectodomains while the C-terminal exons encode
the cytoplasmic domain. These neural cadherin-like cell adhesion
proteins are integral plasma membrane proteins that most likely
play a critical role in the establishment and function of specific
cell-cell connections in the brain. Alternative splicing has been
observed and additional variants have been suggested but their
full-length nature has yet to be determined. [provided by RefSeq,
Jul 2008].
Transcript Variant: This variant (2) utilizes the large, first exon
then continues into the downstream intron 1 sequence before
terminating. This one-exon transcript encodes a shorter isoform
(2), compared to isoform 1. This short variant is represented based
on data in PMID:10380929.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-52 AA601497.1 421-472 c
53-155 HY126945.1 1-103
156-982 BC136785.1 1-827
983-983 AC010223.6 134914-134914 c
984-1444 BC136785.1 829-1289
1445-1445 AC010223.6 134452-134452 c
1446-1667 BC136785.1 1291-1512
1668-1668 AC010223.6 134229-134229 c
1669-2714 BC136785.1 1514-2559
2715-2715 AC010223.6 133182-133182 c
2716-2796 BC136785.1 2561-2641
FEATURES Location/Qualifiers
source 1..2796
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q31"
gene 1..2796
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="protocadherin alpha subfamily C, 1"
/db_xref="GeneID:56135"
/db_xref="HGNC:8676"
/db_xref="MIM:606320"
misc_feature 141..143
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="upstream in-frame stop codon"
CDS 177..2633
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="isoform 2 precursor is encoded by transcript
variant 2; protocadherin alpha-C1"
/codon_start=1
/product="protocadherin alpha-C1 isoform 2 precursor"
/protein_id="NP_114088.2"
/db_xref="GI:14717403"
/db_xref="GeneID:56135"
/db_xref="HGNC:8676"
/db_xref="MIM:606320"
/translation="
MVGCGVAVLCLWVSCGAAAGQLEYSVPEETERGVAVGNLSADLRLPAAAMSSRNFRFLSSHRELYFGVDLPSGNLVVREPADREQLCRAKAACVLTYDLVLEDPLELHKIRIHVLDTNDNSPLFPAGDVQLHIPEFLTPGARFTLPNAQDDDEGSNGILSYSLSPSQHFRLDMGSRVDGSEYPELVLEKALDREQRATHLLVLTARDGGLPARSGDAQVTIIVVDTNDNAPVFERSVYRTKVPETAPNGTVLFRVQALDPDEGSNGEVQYSLSNSTQAELRHRFHVHPKSGEVQVAASLGPPETLLEAYIEARDEGVFGLASTAKLLVEVTDVNDHAPELDFLTLSNPVPEDAAPGTVIALFSVKDEDLDSNGRVICGMSSAGPFQLTASFDNYYSLLIDGPLDREQISEYQVLITASDSGSPPLSTRRTITVSVADVNDNTPNFPQPQQELFVAENNGPGASLGRVFAQDPDLGKNGLVSYELLDVISEGPSASSLLAVESSSGAITAKTSFDFEQLRGFHFQVEGRDGGIPPRSATVTINLFVVDRNDNYPVILFPLPRNGSVPVEIVPRSARTGHLVTKVVAEDADSGSNAWLSYHISRASDSSLFRISANIGELRTARLVLPTDAVKQRVVVVVRDHGDPPLSSSVTLGVLLSNSVPQLLPDFEDVWEPGGQLSAQNLYLVIALACISFLFLGCLLFFVCTKLHQSPGCCAQSCCRSTEDLRYGSKMVSNPCMTSATIDVTTVERLSQTYLYRASLGLGSDNNSLLLRGEYNAADLRNLATGVGLNLPISCIQIRNRKGDHANVNAMVSKFYGI
"
sig_peptide 177..233
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 234..2630
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/product="protocadherin alpha-C1 isoform 2"
misc_feature 243..536
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature order(258..263,420..422,426..428,522..524,528..533)
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:206637"
misc_feature 564..863
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature order(579..584,750..752,756..758,849..851,855..860)
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:206637"
misc_feature 885..1184
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature order(906..911,1074..1076,1080..1082,1170..1172,
1176..1181)
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:206637"
misc_feature 1221..1499
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature order(1227..1232,1386..1388,1392..1394,1485..1487,
1491..1496)
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:206637"
misc_feature 1521..1829
