GGRNA Home | Help | Advanced search

2020-10-30 19:58:57, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_022742               4221 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens coiled-coil domain containing 136 (CCDC136),
            transcript variant 1, mRNA.
ACCESSION   NM_022742
VERSION     NM_022742.4  GI:319655555
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4221)
  AUTHORS   Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M.,
            Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D.,
            Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J.
  TITLE     Genetic variants in nuclear-encoded mitochondrial genes influence
            AIDS progression
  JOURNAL   PLoS ONE 5 (9), E12862 (2010)
   PUBMED   20877624
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 4221)
  AUTHORS   Lim,J., Hao,T., Shaw,C., Patel,A.J., Szabo,G., Rual,J.F.,
            Fisk,C.J., Li,N., Smolyar,A., Hill,D.E., Barabasi,A.L., Vidal,M.
            and Zoghbi,H.Y.
  TITLE     A protein-protein interaction network for human inherited ataxias
            and disorders of Purkinje cell degeneration
  JOURNAL   Cell 125 (4), 801-814 (2006)
   PUBMED   16713569
REFERENCE   3  (bases 1 to 4221)
  AUTHORS   Lehner,B. and Sanderson,C.M.
  TITLE     A protein interaction framework for human mRNA degradation
  JOURNAL   Genome Res. 14 (7), 1315-1323 (2004)
   PUBMED   15231747
REFERENCE   4  (bases 1 to 4221)
  AUTHORS   Zhang,X.M., Sheng,S.R., Wang,X.Y., Bin,L.H., Wang,J.R. and Li,G.Y.
  TITLE     Expression of tumor related gene NAG6 in gastric cancer and
            restriction fragment length polymorphism analysis
  JOURNAL   World J. Gastroenterol. 10 (9), 1361-1364 (2004)
   PUBMED   15112360
  REMARK    GeneRIF: Data suggest that NAG6 may represent a candidate tumor
            suppressor gene at 7q31-32 loci associated with gastric carcinoma.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX952188.1, AB058696.1 and AI611323.1.
            On Jan 19, 2011 this sequence version replaced gi:115511011.
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC150331.1, AB058696.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025085 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-49                BX952188.1         2-50
            50-4217             AB058696.1         1-4168
            4218-4221           AI611323.1         5-8                 c
FEATURES             Location/Qualifiers
     source          1..4221
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q33"
     gene            1..4221
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /note="coiled-coil domain containing 136"
                     /db_xref="GeneID:64753"
                     /db_xref="HGNC:22225"
                     /db_xref="MIM:611902"
     exon            1..432
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       59
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73238120"
     variation       64
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188002290"
     misc_feature    66..68
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /note="upstream in-frame stop codon"
     variation       107
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191625228"
     variation       231
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377037705"
     variation       367
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371820153"
     variation       393
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368197914"
     variation       397
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201807209"
     variation       400
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183403624"
     variation       403
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369999789"
     CDS             417..3881
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /note="isoform 1 is encoded by transcript variant 1;
                     coiled-coil domain-containing protein 136; nasopharyngeal
                     carcinoma-associated gene 6 protein"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 136
                     isoform 1"
                     /protein_id="NP_073579.4"
                     /db_xref="GI:319655556"
                     /db_xref="CCDS:CCDS47704.1"
                     /db_xref="GeneID:64753"
                     /db_xref="HGNC:22225"
                     /db_xref="MIM:611902"
                     /translation="
MQAMEGEVLLPALYEEEEEEEEEEEEVEEEEEQVQKGGSVGSLSVNKHRGLSLTETELEELRAQVLQLVAELEETRELAGQHEDDSLELQGLLEDERLASAQQAEVFTKQIQQLQGELRSLREEISLLEHEKESELKEIEQELHLAQAEIQSLRQAAEDSATEHESDIASLQEDLCRMQNELEDMERIRGDYEMEIASLRAEMEMKSSEPSGSLGLSDYSGLQEELQELRERYHFLNEEYRALQESNSSLTGQLADLESERTQRATERWLQSQTLSMTSAESQTSEMDFLEPDPEMQLLRQQLRDAEEQMHGMKNKCQELCCELEELQHHRQVSEEEQRRLQRELKCAQNEVLRFQTSHSVTQNEELKSRLCTLQKKYDTSQDEQNELLKMQLQLQTELRQLKVMKSTLVENQSEKELLCRLQKLHLQHQNVTCEKEKLLERQQQLQEELQCHEAELQHLRDTVASFKESNEKDTETHAQLQEMKQLYQASKDELERQKHMYDQLEQDLLLCQLELKELKASHPIPEDKGKCANKCDTLLSRLTELQEKYKASQKEMGQLQMEQCELLEDQRRMQEEQGQLQEELHRLTLPLPKSGLLLKSQELLTKLEDLCELQLLYQGMQEEQKKLIQNQDCVLKEQLEIHEELRRFKESHFQEVLENPDDSKLAKSSKCNRNKQSKLLMEQMQALQVMYDAGQAKQELLQQEQGRLLEERKRLQADLQLCLEEMQLLQVQSPSIKMSLESYGKSYGSMVPSNENCRKTYDTTVDDNESYYKSYTSTQTSSKSFLKSYDSSTSASEAYGKSYCTTSNSSITYKKSYGSTSSSDTCQKSFVSSCTDEEPAEPEDMERFEEMVVKVLIKLQAVQAMYQISQEEHSQLQEQMEKLLAKQKDLKEELDACEREFKECMECLEKPMAPQNDKNEIKELQTKLRELQLQYQASMDEQGRLLVVQEQLEGQLQCCQEELRQLREKRPSVVKEARGKNANKNMNKNANGVKMKKVTKPCSDTSESDLETRKSLEVVLYYKASQRKLDGLAKEEEKKEEMEEEKKEVKEEAKEQCGDELVAEPADPEEAKSTEDQEENEEDKEEEEKEEDSEEEEDDADSSLESPEENNPLRLSESKKSSPTPNPPIFSLPLVGLVVISALLWCWWAETSS
"
     misc_feature    3804..3866
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96JN2.3);
                     transmembrane region"
     exon            433..687
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       453
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372607897"
     variation       482
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192348781"
     variation       496
