2024-04-25 00:02:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_030877 1897 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens catenin, beta like 1 (CTNNBL1), mRNA. ACCESSION NM_030877 VERSION NM_030877.3 GI:29570786 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1897) AUTHORS Song,Y., Yang,Q.X., Zhang,F., Meng,F., Li,H., Dong,Y. and Han,A. TITLE Suppression of nasopharyngeal carcinoma cell by targeting beta-catenin signaling pathway JOURNAL Cancer Epidemiol 36 (2), E116-E121 (2012) PUBMED 22142772 REMARK GeneRIF: beta-catenin expression was upregulated in fresh nasopharyngeal carcinoma tissue REFERENCE 2 (bases 1 to 1897) AUTHORS Park,M.H., Kim,D.J., You,S.T., Lee,C.S., Kim,H.K., Park,S.M., Shin,E.Y. and Kim,E.G. TITLE Phosphorylation of beta-catenin at serine 663 regulates its transcriptional activity JOURNAL Biochem. Biophys. Res. Commun. 419 (3), 543-549 (2012) PUBMED 22369945 REMARK GeneRIF: these results provide evidence that PAK1 specifically phosphorylates beta-catenin at S663 and that this phosphorylation is essential for the PAK1-mediated transcriptional activation of beta-catenin. REFERENCE 3 (bases 1 to 1897) AUTHORS Wan,X., Liu,J., Lu,J.F., Tzelepi,V., Yang,J., Starbuck,M.W., Diao,L., Wang,J., Efstathiou,E., Vazquez,E.S., Troncoso,P., Maity,S.N. and Navone,N.M. TITLE Activation of beta-catenin signaling in androgen receptor-negative prostate cancer cells JOURNAL Clin. Cancer Res. 18 (3), 726-736 (2012) PUBMED 22298898 REMARK GeneRIF: We identified a previously unknown downstream target of beta-catenin, HAS2, in prostate cancer REFERENCE 4 (bases 1 to 1897) AUTHORS Narasipura,S.D., Henderson,L.J., Fu,S.W., Chen,L., Kashanchi,F. and Al-Harthi,L. TITLE Role of beta-catenin and TCF/LEF family members in transcriptional activity of HIV in astrocytes JOURNAL J. Virol. 86 (4), 1911-1921 (2012) PUBMED 22156527 REMARK GeneRIF: Knockdown of either beta-catenin or TCF-4 induced LTR activity in astrocytes. REFERENCE 5 (bases 1 to 1897) AUTHORS Anani,W., Bruggeman,R. and Zander,D.S. TITLE beta-catenin expression in benign and malignant pleural disorders JOURNAL Int J Clin Exp Pathol 4 (8), 742-747 (2011) PUBMED 22135721 REMARK GeneRIF: IHC for beta-catenin does not appear to be conclusive for separating benign from malignant mesothelial proliferations REFERENCE 6 (bases 1 to 1897) AUTHORS Andersen,J.S., Lam,Y.W., Leung,A.K., Ong,S.E., Lyon,C.E., Lamond,A.I. and Mann,M. TITLE Nucleolar proteome dynamics JOURNAL Nature 433 (7021), 77-83 (2005) PUBMED 15635413 REFERENCE 7 (bases 1 to 1897) AUTHORS Wan,D., Gong,Y., Qin,W., Zhang,P., Li,J., Wei,L., Zhou,X., Li,H., Qiu,X., Zhong,F., He,L., Yu,J., Yao,G., Jiang,H., Qian,L., Yu,Y., Shu,H., Chen,X., Xu,H., Guo,M., Pan,Z., Chen,Y., Ge,C., Yang,S. and Gu,J. TITLE Large-scale cDNA transfection screening for genes related to cancer development and progression JOURNAL Proc. Natl. Acad. Sci. U.S.A. 101 (44), 15724-15729 (2004) PUBMED 15498874 REMARK Erratum:[Proc Natl Acad Sci U S A. 2004 Dec 14:101(50):17565] REFERENCE 8 (bases 1 to 1897) AUTHORS Makarova,O.V., Makarov,E.M., Urlaub,H., Will,C.L., Gentzel,M., Wilm,M. and Luhrmann,R. TITLE A subset of human 35S U5 proteins, including Prp19, function prior to catalytic step 1 of splicing JOURNAL EMBO J. 23 (12), 2381-2391 (2004) PUBMED 15175653 REFERENCE 9 (bases 1 to 1897) AUTHORS Jabbour,L., Welter,J.F., Kollar,J. and Hering,T.M. TITLE Sequence, gene structure, and expression pattern of CTNNBL1, a minor-class intron-containing gene--evidence for a role in apoptosis JOURNAL Genomics 81 (3), 292-303 (2003) PUBMED 12659813 REFERENCE 10 (bases 1 to 1897) AUTHORS Deloukas,P., Matthews,L.H., Ashurst,J., Burton,J., Gilbert,J.G., Jones,M., Stavrides,G., Almeida,J.P., Babbage,A.K., Bagguley,C.L., Bailey,J., Barlow,K.F., Bates,K.N., Beard,L.M., Beare,D.M., Beasley,O.P., Bird,C.P., Blakey,S.E., Bridgeman,A.M., Brown,A.J., Buck,D., Burrill,W., Butler,A.P., Carder,C., Carter,N.P., Chapman,J.C., Clamp,M., Clark,G., Clark,L.N., Clark,S.Y., Clee,C.M., Clegg,S., Cobley,V.E., Collier,R.E., Connor,R., Corby,N.R., Coulson,A., Coville,G.J., Deadman,R., Dhami,P., Dunn,M., Ellington,A.G., Frankland,J.A., Fraser,A., French,L., Garner,P., Grafham,D.V., Griffiths,C., Griffiths,M.N., Gwilliam,R., Hall,R.E., Hammond,S., Harley,J.L., Heath,P.D., Ho,S., Holden,J.L., Howden,P.J., Huckle,E., Hunt,A.R., Hunt,S.E., Jekosch,K., Johnson,C.M., Johnson,D., Kay,M.P., Kimberley,A.M., King,A., Knights,A., Laird,G.K., Lawlor,S., Lehvaslaiho,M.H., Leversha,M., Lloyd,C., Lloyd,D.M., Lovell,J.D., Marsh,V.L., Martin,S.L., McConnachie,L.J., McLay,K., McMurray,A.A., Milne,S., Mistry,D., Moore,M.J., Mullikin,J.C., Nickerson,T., Oliver,K., Parker,A., Patel,R., Pearce,T.A., Peck,A.I., Phillimore,B.J., Prathalingam,S.R., Plumb,R.W., Ramsay,H., Rice,C.M., Ross,M.T., Scott,C.E., Sehra,H.K., Shownkeen,R., Sims,S., Skuce,C.D., Smith,M.L., Soderlund,C., Steward,C.A., Sulston,J.E., Swann,M., Sycamore,N., Taylor,R., Tee,L., Thomas,D.W., Thorpe,A., Tracey,A., Tromans,A.C., Vaudin,M., Wall,M., Wallis,J.M., Whitehead,S.L., Whittaker,P., Willey,D.L., Williams,L., Williams,S.A., Wilming,L., Wray,P.W., Hubbard,T., Durbin,R.M., Bentley,D.R., Beck,S. and