Home |
Help |
Advanced search
2024-04-24 22:21:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_030763 2126 bp mRNA linear PRI 09-JUN-2013
DEFINITION Homo sapiens high mobility group nucleosome binding domain 5
(HMGN5), mRNA.
ACCESSION NM_030763
VERSION NM_030763.2 GI:254028191
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2126)
AUTHORS Zhang,X.Y., Guo,Z.Q., Ji,S.Q., Zhang,M., Jiang,N., Li,X.S. and
Zhou,L.Q.
TITLE Small interfering RNA targeting HMGN5 induces apoptosis via
modulation of a mitochondrial pathway and Bcl-2 family proteins in
prostate cancer cells
JOURNAL Asian J. Androl. 14 (3), 487-492 (2012)
PUBMED 22504871
REMARK GeneRIF: HMGN5 may be a potential molecular target with therapeutic
relevance for the treatment of prostate cancer.
REFERENCE 2 (bases 1 to 2126)
AUTHORS Chen,P., Wang,X.L., Ma,Z.S., Xu,Z., Jia,B., Ren,J., Hu,Y.X.,
Zhang,Q.H., Ma,T.G., Yan,B.D., Yan,Q.Z., Li,Y.L., Li,Z., Yu,J.Y.,
Gao,R., Fan,N., Li,B. and Yang,J.L.
TITLE Knockdown of HMGN5 expression by RNA interference induces cell
cycle arrest in human lung cancer cells
JOURNAL Asian Pac. J. Cancer Prev. 13 (7), 3223-3228 (2012)
PUBMED 22994738
REMARK GeneRIF: HMGN5 silencing to significantly inhibit A549 and H1299
cell proliferation.
REFERENCE 3 (bases 1 to 2126)
AUTHORS Ji,S.Q., Yao,L., Zhang,X.Y., Li,X.S. and Zhou,L.Q.
TITLE Knockdown of the nucleosome binding protein 1 inhibits the growth
and invasion of clear cell renal cell carcinoma cells in vitro and
in vivo
JOURNAL J. Exp. Clin. Cancer Res. 31, 22 (2012)
PUBMED 22420896
REMARK GeneRIF: NSBP1 plays oncogenic role in clear cell renal cell
carcinoma (ccRCC) by promoting cell proliferation and invasion.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2126)
AUTHORS Wahafu,W., He,Z.S., Zhang,X.Y., Zhang,C.J., Yao,K., Hao,H.,
Song,G., He,Q., Li,X.S. and Zhou,L.Q.
TITLE The nucleosome binding protein NSBP1 is highly expressed in human
bladder cancer and promotes the proliferation and invasion of
bladder cancer cells
JOURNAL Tumour Biol. 32 (5), 931-939 (2011)
PUBMED 21695596
REMARK GeneRIF: these results suggest that NSBP1 promotes the viability of
bladder cancer cells through increased cell proliferation
REFERENCE 5 (bases 1 to 2126)
AUTHORS Malicet,C., Rochman,M., Postnikov,Y. and Bustin,M.
TITLE Distinct properties of human HMGN5 reveal a rapidly evolving but
functionally conserved nucleosome binding protein
JOURNAL Mol. Cell. Biol. 31 (13), 2742-2755 (2011)
PUBMED 21518955
REMARK GeneRIF: HMGN5 has a highly disordered structure, binds dynamically
to nucleosome core particles, modulates the binding of H1 to
chromatin, reduces the compaction of the chromatin fiber, and
affects transcription.
REFERENCE 6 (bases 1 to 2126)
AUTHORS Jiang,N., Zhou,L.Q. and Zhang,X.Y.
TITLE Downregulation of the nucleosome-binding protein 1 (NSBP1) gene can
inhibit the in vitro and in vivo proliferation of prostate cancer
cells
JOURNAL Asian J. Androl. 12 (5), 709-717 (2010)
PUBMED 20531280
REMARK GeneRIF: A positive correlation was observed between NSBP1
expression and cell proliferation and apoptosis in DU145 cells.
REFERENCE 7 (bases 1 to 2126)
AUTHORS Rochman,M., Malicet,C. and Bustin,M.
TITLE HMGN5/NSBP1: a new member of the HMGN protein family that affects
chromatin structure and function
JOURNAL Biochim. Biophys. Acta 1799 (1-2), 86-92 (2010)
PUBMED 20123071
REMARK GeneRIF: The structure of the HMGN5 gene and the known properties
of the HMGN5 protein, are described.