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375637274"
     variation       516
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201497246"
     variation       529
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143537881"
     variation       530
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376755462"
     variation       538
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371358536"
     variation       539
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374254797"
     variation       578
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78589071"
     variation       593
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368126722"
     variation       601
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370540126"
     variation       614
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200045449"
     variation       686
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374903912"
     exon            688..762
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     exon            763..1086
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       782
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201330064"
     variation       834
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200870724"
     variation       842
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368166029"
     variation       862
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200585539"
     variation       931
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200189364"
     variation       936
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201479027"
     variation       946
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374763554"
     variation       975
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142162337"
     variation       976
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372522612"
     variation       1002
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377566040"
     variation       1015
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185493260"
     variation       1064
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117874579"
     variation       1068
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3816887"
     variation       1079
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3816886"
     exon            1087..1198
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1104
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199931459"
     variation       1110
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373645281"
     variation       1132
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368912903"
     variation       1161
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372216926"
     variation       1168
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193040933"
     exon            1199..1364
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1249
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143320390"
     variation       1276
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201808958"
     variation       1290
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200137911"
     variation       1296
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367581022"
     variation       1310
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201520741"
     variation       1314
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373307906"
     exon            1365..1505
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1420
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377594781"
     variation       1434
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370564304"
     variation       1444
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374412941"
     variation       1448
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142215231"
     variation       1477
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371534652"
     exon            1506..1664
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1568
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200864528"
     variation       1574
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146397482"
     variation       1597
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138494965"
     variation       1613
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191944826"
     variation       1614
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368845976"
     variation       1658
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371781556"
     variation       1662
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377302405"
     exon            1665..1835
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1710
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746779"
     variation       1715
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377623985"
     variation       1794
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374219801"
     variation       1818
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200328990"
     exon            1836..2021
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       1847
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370349092"
     variation       1850
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374313513"
     variation       1883
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369048158"
     variation       1905
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187408244"
     variation       1911
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150626171"
     variation       1932
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376521370"
     variation       1934
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370969982"
     exon            2022..2216
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       2033
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201409151"
     variation       2174
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368212477"
     variation       2214