Rogers,J. TITLE The DNA sequence and comparative analysis of human chromosome 20 JOURNAL Nature 414 (6866), 865-871 (2001) PUBMED 11780052 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF239607.1 and CB137946.1. On Apr 7, 2003 this sequence version replaced gi:18644733. Summary: The protein encoded by this gene contains an acidic domain, a putative bipartite nuclear localization signal, a nuclear export signal, a leucine-isoleucine zipper, and phosphorylation motifs. In addition, the encoded protein contains Armadillo/beta-catenin-like repeats, which have been implicated in protein-protein interactions. Although the function of this protein has not been determined, the C-terminal portion of the protein has been shown to possess apoptosis-inducing activity. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF239607.1, AK074663.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. FEATURES Location/Qualifiers source 1..1897 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="20" /map="20q11.23-q12" gene 1..1897 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="catenin, beta like 1" /db_xref="GeneID:56259" /db_xref="HGNC:15879" /db_xref="HPRD:10850" /db_xref="MIM:611537" exon 1..121 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 40 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:374343096" variation 43 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:78962146" misc_feature 53..55 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="upstream in-frame stop codon" CDS 92..1783 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="nuclear associated protein; nuclear-associated protein; testis development protein NYD-SP19" /codon_start=1 /product="beta-catenin-like protein 1" /protein_id="NP_110517.2" /db_xref="GI:18644734" /db_xref="CCDS:CCDS13298.1" /db_xref="GeneID:56259" /db_xref="HGNC:15879" /db_xref="HPRD:10850" /db_xref="MIM:611537" /translation="
MDVGELLSYQPNRGTKRPRDDEEEEQKMRRKQTGTRERGRYREEEMTVVEEADDDKKRLLQIIDRDGEEEEEEEEPLDESSVKKMILTFEKRSYKNQELRIKFPDNPEKFMESELDLNDIIQEMHVVATMPDLYHLLVELNAVQSLLGLLGHDNTDVSIAVVDLLQELTDIDTLHESEEGAEVLIDALVDGQVVALLVQNLERLDESVKEEADGVHNTLAIVENMAEFRPEMCTEGAQQGLLQWLLKRLKAKMPFDANKLYCSEVLAILLQDNDENRELLGELDGIDVLLQQLSVFKRHNPSTAEEQEMMENLFDSLCSCLMLSSNRERFLKGEGLQLMNLMLREKKISRSSALKVLDHAMIGPEGTDNCHKFVDILGLRTIFPLFMKSPRKIKKVGTTEKEHEEHVCSILASLLRNLRGQQRTRLLNKFTENDSEKVDRLMELHFKYLGAMQVADKKIEGEKHDMVRRGEIIDNDTEEEFYLRRLDAGLFVLQHICYIMAEICNANVPQIRQRVHQILNMRGSSIKIVRHIIKEYAENIGDGRSPEFRENEQKRILGLLENF
" misc_feature 137..190 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q8WYA6.1); Region: Nuclear localization signal" misc_feature 245..577 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="Eukaryotic domain of unknown function (DUF1716); Region: DUF1716; pfam08216" /db_xref="CDD:116802" misc_feature 362..364 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q8WYA6.1); acetylation site" misc_feature <464..736 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cl02500" /db_xref="CDD:207616" misc_feature order(464..466,557..559,569..571,578..580,590..592, 722..724,731..733) /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:28904" misc_feature 647..973 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="Armadillo/beta-catenin-like repeats. An approximately 40 amino acid long tandemly repeated sequence motif first identified in the Drosophila segment polarity gene armadillo; these repeats were also found in the mammalian armadillo homolog beta-catenin; Region: ARM; cl02500" /db_xref="CDD:207616" misc_feature order(719..721,749..751,761..763,860..862,872..874, 881..883,893..895) /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /note="protein binding surface [polypeptide binding]; other site" /db_xref="CDD:28904" misc_feature 1256..1258 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q8WYA6.1); phosphorylation site" exon 122..310 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 143 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:376352806" variation 146 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:112045085" variation 150 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:150872211" variation 157 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:182279757" variation 169 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:369442657" variation 179 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:202016331" variation 180 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:373260848" variation 205 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:139428276" variation 213 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:150059167" variation 223 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:377312179" variation 284 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:143170003" variation 292 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:144258327" variation 304 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:371100789" exon 