Review article
REFERENCE 8 (bases 1 to 2126)
AUTHORS Rochman,M., Postnikov,Y., Correll,S., Malicet,C., Wincovitch,S.,
Karpova,T.S., McNally,J.G., Wu,X., Bubunenko,N.A., Grigoryev,S. and
Bustin,M.
TITLE The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin
counteracts linker histone-mediated chromatin compaction and
modulates transcription
JOURNAL Mol. Cell 35 (5), 642-656 (2009)
PUBMED 19748358
REFERENCE 9 (bases 1 to 2126)
AUTHORS Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
TITLE Immunoaffinity profiling of tyrosine phosphorylation in cancer
cells
JOURNAL Nat. Biotechnol. 23 (1), 94-101 (2005)
PUBMED 15592455
REFERENCE 10 (bases 1 to 2126)
AUTHORS King,L.M. and Francomano,C.A.
TITLE Characterization of a human gene encoding nucleosomal binding
protein NSBP1
JOURNAL Genomics 71 (2), 163-173 (2001)
PUBMED 11161810
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK094058.1, DA745749.1 and
AF250329.1.
This sequence is a reference standard in the RefSeqGene project.
On Jul 16, 2009 this sequence version replaced gi:13540522.
Summary: This gene encodes a nuclear protein with similarities to
the high mobility group proteins, HMG14 and HMG17, which suggests
that this protein may function as a nucleosomal binding and
transcriptional activating protein. [provided by RefSeq, Sep 2009].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK094058.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-85 AK094058.1 1-85
86-596 DA745749.1 55-565
597-2126 AF250329.1 336-1865
FEATURES Location/Qualifiers
source 1..2126
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq13.3"
gene 1..2126
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/note="high mobility group nucleosome binding domain 5"
/db_xref="GeneID:79366"
/db_xref="HGNC:8013"
/db_xref="HPRD:02310"
/db_xref="MIM:300385"
exon 1..206
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
exon 207..344
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
misc_feature 315..317
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/note="upstream in-frame stop codon"
CDS 330..1178
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/note="nucleosomal binding protein 1; high-mobility group
nucleosome binding domain 5; nucleosome-binding protein 1"
/codon_start=1
/product="high mobility group nucleosome-binding
domain-containing protein 5"
/protein_id="NP_110390.1"
/db_xref="GI:13540523"
/db_xref="CCDS:CCDS14448.1"
/db_xref="GeneID:79366"
/db_xref="HGNC:8013"
/db_xref="HPRD:02310"
/db_xref="MIM:300385"
/translation="
MPKRKAAGQGDMRQEPKRRSARLSAMLVPVTPEVKPKRTSSSRKMKTKSDMMEENIDTSAQAVAETKQEAVVEEDYNENAKNGEAKITEAPASEKEIVEVKEENIEDATEKGGEKKEAVAAEVKNEEEDQKEDEEDQNEEKGEAGKEDKDEKGEEDGKEDKNGNEKGEDAKEKEDGKKGEDGKGNGEDGKEKGEDEKEEEDRKETGDGKENEDGKEKGDKKEGKDVKVKEDEKEREDGKEDEGGNEEEAGKEKEDLKEEEEGKEEDEIKEDDGKKEEPQSIV
"
misc_feature 333..608
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/note="HMG14 and HMG17; Region: HMG14_17; pfam01101"
/db_xref="CDD:201597"
misc_feature 420..422
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P82970.1); phosphorylation site"
misc_feature 555..557
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (P82970.1); phosphorylation site"
misc_feature 555..557
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[9]
exon 345..374
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
variation complement(352)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:142173136"
variation complement(364)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138950278"
exon 375..404
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
exon 405..458
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
variation complement(408)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:73631719"
variation complement(414)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374413319"
variation complement(428)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:73231013"
exon 459..596
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
variation complement(531)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:148090107"
exon 597..2126
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/inference="alignment:Splign:1.39.8"
variation complement(609..610)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace=""
/replace="a"
/db_xref="dbSNP:59584935"
variation complement(658)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143679569"
variation complement(696)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148928737"
variation complement(794)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:147858164"