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142055253"
     exon            2217..2444
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       2220
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367971232"
     variation       2264
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61740835"
     variation       2279
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200890079"
     variation       2288
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376477504"
     variation       2308
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202240629"
     variation       2310
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116868322"
     variation       2321
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377096915"
     variation       2355
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200892824"
     variation       2356
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202183336"
     variation       2366
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200162055"
     variation       2384
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375382998"
     variation       2399
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369412186"
     variation       2436
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372613683"
     variation       2437
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375639275"
     exon            2445..2957
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       2461
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377491251"
     variation       2464
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186600964"
     variation       2477
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61743943"
     variation       2496
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368143350"
     variation       2530
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370649260"
     variation       2552
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61742628"
     variation       2573
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374908110"
     variation       2648
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367576294"
     variation       2678
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148305489"
     variation       2784
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372761655"
     variation       2793
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377315858"
     variation       2812
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368815709"
     variation       2828
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372104350"
     variation       2832
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8180870"
     variation       2850..2851
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35530274"
     variation       2850
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376400216"
     variation       2857
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373049285"
     variation       2888
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369363208"
     variation       2927
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189804470"
     exon            2958..3179
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       2959
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371433810"
     variation       3012
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201564680"
     variation       3084
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377281608"
     variation       3098
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140010464"
     variation       3128
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375061729"
     variation       3132
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367980353"
     variation       3153
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370442842"
     variation       3167
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369180028"
     variation       3170
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374799375"
     exon            3180..3461
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       3196
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374327276"
     variation       3204
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199769669"
     variation       3250
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61730244"
     variation       3351
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201403112"
     variation       3352
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199650087"
     variation       3354
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61730174"
     variation       3359
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371406451"
     variation       3427
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150275906"
     variation       3428
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192407933"
     variation       3431
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138966292"
     variation       3443
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184775299"
     exon            3462..3779
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       3523
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377595539"
     variation       3528
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201740952"
     variation       3561
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4728137"
     variation       3573
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371133316"
     variation       3628
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189812175"
     variation       3638
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368597564"
     variation       3649
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372024334"
     variation       3677
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56979796"
     variation       3706
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143918184"
     variation       3710
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2270590"