311..417 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 370 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:11549311" variation 372 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:148717643" variation 384 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:202008237" variation 390 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:144576870" exon 418..557 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 427 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="t" /db_xref="dbSNP:200099302" variation 466 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:147906955" variation 467 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:141617183" variation 487 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:145258824" variation 490 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:201471920" variation 499 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:377178252" variation 532 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:368812998" variation 541 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:150982113" variation 547 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:140908913" exon 558..655 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 607 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:200441452" variation 608 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:200455301" variation 617 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="g" /replace="t" /db_xref="dbSNP:199629672" variation 647 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:376332701" exon 656..749 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 745 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:150168338" exon 750..841 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 755 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:199865982" variation 776 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:370578340" variation 788 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:138624289" variation 793 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:374610622" variation 815 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:140243689" variation 824 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:186475150" variation 825..826 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="" /replace="g" /db_xref="dbSNP:144191226" exon 842..914 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 856 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:76396395" variation 865 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:200725330" variation 909 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:137951659" exon 915..973 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 922 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:142441724" variation 925 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:6096188" exon 974..1122 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 993 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:200219582" variation 1000 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:373264095" variation 1010 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:148139169" variation 1047 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:375145301" variation 1052 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:6067593" variation 1063 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:149569480" variation 1068 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:369990971" variation 1090 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:373840043" exon 1123..1304 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1139 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:141919968" variation 1183 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:377606536" variation 1197 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="c" /db_xref="dbSNP:75954662" variation 1207 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:201689535" variation 1235 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:202058629" variation 1267 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="g" /replace="t" /db_xref="dbSNP:200874158" variation 1270 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:140985198" exon 1305..1402 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1366 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:370621073" exon 1403..1483 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1442 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:144638509" variation 1444 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:147450818" variation 1447 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:368235471" variation 1455 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:141470801" variation 1456 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:201017515" exon 1484..1621 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1487 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:201986512" variation 1496 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:145448184" variation 