GGRNA Home | Help | Advanced search

2019-03-24 19:52:41, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_024786               2618 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens zinc finger, DHHC-type containing 11 (ZDHHC11), mRNA.
ACCESSION   NM_024786 XM_940764
VERSION     NM_024786.2  GI:196162714
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2618)
  AUTHORS   Yamamoto,Y., Chochi,Y., Matsuyama,H., Eguchi,S., Kawauchi,S.,
            Furuya,T., Oga,A., Kang,J.J., Naito,K. and Sasaki,K.
  TITLE     Gain of 5p15.33 is associated with progression of bladder cancer
  JOURNAL   Oncology 72 (1-2), 132-138 (2007)
   PUBMED   18025801
  REMARK    GeneRIF: data suggest that gain of 5p15.33 (TPPP and ZDHHC11) may
            become a potential biomarker identifying high-risk patients with
            disease progression in bladder cancer.
REFERENCE   2  (bases 1 to 2618)
  AUTHORS   Clark,H.F., Gurney,A.L., Abaya,E., Baker,K., Baldwin,D., Brush,J.,
            Chen,J., Chow,B., Chui,C., Crowley,C., Currell,B., Deuel,B.,
            Dowd,P., Eaton,D., Foster,J., Grimaldi,C., Gu,Q., Hass,P.E.,
            Heldens,S., Huang,A., Kim,H.S., Klimowski,L., Jin,Y., Johnson,S.,
            Lee,J., Lewis,L., Liao,D., Mark,M., Robbie,E., Sanchez,C.,
            Schoenfeld,J., Seshagiri,S., Simmons,L., Singh,J., Smith,V.,
            Stinson,J., Vagts,A., Vandlen,R., Watanabe,C., Wieand,D., Woods,K.,
            Xie,M.H., Yansura,D., Yi,S., Yu,G., Yuan,J., Zhang,M., Zhang,Z.,
            Goddard,A., Wood,W.I., Godowski,P. and Gray,A.
  TITLE     The secreted protein discovery initiative (SPDI), a large-scale
            effort to identify novel human secreted and transmembrane proteins:
            a bioinformatics assessment
  JOURNAL   Genome Res. 13 (10), 2265-2270 (2003)
   PUBMED   12975309
  REMARK    Erratum:[Genome Res. 2003 Dec;13(12):2759]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK023215.1, AK024233.1 and BC032000.1.
            On Aug 15, 2008 this sequence version replaced gi:13376149.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK023215.1, BC032000.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2261              AK023215.1         1-2261
            2262-2296           AK024233.1         3580-3614
            2297-2604           AK023215.1         2316-2623
            2605-2618           BC032000.1         2243-2256
FEATURES             Location/Qualifiers
     source          1..2618
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5p15.33"
     gene            1..2618
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /note="zinc finger, DHHC-type containing 11"
                     /db_xref="GeneID:79844"
                     /db_xref="HGNC:19158"
                     /db_xref="HPRD:15708"
     exon            1..606
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     variation       35
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3747732"
     variation       56
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3747733"
     misc_feature    58..60
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /note="upstream in-frame stop codon"
     variation       100
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3747734"
     variation       102..103
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace=""
                     /replace="aggcctggccaggtcctctgcccagg"
                     /db_xref="dbSNP:3833451"
     CDS             385..1623
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /note="zinc finger, DHHC domain containing 11; DHHC-11;
                     zinc finger protein 399; zinc finger DHHC
                     domain-containing protein 11"
                     /codon_start=1
                     /product="probable palmitoyltransferase ZDHHC11"
                     /protein_id="NP_079062.1"
                     /db_xref="GI:13376150"
                     /db_xref="CCDS:CCDS3857.1"
                     /db_xref="GeneID:79844"
                     /db_xref="HGNC:19158"
                     /db_xref="HPRD:15708"
                     /translation="
MDTRSGSQCSVTPEAILNNEKLVLPPRISRVNGWSLPLHYFQVVTWAVFVGLSSATFGIFIPFLPHAWKYIAYVVTGGIFSFHLVVHLIASCIDPADSNVRLMKNYSQPMPLFDRSKHAHVIQNQFCHLCKVTVNKKTKHCISCNKCVSGFDHHCKWINNCVGSRNYWFFFSTVASATAGMLCLIAILLYVLVQYLVNPGVLRTDPRYEDVKNMNTWLLFLPLFPVQVQTLIVVIIGMLVLLLDFLGLVHLGQLLIFHIYLKAKKMTTFEYLINNRKEESSKHQAVRKDPYVQMDKGVLQQGAGALGSSAQGVKAKSSLLIHKHLCHFCTSVNQDGDSTAREGDEDPCPSALGAKARNSRLICRRLCQFSTRVHPDGGSMAQEADDAPSISTLGLQQETTEPMKTDSAESED
"
     misc_feature    511..573
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9H8X9.1);
                     transmembrane region"
     misc_feature    592..654
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9H8X9.1);
                     transmembrane region"
     misc_feature    634..1209
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /note="DHHC palmitoyltransferase; Region: zf-DHHC;
                     pfam01529"
                     /db_xref="CDD:201843"
     misc_feature    913..975
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9H8X9.1);
                     transmembrane region"
     misc_feature    1075..1137
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9H8X9.1);
                     transmembrane region"
     exon            607..785
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            786..887
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            888..1012
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     variation       1004
