Home |
Help |
Advanced search
2024-04-26 13:35:02, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_024834 4298 bp mRNA linear PRI 16-JUN-2013
DEFINITION Homo sapiens minichromosome maintenance complex binding protein
(MCMBP), transcript variant 1, mRNA.
ACCESSION NM_024834
VERSION NM_024834.3 GI:373838725
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4298)
AUTHORS Jagannathan,M., Sakwe,A.M., Nguyen,T. and Frappier,L.
TITLE The MCM-associated protein MCM-BP is important for human nuclear
morphology
JOURNAL J. Cell. Sci. 125 (PT 1), 133-143 (2012)
PUBMED 22250201
REMARK GeneRIF: results suggest that MCM-BP makes multiple contributions
to human cells that are not limited to unloading of the MCM complex
REFERENCE 2 (bases 1 to 4298)
AUTHORS Nguyen,T., Jagannathan,M., Shire,K. and Frappier,L.
TITLE Interactions of the human MCM-BP protein with MCM complex
components and Dbf4
JOURNAL PLoS ONE 7 (4), E35931 (2012)
PUBMED 22540012
REMARK GeneRIF: MCM-BP can decrease phosphorylation by DDK but is not a
substrate.
REFERENCE 3 (bases 1 to 4298)
AUTHORS Nishiyama,A., Frappier,L. and Mechali,M.
TITLE MCM-BP regulates unloading of the MCM2-7 helicase in late S phase
JOURNAL Genes Dev. 25 (2), 165-175 (2011)
PUBMED 21196493
REMARK GeneRIF: MCM-BP silencing in human cells also delays MCM
dissociation in late S phase
REFERENCE 4 (bases 1 to 4298)
AUTHORS Takahashi,N., Quimbaya,M., Schubert,V., Lammens,T., Vandepoele,K.,
Schubert,I., Matsui,M., Inze,D., Berx,G. and De Veylder,L.
TITLE The MCM-binding protein ETG1 aids sister chromatid cohesion
required for postreplicative homologous recombination repair
JOURNAL PLoS Genet. 6 (1), E1000817 (2010)
PUBMED 20090939
REMARK GeneRIF: Knockdown of the human ETG1 results in defective chromatid
cohesion.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 4298)
AUTHORS Sakwe,A.M., Nguyen,T., Athanasopoulos,V., Shire,K. and Frappier,L.
TITLE Identification and characterization of a novel component of the
human minichromosome maintenance complex
JOURNAL Mol. Cell. Biol. 27 (8), 3044-3055 (2007)
PUBMED 17296731
REMARK GeneRIF: MCM-BP is conserved in multicellular eukaryotes and shares
limited homology with MCM proteins. MCM-BP formed a complex with
MCM3 to MCM7, which excluded MCM2.
REFERENCE 6 (bases 1 to 4298)
AUTHORS Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
TITLE A probability-based approach for high-throughput protein
phosphorylation analysis and site localization
JOURNAL Nat. Biotechnol. 24 (10), 1285-1292 (2006)
PUBMED 16964243
REFERENCE 7 (bases 1 to 4298)
AUTHORS Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
TITLE A scan of chromosome 10 identifies a novel locus showing strong
association with late-onset Alzheimer disease
JOURNAL Am. J. Hum. Genet. 78 (1), 78-88 (2006)
PUBMED 16385451
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BQ929053.1, AK023143.1, AC027672.12 and AA292620.1.
On Jan 24, 2012 this sequence version replaced gi:148727274.
Summary: This gene encodes a protein which is a component of the
hexameric minichromosome maintenance (MCM) complex which regulates
initiation and elongation of DNA. Multiple transcript variants
encoding different isoforms have been found for this gene.
[provided by RefSeq, Jan 2012].