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature order(1542..1547,1716..1718,1722..1724,1815..1817,
1821..1826)
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:206637"
misc_feature 1884..>2042
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/note="Cadherin tandem repeat domain; Region:
Cadherin_repeat; cd11304"
/db_xref="CDD:206637"
misc_feature 2226..2288
/gene="PCDHAC1"
/gene_synonym="PCDH-ALPHA-C1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9H158.2);
transmembrane region"
ORIGIN
caatgccggcgttcgggaggcgcaacgtcggcggtcgctgagtatccagcccgcagcagtgacggccggcaggagcgtgctcttccccgcggctcgtgctctccaggagtccggagcatggtcctgggtcaccgttggtgtagcgtgttggtggaacgtggacgcctagagggaggatggtgggctgtggggtggcagttttatgtttgtgggtttcctgcggcgctgcagcgggacagctcgagtactcagtgccggaggagacggagcggggcgtagccgtaggcaatctctccgcggacttgaggctgccagcggccgctatgtcctcgcggaactttcgcttcctttccagccaccgcgagctctacttcggggtggatctacccagcggcaatttggtggtcagagagccggcggaccgcgaacagctgtgcagggccaaagctgcctgcgtcttgacctacgacctggtgctcgaggacccgctggagctgcacaagattcggattcacgtcctggacaccaatgacaactcacctctctttcctgccggcgacgtgcagctgcacatccccgagttcctgacgcccggagcccgctttactctcccgaatgcccaagatgacgacgagggaagcaatgggatactaagctacagcctaagccccagtcagcactttcgcctggacatgggatcgcgggttgacggcagcgaatacccggagttggtgttggagaaagcactggatcgcgaacagcgcgccacccacctgctggtgcttacagctcgggacggcgggctacctgcccgctcaggagacgcacaagtcaccatcattgtggtggacacaaatgacaacgcgcctgtatttgagcgctccgtataccgcaccaaggttccagagactgcacccaatgggactgtgttattccgagttcaagccttggatccagatgaagggtccaatggggaagtccagtactccctaagcaacagcacgcaagcagagctgcgacaccgctttcacgtgcaccctaaaagtggggaggtgcaagtagctgcttcactaggtccgcctgaaacgctcttggaggcatacattgaggcgagggacgaaggtgtctttggtttagctagcaccgctaaactgctggtggaggtgactgacgtgaacgatcatgcccccgaactggacttcctgactctttcgaacccagtacctgaggacgctgcccctggcacagtgattgctctctttagtgtaaaggatgaagacctcgattctaatggtagggtcatttgtggcatgtctagtgcaggcccttttcagctgacggcttcctttgacaactactacagcctgctgattgatgggcccctggaccgggagcagatcagtgaataccaagtcctgatcacggcctcagatagtggctcacccccacttagcacccgaaggacaatcactgtgtcagttgctgatgtgaatgacaatacaccaaactttcctcaaccccagcaggaacttttcgttgctgaaaacaatggccctggggcctctctaggccgagtgtttgcccaggaccccgacctggggaagaatggccttgtctcttatgagctgttggatgttatctctgaagggccatcagcctctagcttgctggcagtggaatcatccagtggggccatcactgccaaaacttcctttgactttgagcagctcagggggtttcatttccaagtagaaggccgggatggtggcattcctcccagaagtgcaacagtgactataaacttgtttgtggtagataggaatgacaattatccggttatcttgtttcccttgcccagaaatggttctgtcccagtggaaattgtgccccgctctgccaggactggacacttggtcacaaaagtggtagcagaggatgctgacagtggttctaatgcctggctttcctaccacatctcccgggcgtctgactctagtctctttagaatttcagccaatataggtgagctccgtactgctcgcttagttcttcccactgatgcagttaagcagagggtggtggtagtggttcgggaccatggagacccaccactttcctcctctgtcactctgggtgtgctgttgagcaactctgtccctcagttacttccagactttgaagatgtctgggaaccaggagggcagctttctgcccagaacttgtatttagtaattgccttggcttgtatttcctttttatttctggggtgcttacttttcttcgtgtgtaccaagttgcaccagagcccaggctgttgcgctcagagctgctgtcgctctacagaggatctgaggtatggaagtaagatggtttcaaatccttgcatgacatcagccaccatagatgtcactacagttgagagactttctcagacttatctctatcgggcctctctgggacttggttctgataataacagtttgctgttgcgtggggagtacaatgctgccgacctgcgaaatcttgccactggggtaggactgaatttgccaatatcctgtattcagattcggaataggaaaggggatcacgctaatgtcaatgccatggtaagcaaattttatggaatttgattcctttggcccggagatggctgctagctgtgttttgaaatatttcttagacaagcctttcacaacatttcatcaattgaactaaacactccttcttagcacttcctgtgccaagaaatctggaagtatagaagtattagaagattgccctaggcctcaaggg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:56135 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:56135 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
GeneID:56135 -> Biological process: GO:0007156 [homophilic cell adhesion] evidence: IEA
GeneID:56135 -> Biological process: GO:0007399 [nervous system development] evidence: TAS
GeneID:56135 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.