variation complement(824)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:144502161"
variation complement(840)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142186197"
variation complement(875)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:374637006"
variation complement(957)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:150302618"
variation complement(1040)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:369429467"
variation complement(1075)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:186732408"
variation complement(1162)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:41310713"
variation complement(1333)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:184579787"
variation complement(1351)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:41300251"
variation complement(1492)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:41300259"
variation complement(1698)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace=""
/replace="t"
/db_xref="dbSNP:68183777"
polyA_signal 1738..1743
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
polyA_site 1759
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
variation complement(2033)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:148228755"
variation complement(2036)
/gene="HMGN5"
/gene_synonym="NBP-45; NSBP1"
/replace=""
/replace="t"
/db_xref="dbSNP:199672193"
ORIGIN
aatagcaccgcgagatctgttgaaacattgatttttgacgattccttccctgagaagagggcgaggagaagaagaaagaaaaaggagaactgaattgaattagattagcatgaaggaccttttcacgcggagactaaaagtactgcgcataacttcctgctcagaaatatatgcaaataagaagacagatcctgaaagagcaagctaggagagtacaggtcgtgctgcagttagttcattgaaaactcatttgctcttggagcagtcaggcagtgactgccttcggctttttttctgctgactaagatctcctatagagagctacaacaatgcccaaaagaaaggctgcaggtcaaggtgatatgaggcaggagccaaagagaagatctgccaggttgtctgctatgcttgtgccagttacaccagaggtgaagcctaaaagaacatcaagttcaaggaaaatgaagacaaaaagtgatatgatggaagaaaacatagatacaagtgcccaagcagttgctgaaaccaagcaagaagcagttgttgaagaagactacaatgaaaatgctaaaaatggagaagccaaaattacagaggcaccagcttctgaaaaagaaattgtggaagtaaaagaagaaaatattgaagatgccacagaaaagggaggagaaaagaaagaagcagtggcagcagaagtaaaaaatgaagaagaagatcagaaagaagatgaagaagatcaaaacgaagagaaaggggaagctggaaaagaagacaaagatgaaaaaggggaagaagatggaaaagaggataaaaatggaaatgagaaaggagaagatgcaaaagagaaagaagatggaaaaaaaggtgaagacggaaaaggaaatggagaagatggaaaagagaaaggagaagatgaaaaagaggaagaagacagaaaagaaacaggagatggaaaagagaatgaagatggaaaagagaagggagataaaaaagaggggaaagatgtaaaagtcaaagaagatgaaaaagagagagaagatggaaaagaagatgaaggtggaaatgaggaagaagctggaaaagagaaagaagatttaaaagaagaggaagaaggaaaagaggaagatgagatcaaagaagatgatggaaaaaaagaggagccacagagtattgtttaaaactgccctatgtagtttcataatttggtaacatgtaccttcatgttgtaaagttaatagagataaatatttttatcaaaaattttataaacacagcctttctttagcattgatttaatttcagaacatcttcatattgattattagccataaagtttctaacatgaaacatttatctataaattttgtgattatagtagtggaatacatagaaaaaaatatgctttcaactttgtgagtgaatttcgtgttgtgtaagttatatgtcaaatctttgaattttaattttactcttttatacatgtgataatttcataaagtgagggatcccaaaaaaagagtttcatccaacattcttgttctgcaggttgcttttataaagaaggtgaactattttcatgtaatgttaagagttaaacttatctttcccaaatataactttattattagcttgggaaaaatgaaattgtattcccatttttaaaataaatacaaatgtttatttcagaagggcagttttgattatatgtgaatacacaaattttactggatttatcttaataaaaagactctgacgatgattgtgttttgttatatcttcaaaaatatagctagtgaaatattgtgcttaatttttttctattgtgttattcatgaaaatatttaatattcactgacataaaattaatataaagtaaaattcaccattttaattataataaaaataaagtatataattcaatggttgtcagtatattcacaatgttgtgtccactgtttaattccagagaatttttatcacccaaataagaaacaaagcaccaattagcagtctcttcccattttcgcccaacttatcccccacctccatcccttggcaaccactaatctgccttctatctctatggatttgcctattctgaacatttattataaatggaatcacat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:79366 -> Molecular function: GO:0003682 [chromatin binding] evidence: NAS
GeneID:79366 -> Molecular function: GO:0031492 [nucleosomal DNA binding] evidence: IEA
GeneID:79366 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:79366 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
GeneID:79366 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:79366 -> Biological process: GO:0016568 [chromatin modification] evidence: IEA
GeneID:79366 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: NAS
GeneID:79366 -> Cellular component: GO:0000785 [chromatin] evidence: IEA
GeneID:79366 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:79366 -> Cellular component: GO:0005634 [nucleus] evidence: NAS
GeneID:79366 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IEA
GeneID:79366 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:79366 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.