Transcript Variant: This variant (1) represents the longest
transcript and encodes the longest protein (isoform 1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AK023143.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-129 BQ929053.1 1-129
130-3811 AK023143.1 1-3682
3812-3892 AC027672.12 185665-185745
3893-4073 AK023143.1 3764-3944
4074-4246 AA292620.1 1-173 c
4247-4298 AC027672.12 186100-186151
FEATURES Location/Qualifiers
source 1..4298
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q26.11"
gene 1..4298
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="minichromosome maintenance complex binding protein"
/db_xref="GeneID:79892"
/db_xref="HGNC:25782"
/db_xref="HPRD:07624"
/db_xref="MIM:610909"
exon 1..357
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
misc_feature 81..83
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="upstream in-frame stop codon"
variation 257
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="c"
/replace="g"
/db_xref="dbSNP:11556854"
variation 276
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="t"
/db_xref="dbSNP:11556853"
CDS 300..2228
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="isoform 1 is encoded by transcript variant 1;
MCM-binding protein; minichromosome maintenance
complex-binding protein; mini-chromosome maintenance
complex-binding protein"
/codon_start=1
/product="mini-chromosome maintenance complex-binding
protein isoform 1"
/protein_id="NP_079110.1"
/db_xref="GI:13376243"
/db_xref="CCDS:CCDS7617.1"
/db_xref="GeneID:79892"
/db_xref="HGNC:25782"
/db_xref="HPRD:07624"
/db_xref="MIM:610909"
/translation="
MPCGEDWLSHPLGIVQGFFAQNGVNPDWEKKVIEYFKEKLKENNAPKWVPSLNEVPLHYLKPNSFVKFRCMIQDMFDPEFYMGVYETVNQNTKAHVLHFGKYRDVAECGPQQELDLNSPRNTTLERQTFYCVPVPGESTWVKEAYVNANQARVSPSTSYTPSRHKRSYEDDDDMDLQPNKQKDQHAGARQAGSVGGLQWCGEPKRLETEASTGQQLNSLNLSSPFDLNFPLPGEKGPACLVKVYEDWDCFKVNDILELYGILSVDPVLSILNNDERDASALLDPMECTDTAEEQRVHSPPASLVPRIHVILAQKLQHINPLLPACLNKEESKTCKFVSSFMSELSPVRAELLGFLTHALLGDSLAAEYLILHLISTVYTRRDVLPLGKFTVNLSGCPRNSTFTEHLYRIIQHLVPASFRLQMTIENMNHLKFIPHKDYTANRLVSGLLQLPSNTSLVIDETLLEQGQLDTPGVHNVTALSNLITWQKVDYDFSYHQMEFPCNINVFITSEGRSLLPADCQIHLQPQLIPPNMEEYMNSLLSAVLPSVLNKFRIYLTLLRFLEYSISDEITKAVEDDFVEMRKNDPQSITADDLHQLLVVARCLSLSAGQTTLSRERWLRAKQLESLRRTRLQQQKCVNGNEL
"
misc_feature 408..797
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="Mini-chromosome maintenance replisome factor;
Region: MCM_bind; pfam09739"
/db_xref="CDD:204302"
misc_feature 759..761
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9BTE3.2); phosphorylation site"
misc_feature 759..761
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 777..779
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9BTE3.2); phosphorylation site"
misc_feature 1191..1193
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9BTE3.2); phosphorylation site"
misc_feature 1191..1193
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1353..1652
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/note="Putative alanine racemase; Region: Racemase_4;
pfam13615"
/db_xref="CDD:205793"
variation 357
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:79599682"
exon 358..443
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 444..584
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 585..626
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 627..728
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 729..873