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3863148"
     exon            1013..1168
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1169..1284
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1285..1319
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1320..1407
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     variation       1348
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2335582"
     variation       1353
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2878465"
     variation       1354
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2878466"
     variation       1355
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2878467"
     variation       1357
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2335583"
     variation       1358
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2878468"
     variation       1389
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1808545"
     variation       1400
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2335585"
     exon            1408..1442
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1443..1530
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     variation       1499
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3747738"
     exon            1531..1565
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1566..1630
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     exon            1631..2606
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /inference="alignment:Splign:1.39.8"
     STS             1688..1887
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /standard_name="A008P27"
                     /db_xref="UniSTS:55169"
     variation       2030
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:453637"
     variation       2297
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3180297"
     variation       2318
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057004"
     variation       2334
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057005"
     variation       2340
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057006"
     variation       2341
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057007"
     variation       2357
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057008"
     variation       2365
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057009"
     variation       2379
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057010"
     variation       2393
                     /gene="ZDHHC11"
                     /gene_synonym="ZNF399"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057011"
ORIGIN      
gtgaacgggttgtgggacctgtcgctgtgtgggggctgtcgagcactccccagaacgtaacaaatcctcaggggaactgatgggcggtcgcgcgggcactgggtcctccacaccctggagagccgttttccgttgccactcggctctggccggggtcacattctgcagcatgtctgttcattcccctgggcggggccctgcaccgactccagcccagcccctgctccctctgcggggaacgtggccccaggcagtgctgggccattggctgtcagtgctggtcctggcggctgcattcccagtccccttggtctctgtgacagtgggcggggccggccctcccaggatctgacggcgcaggtcctccccttctgtgtcctgcagatggacacccgctccgggagccagtgttccgtcaccccagaagccatactcaataatgaaaagctggtcttgccgccccgcatctccagagtgaacggctggtcgttacccctgcactacttccaggtggtgacctgggctgtcttcgtgggcctttcctcggccaccttcgggatcttcattcccttcctgcctcacgcgtggaaatacattgcctacgtggtgaccggggggatcttctcgttccacctcgtcgtccacctgatcgcgtcctgcatcgacccggccgactccaatgtcagactcatgaagaactattctcagcccatgcccctcttcgacagatcaaaacatgcacacgtgatccagaatcagttctgccacctgtgcaaggtcaccgtgaacaagaaaaccaaacactgcatttcctgcaataagtgtgtgtccggcttcgaccaccactgcaaatggatcaacaactgcgtgggaagccggaattattggttcttcttcagcactgtggcctcggccacagctggcatgctctgcctgatcgccatcctgctgtatgtcctcgtccagtacctcgtgaaccccggggtgctccgcacggaccccaggtatgaagatgtcaagaatatgaacacgtggctgctgttcctccccctgttcccggtgcaggtgcagaccctgatagtcgtgatcatcgggatgctcgtgctcctgctggactttcttggcttggtgcacctgggccagctgctcatcttccacatctacctgaaggccaagaagatgaccacctttgagtatctcattaataaccgcaaagaagagagttcaaaacatcaagcagtgaggaaagatccatacgtgcaaatggacaaaggagttctccagcaaggagctggcgccctgggctcatctgcacagggagtcaaagccaagagctccctgctgattcacaagcacttatgtcacttctgcacttcagtaaaccaggatggggattcgacggcacgggaaggggatgaagacccgtgtccatctgcacttggagccaaggccaggaactcccggctgatttgcaggcgcctgtgtcagttctccactcgtgtacacccagacgggggctcgatggcacaggaagcagatgatgccccgagtatatctacacttgggctgcaacaagaaacaacagagcccatgaaaactgacagtgctgaaagtgaagactgagattcaggagctcaggtgcccctgtgatccaggtcttctaccctgaaaccccaccctccatcaaggtcctgcctgtagagtctaccttgcaaagcctcctgctcctacccatgctacaggccaggaaccagagcccatcatctcagaggcccctggatgtccttcgaaggaaccaggaccctcagagcccagcatccatctctgtcatcatcttcatcacacccaaagaagagccagccttgcaggagggtttacatctccaggaagatgggctgccagcaactgcagaggatgcagccacctgcttaactgtgctgtccagccagccagccagctgcagggcctcttgctgcttaagagctgatgggccgggcatgttggctcacacctgtgagcacagtactgggaaatgggagcacagtactaggaaatgggagcacagtactgggaaatgggagcacagtactgggaaatgggggctcacagcactgcaaaatgggagcacagtattgggaaatgggagcacagtactgggaagtgggagcacagtactgagaagtgggagcacagtactgagaaatgggagtacactactgagaaatgggagcacagtactgggaaatgggcatacagtactgagaaatgggagcacacagtactgggaaatgggagcacagtactgggaaatgggagcccacagtactgggaaaggggagttcacagtactcggaaatgggagcatagtactgggaaatgggagcacagtactgggaaatgggagcatagtactgggaaaccccagacctggattctgagtttttcagcctagcccagacttcttatcttagtagacaaaaagagtcaataccagagaaccagaggcatcctctgtattttaatgaactctgcattttaatctgtttagtagtcattttttaaaagataatcagttttccaaatatatctataagttactacgtgcaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:79844 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:79844 -> Molecular function: GO:0016746 [transferase activity, transferring acyl groups] evidence: IEA
            GeneID:79844 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.