1515 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:145224089" variation 1517 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:149088688" variation 1525 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="g" /replace="t" /db_xref="dbSNP:368154050" variation 1542 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:142148950" variation 1545 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:151227978" variation 1588 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="g" /db_xref="dbSNP:181057353" variation 1594 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:200548374" variation 1610 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:4811236" exon 1622..1694 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1646 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:376622128" STS 1662..1869 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /standard_name="RH67827" /db_xref="UniSTS:80593" variation 1687 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:200817413" exon 1695..1888 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /inference="alignment:Splign:1.39.8" variation 1718 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:199857944" variation 1721 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:370193565" variation 1722 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:145282312" STS 1729..1878 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /standard_name="WI-18282" /db_xref="UniSTS:14314" variation 1729 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:146419783" variation 1737 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:201887283" variation 1755 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:372667358" variation 1783 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:3199864" variation 1785 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:140951542" variation 1801 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="a" /replace="g" /db_xref="dbSNP:376636685" variation 1821 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" /replace="c" /replace="t" /db_xref="dbSNP:111273713" polyA_signal 1870..1875 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" polyA_site 1888 /gene="CTNNBL1" /gene_synonym="C20orf33; dJ633O20.1; NAP; NYD-SP19; P14L; PP8304" ORIGIN
actttacggcagtgtggctggagccgcggctgacgggcccgcggtctgggcgtgagtgcagggaagtggagtatttgctgggccgggtaccatggacgtgggcgaacttctgagctaccagcccaataggggcacaaaacgtccccgggatgatgaagaggaggagcagaagatgcgtcggaaacaaactggtactcgagaacgcggccgctatcgggaagaagaaatgactgtggtggaggaagcggatgatgacaaaaaaaggctgctgcagattattgacagagatggggaagaggaagaggaagaggaggagccattggatgaaagctcagtgaagaaaatgatcctcacatttgaaaagagatcatataaaaaccaagaattgcggattaagtttccagacaatccagagaagttcatggaatccgagctggacctaaatgacatcattcaggagatgcacgtggtggccaccatgccagacctgtaccaccttctggtggagctgaatgctgtacagtcgcttctcggcttgctcggacacgataatacagatgtgtccatagctgtggtcgatttgcttcaggaattaacagatatagacaccctccatgagagtgaagagggagcagaagtgctcatcgatgctctggtggatgggcaggtggtagcactgctggtacagaatctggagcgcctggatgagtctgtgaaagaggaggcagatggcgtccacaacactctggctattgtggaaaacatggctgagttccggcctgagatgtgtacagagggtgcccagcagggtcttctacagtggctgttgaagaggctgaaggcaaagatgccttttgatgccaacaaactgtattgcagtgaagtgctggccatattgctccaggacaatgatgaaaacagggaattgcttggggagctggatggaatcgatgtgcttcttcagcagttatccgtgtttaaaagacacaatcccagcacggctgaggagcaggagatgatggagaatctgtttgattccctctgctcctgtctaatgcttagttccaatcgtgagcgcttcctgaagggcgagggtcttcagctgatgaatctcatgctcagggaaaagaagatctcccggagcagtgccctgaaagtgctggaccatgccatgattggccccgaaggcacagacaactgccataagtttgttgacattcttggcttacgaaccatctttcccctctttatgaaatctcccaggaagatcaagaaagtgggaaccactgagaaggaacatgaagagcatgtctgttcgatcctggcttccctcctgcggaacctgagagggcagcagcggacccggcttctgaataaattcactgaaaatgacagtgagaaggttgacagactaatggagttgcattttaaatatctgggtgcaatgcaggtggcggacaagaagattgaaggggaaaaacacgacatggtccggcgaggagagatcatcgacaatgacaccgaggaggagttctacctccggcgcctggatgcggggctctttgttctccagcacatctgctacatcatggccgagatctgcaatgccaatgtcccccagattcgccagagggttcaccagatcctaaacatgcgaggaagctccatcaaaattgtcaggcatatcatcaaggagtatgcagagaacatcggggacggccggagcccggagttccgggagaacgagcaaaagcgcatcctgggcttgctggagaacttctagaggcaccttggccctgcgcatcatggactctctcagcttccctcccaggatcagtttctacacaactctgtgtggcttttggacaaattaaagctagttttggtaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:56259 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:56259 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI GeneID:56259 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA GeneID:56259 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:56259 -> Biological process: GO:0008380 [RNA splicing] evidence: IEA GeneID:56259 -> Biological process: GO:0016445 [somatic diversification of immunoglobulins] evidence: IMP GeneID:56259 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA GeneID:56259 -> Cellular component: GO:0000974 [Prp19 complex] evidence: IDA GeneID:56259 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:56259 -> Cellular component: GO:0005681 [spliceosomal complex] evidence: IDA GeneID:56259 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.