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 853
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:35175048"
exon 874..1025
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1026..1126
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1127..1305
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 1184
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:35484984"
variation 1235
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="c"
/replace="t"
/db_xref="dbSNP:34297798"
exon 1306..1429
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1430..1547
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1548..1713
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 1714..1847
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 1757
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:34118671"
exon 1848..2012
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 2013..2101
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
exon 2102..4298
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/inference="alignment:Splign:1.39.8"
variation 2110
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="c"
/replace="g"
/db_xref="dbSNP:35371199"
variation 2363..2364
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace=""
/replace="gt"
/db_xref="dbSNP:28362484"
variation 3440
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="g"
/db_xref="dbSNP:10550"
STS 3680..3794
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/standard_name="A005M41"
/db_xref="UniSTS:7490"
STS 3680..3794
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/standard_name="G32243"
/db_xref="UniSTS:116846"
variation 3812
/gene="MCMBP"
/gene_synonym="C10orf119; MCM-BP"
/replace="a"
/replace="c"
/db_xref="dbSNP:6881"
ORIGIN
aggtcgcaggcagcgcggtcggcggcggctatttcccgccattgtgcgaagtgaaggctaggggcccgtacgcgcccgcctgactgtcgccagcagctcctcggcggccccaccgcagccgccgctccctgaggcgcgggaggcccgcgccccgcggctcgctgtgcgtgggagggcgcgagcgaacgcgggcgaggagcggccgagccgctgaagaggagctgggcgccggccgcccggccgcgctcggcccgcggatcgcctccgcccggtcttcgccggccccggcccctggcgagatgccgtgtggggaggattggctcagccacccgctgggaatcgtgcagggattcttcgcccaaaatggagttaatcctgactgggagaagaaagtaattgagtattttaaggaaaagctgaaggaaaataatgctcctaagtgggtaccatcactgaacgaagttccccttcattatttgaaacctaatagttttgtgaaatttcgttgcatgattcaggatatgtttgaccctgagttttacatgggagtttatgaaacggttaaccaaaacacaaaagcacatgttcttcattttggaaaatatagagatgtagcagagtgtgggcctcaacaagaacttgatttaaactctccacgaaataccactttggaaagacagactttctattgtgttccggtgcctggggaatctacgtgggtaaaagaagcctatgttaatgcaaaccaagctcgagtcagtccctcaacatcctacactcctagtcgccacaagaggagttatgaagatgatgacgatatggacctacagcccaataagcagaaagaccaacatgcaggtgccagacaagcagggagtgttggtggtcttcaatggtgtggagagccaaaacgtttagaaactgaagcttctactgggcaacagctgaactctctgaacttgtcttctccttttgatttgaattttccattgccaggagagaagggccctgcatgccttgtgaaggtttatgaagattgggattgtttcaaagtaaatgacattcttgagctatatggcatactgtctgtggatcctgtgctgagtatactgaataatgatgaaagggatgcctctgcactgctggatccgatggagtgcacagacacagcagaggagcagagagtacacagtcctcctgcttcattagtgccgagaattcatgtgatcttagcccagaagttgcaacacatcaacccattattgcctgcctgccttaacaaagaggagagcaaaacctgtaagtttgtttcaagtttcatgtccgaattgtctccagtcagagcagaacttcttgggttccttactcatgcccttctgggggatagtttggctgctgaataccttatattacatctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttacagttaacttgagtggttgcccacggaatagtaccttcacagaacacttgtatcgaattattcaacatcttgttccagcatcttttcgtctgcagatgactatagagaacatgaaccatttgaaattcattccccacaaagactacacagccaatcgcttggtcagtgggctcctccagctgcccagcaatacttcccttgtaatcgatgagactctcctggaacaggggcagctggataccccaggtgttcataatgtgacagccctgagcaacctcataacgtggcagaaggtggattatgacttcagctaccatcagatggaattcccctgcaatattaacgttttcattacttcggaggggaggtcactcctcccggcagactgccagattcacttacagccccagctaattccaccaaacatggaggagtacatgaacagccttctctcagcggtgctgccttccgtgctgaacaaattccgcatttatctaactcttttgagattcttggaatatagcatatctgatgaaataaccaaggcagttgaagatgactttgtggaaatgcggaagaacgaccctcagagcatcactgctgatgatcttcaccagctgctcgtggtggctcggtgtctgtctctcagtgctggtcagacaacgctgtcaagagaacgatggctgagagcaaagcagctagagtctttaagaagaacgaggcttcagcagcaaaaatgtgtgaatggaaatgaactttaaagatgtaatacctatgaagagtaatgggcaaactgtagccacataattgtaaaattcagatattcatttataccacattgttttataggtaatttctatcacaaaccagtgacatttcctgaaatcaagcctggtaacacctgatgtttatatgatattcagtaaggacttttaccttactgatttcatggagcttttgaagtttgttttataataattatataaattagtaatgatgtaaaaaaagtatttgatattaaaagtttaatattgataatgttgctgattgtaccatttccttagcttcagctgagtcataggccagactgttgaaatgctgaaatgaagaaggttgttgcagtttcaaagtcagaggaatcgtgcttcggatttcttatgttttctagttctctgtttttccagttcacagtgggttggggtgcattcagtagtccatctttggggaacggaggcgtacttgccattgattcacatgactacatgaaattctgtactgtcatttcccagatgtttggccacagaaactttttcccacttaacatttgttaacagcctgcaaaactaaacttgtacatggcagtggttcccagacttttgtattttatggaccggtagtaatatttccaaaaatctggggtactataaggttgccaatttaccttgccaagtaatccgaataaatcactgtattatcaccatttttttcataaaaggaaaggacaatctatctctgaataagaggagtcctttaaacggaatgaatgtggcttttgggggcaaaagaaaccaagacactacattgtctttattttctcctatcccagtgcatttgagaaccatgcataagggaatgctgtgctacaaagctgtgcccaaatatgaaaacaaaataggaaacttaaaaagcaataccccctttagaaagtttttattttcttaaatgtcattgagttgctttgattctattggatttttggcattttttatgggatcatcagttggttccaagtatgttagatcagctaacatctgctactccagtaacagcctcgtacaactgcaggtaggttttctccagaccaattagttttaatagagcaaactaacaacagactgtagtagcatggttatggcaaccagaatcttcagaaaggttaggacattactttttaagctgtcagtggtatcaaataacttacctagttggaggcagataaaggatcccttacgttttttcctataaggcctaaattgaaattgttaaccaaggaaacagggtcagccttgaaaaatcaaggaattcattgtacctaataactgaagtaaaaataactagttgttcaacttttcctaaactcaaatctatttttataaacaaatgtaaataatgtttatattagagttgaactggttttcatttttataactggtagactagaccttccttaaacttttagaaataaaatgaaggcttcactggatttgtgaggataaaatacattttctttaattgtcctagagcaaagtacattagtcaccatgtgttttttgtgccaatgtaaattgtaatttaccaaagaaaaatacatacattgcttggtcttgcagaaaagttcccttgaaagaacctttccaataaataaaacgtcccaaattagcagtaccttgggctgtttttcatgagtaagaagattcaccatcccatgtgatctgtgtggaaaaagaccatgtcctcttggtggaagacatgagagagctgaactgaagtggaggaggtggtgcaagagggaccttcctgctcaaggcccgcccaggcagcggaatggagtgcagtgcttggctgcagaaaccctttgtccctcacctatatatacacggacagtcaagtttgttgctctaacgtaaggcacagcgttaatcctgtatggccaggaaactgagtagactcctgtgtaaccctgtttggaactttgccttcttaaaatgatttttcaaagatctctttcgaactaatttctgtagagtttaaacgtgtattttatcacctaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:79892 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: IMP
GeneID:79892 -> Biological process: GO:0000084 [S phase of mitotic cell cycle] evidence: TAS
GeneID:79892 -> Biological process: GO:0006261 [DNA-dependent DNA replication] evidence: IMP
GeneID:79892 -> Biological process: GO:0007062 [sister chromatid cohesion] evidence: IMP
GeneID:79892 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:79892 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:79892 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:79892 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:79892 -> Cellular component: GO:0042555 [MCM complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.