     variation       3714
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374969434"
     variation       3715
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368985899"
     variation       3719
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201209390"
     variation       3740
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371393598"
     variation       3741
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376829002"
     exon            3780..3886
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       3782
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369256399"
     variation       3793
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180873354"
     variation       3802
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199887952"
     variation       3872
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376488298"
     variation       3875
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370532020"
     exon            3887..4221
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /inference="alignment:Splign:1.39.8"
     variation       4027
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146581806"
     STS             4049..4179
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /standard_name="D7S2100E"
                     /db_xref="UniSTS:39686"
     variation       4150
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184242384"
     variation       4205
                     /gene="CCDC136"
                     /gene_synonym="NAG6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188901467"
ORIGIN      
agcctcttcttcactggctcccgccctctttcagtcttggccctctcctccctgtccccccggactaaatacgcacaccccctctttctttctgtgcaagcaagagggtcctggaacagcgggttctgaggaggctgggaggcagggctgagaggtggccgagagagaggagtcgcagagccgccagagtgagtcaggcacctccactgggattacagatcccagagcctcgaggagctggaagacatgtccccttctttcctctgcaccccagcccgcagccagccccccaccccccagcccctcctttctccctgctctcaggacccacagtgaccactctaggctcctatgaggcttccgagggctgtgagaggaagaagggccaacgctgggggtccctggaacgacgggggatgcaagctatggagggggaggtgttactcccagctctctatgaggaggaagaggaagaggaagaggaggaagaagaggtggaagaagaagaagaacaagtgcagaaaggtggcagtgttggctctctgtcagtcaacaagcaccggggactgagcctcacggagacagagctggaggagctgcgggctcaggtgctgcagctggtggcagaactggaggagacccgggaactggcagggcagcatgaggatgactccttggagctacaggggctcctggaggatgaacggctagccagcgcccagcaggcagaggtgttcaccaagcagatccagcagctccaaggtgagctgcgttctctacgggaggagatttccctgttagagcatgagaaagaaagcgaacttaaggaaatagaacaggaattgcatttggcccaggctgagatccagagtctgcggcaagcagcagaggattccgcaactgaacatgagagtgacatagcatccctgcaggaggatctctgccggatgcagaatgaacttgaagacatggaacgcattcggggagattatgagatggagatcgcctccctccgtgcagaaatggaaatgaagagctctgaaccatccggtagtttaggtctctcagattactctgggttacaagaagaactgcaggagctgcgggaacgctaccatttcctgaatgaggaataccgggccctgcaggagagcaacagcagcctcacggggcagcttgcagatctggagagtgagaggacacagagagcaacagagagatggctgcagtcccaaacactgagtatgacgtcagcagagtctcagacttcagaaatggatttcttagagcctgatcctgaaatgcagttgttacggcagcagctacgggatgctgaagagcagatgcatggcatgaagaacaagtgtcaggaattgtgttgtgagttggaagagctacagcatcatcgccaggtcagtgaggaggagcagaggcggctgcagagggagctcaagtgtgctcagaatgaggtgcttcggtttcagacctcccacagtgtcacccagaatgaggagctgaagtccagactctgtaccctgcagaaaaaatatgatactagccaggatgagcagaacgagctcttgaagatgcagctgcaacttcagactgagctccggcagctcaaagtcatgaaatccacacttgtagaaaaccagagtgagaaggagttactgtgccggctgcagaagctgcacctccagcaccagaacgtcacatgtgagaaggaaaagctgctggaacggcagcagcagctgcaggaggagctgcagtgccatgaggcagagctgcagcacctcagggatacggtggcctccttcaaagagagcaatgagaaggacacagagacgcacgctcagcttcaggagatgaagcagctgtaccaggccagcaaggacgagctggagcggcagaagcacatgtatgaccagctggagcaggacctcctgctctgccagctggagctgaaagagctcaaggcctcccaccccattccggaggacaaaggaaagtgtgctaataagtgtgacacactgctgtccagactgacagaattgcaggaaaagtacaaggccagccagaaggagatggggcagctgcagatggagcagtgtgagctcctggaggatcagaggaggatgcaggaggagcagggccagctgcaggaagagctgcacaggctcacactgccactgccaaagagtggcctcttactcaagagtcaggagctactcaccaagttagaagacctgtgtgagctgcagctgctctaccaaggcatgcaggaggaacagaagaagctgatacagaaccaagactgtgtattaaaagaacaattagagatccacgaagagctgcgacgtttcaaagagtctcatttccaggaagtgttggagaatcccgatgattccaaattggctaagtcctccaaatgtaatcgaaacaagcaatccaagctgctcatggagcagatgcaggccctgcaggtgatgtatgacgccggtcaggcgaagcaggagctcttgcagcaagagcaagggaggctcctagaggagcggaagaggctgcaggcagacttgcagctctgcctggaagaaatgcagctgcttcaagtccagtccccttctataaaaatgagccttgagtcctacgggaagagctatggtagcatggtccccagcaatgagaactgtcgcaagacttatgataccactgtggatgacaatgagagctattacaagagttacaccagcacccagaccagcagcaagagctttctcaagagctatgacagcagcaccagtgccagtgaggcctatgggaagagttactgcactaccagcaacagcagcattacctataagaagagttacggcagcaccagtagctctgacacctgccagaagagttttgtcagcagctgcactgacgaggaacctgctgagcctgaagacatggagcgctttgaggaaatggttgtgaaagtgctgatcaagctgcaggcggtgcaggccatgtaccagataagccaggaggaacacagccagctgcaagagcagatggaaaagttactggccaagcagaaagacctgaaggaagagctggatgcctgtgaaagggagttcaaggagtgcatggaatgccttgaaaagcccatggccccccagaacgacaagaatgagatcaaagaactgcagaccaagctgcgggagctgcagctgcaataccaggctagcatggatgagcaggggcggcttctggtagtgcaggagcagctggaggggcagctgcagtgctgccaggaggagctccgccagctcagggagaagaggccttctgttgtcaaagaagcccgggggaagaatgctaataagaacatgaacaagaatgccaatggggttaaaatgaaaaaggtgaccaagccatgctcggatacttctgagagcgaccttgagaccagaaagagtctggaggtagtgctgtactacaaggccagccagaggaaattagatggactagcaaaagaggaggaaaagaaagaggagatggaggaggaaaaaaaggaagtgaaagaggaagcaaaggagcagtgtggggatgagctagttgctgagccagcagatcctgaggaagctaaatccacagaagatcaggaggaaaatgaagaggacaaagaggaagaggagaaggaagaagacagtgaagaggaggaggatgacgccgactcttcccttgaaagtcccgaagaaaataaccccctcagactttccgagagcaaaaagtcatcccctacccccaatccccccatcttctccttgcctcttgtaggcctggtggtcatctcggctttgctctggtgctggtgggctgagacgtcgtcctaatgcagaacatgtttgggttgtggaagcctatggtattcttggctattgcagctgtggctctgtatgtgttacccaacatgcgacagcaggagtcagagttctgcctcatggagtgatggcagaccttggccagcgcgagggcagatccccagtggccaccaccctcagctttgggcaggacacactgtgccagaaccctccccatatgttccatgtgtccccatctcctcagcctcagtcacccaggctgaaaaggcttgtggggagcggctgacttccatctcctgccttgtgtaagaacctgagttccttgtaattaaatatcaactgaattacatga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:64753 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA
            GeneID:64753 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.