GGRNA | NM_022476.2

LOCUS       NM_022476               2193 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens AKT interacting protein (AKTIP), transcript variant 2,
            mRNA.
ACCESSION   NM_022476
VERSION     NM_022476.2  GI:61743931
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2193)
  AUTHORS   Anandharaj,A., Cinghu,S., Kim,W.D., Yu,J.R. and Park,W.Y.
  TITLE     Fused Toes Homolog modulates radiation cytotoxicity in uterine
            cervical cancer cells
  JOURNAL   Mol. Biol. Rep. 38 (8), 5361-5370 (2011)
   PUBMED   21424602
  REMARK    GeneRIF: Targeted inhibition of FTS led to the shutdown of key
            elemental characteristics of cervical cancer and could lead to an
            effective therapeutic strategy.
REFERENCE   2  (bases 1 to 2193)
  AUTHORS   Cinghu,S., Anandharaj,A., Lee,H.C., Yu,J.R. and Park,W.Y.
  TITLE     FTS (fused toes homolog) a novel oncoprotein involved in uterine
            cervical carcinogenesis and a potential diagnostic marker for
            cervical cancer
  JOURNAL   J. Cell. Physiol. 226 (6), 1564-1572 (2011)
   PUBMED   20945372
  REMARK    GeneRIF: These data unraveled the involvement of new oncoprotein
            FTS in cervical cancer which plays a central role in
            carcinogenesis.
REFERENCE   3  (bases 1 to 2193)
  AUTHORS   Notaridou,M., Quaye,L., Dafou,D., Jones,C., Song,H., Hogdall,E.,
            Kjaer,S.K., Christensen,L., Hogdall,C., Blaakaer,J., McGuire,V.,
            Wu,A.H., Van Den Berg,D.J., Pike,M.C., Gentry-Maharaj,A.,
            Wozniak,E., Sher,T., Jacobs,I.J., Tyrer,J., Schildkraut,J.M.,
            Moorman,P.G., Iversen,E.S., Jakubowska,A., Medrek,K., Lubinski,J.,
            Ness,R.B., Moysich,K.B., Lurie,G., Wilkens,L.R., Carney,M.E.,
            Wang-Gohrke,S., Doherty,J.A., Rossing,M.A., Beckmann,M.W.,
            Thiel,F.C., Ekici,A.B., Chen,X., Beesley,J., Gronwald,J.,
            Fasching,P.A., Chang-Claude,J., Goodman,M.T., Chenevix-Trench,G.,
            Berchuck,A., Pearce,C.L., Whittemore,A.S., Menon,U., Pharoah,P.D.,
            Gayther,S.A. and Ramus,S.J.
  CONSRTM   Australian Ovarian Cancer Study Group/Australian Cancer Study
            (Ovarian Cancer); Ovarian Cancer Association Consortium
  TITLE     Common alleles in candidate susceptibility genes associated with
            risk and development of epithelial ovarian cancer
  JOURNAL   Int. J. Cancer 128 (9), 2063-2074 (2011)
   PUBMED   20635389
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 2193)
  AUTHORS   Magno,L.A., Miranda,D.M., Neves,F.S., Pimenta,G.J., Mello,M.P., De
            Marco,L.A., Correa,H. and Romano-Silva,M.A.
  TITLE     Association between AKT1 but not AKTIP genetic variants and
            increased risk for suicidal behavior in bipolar patients
  JOURNAL   Genes Brain Behav. 9 (4), 411-418 (2010)
   PUBMED   20132317
  REMARK    GeneRIF: Demographic and clinical characteristics and AKT1 single
            markers and haplotypes, but not AKTIP polymorphisms or interactions
            between AKT1 and AKTIP, are associated with increased risk for
            suicidal behavior in bipolar patients.
REFERENCE   5  (bases 1 to 2193)
  AUTHORS   Quaye,L., Dafou,D., Ramus,S.J., Song,H., Gentry-Maharaj,A.,
            Notaridou,M., Hogdall,E., Kjaer,S.K., Christensen,L., Hogdall,C.,
            Easton,D.F., Jacobs,I., Menon,U., Pharoah,P.D. and Gayther,S.A.
  TITLE     Functional complementation studies identify candidate genes and
            common genetic variants associated with ovarian cancer survival
  JOURNAL   Hum. Mol. Genet. 18 (10), 1869-1878 (2009)
   PUBMED   19270026
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
            Erratum:[Hum Mol Genet. 2009 Aug 1;18(15):2928. Maharaj, Aleksandra
            Gentry [corrected to Gentry-Maharaj, Aleksandra]]
REFERENCE   6  (bases 1 to 2193)
  AUTHORS   Stelzl,U., Worm,U., Lalowski,M., Haenig,C., Brembeck,F.H.,
            Goehler,H., Stroedicke,M., Zenkner,M., Schoenherr,A., Koeppen,S.,
            Timm,J., Mintzlaff,S., Abraham,C., Bock,N., Kietzmann,S.,
            Goedde,A., Toksoz,E., Droege,A., Krobitsch,S., Korn,B.,
            Birchmeier,W., Lehrach,H. and Wanker,E.E.
  TITLE     A human protein-protein interaction network: a resource for
            annotating the proteome
  JOURNAL   Cell 122 (6), 957-968 (2005)
   PUBMED   16169070
REFERENCE   7  (bases 1 to 2193)
  AUTHORS   Remy,I. and Michnick,S.W.
  TITLE     Regulation of apoptosis by the Ft1 protein, a new modulator of
            protein kinase B/Akt
  JOURNAL   Mol. Cell. Biol. 24 (4), 1493-1504 (2004)
   PUBMED   14749367
  REMARK    GeneRIF: Ft1 protein interacts directly with PKB, enhancing the
            phosphorylation of both of its regulatory sites by promoting its
            interaction with the upstream kinase PDK1
REFERENCE   8  (bases 1 to 2193)
  AUTHORS   Lesche,R. and Ruther,U.
  TITLE     Close linkage of p130 and Ft1 is conserved among mammals
  JOURNAL   Mamm. Genome 9 (3), 253-255 (1998)
   PUBMED   9501314
REFERENCE   9  (bases 1 to 2193)
  AUTHORS   Lesche,R., Peetz,A., van der Hoeven,F. and Ruther,U.
  TITLE     Ft1, a novel gene related to ubiquitin-conjugating enzymes, is
            deleted in the Fused toes mouse mutation
  JOURNAL   Mamm. Genome 8 (12), 879-883 (1997)
   PUBMED   9383278
REFERENCE   10 (bases 1 to 2193)
  AUTHORS   Aiyar,N., Rand,K., Elshourbagy,N.A., Zeng,Z., Adamou,J.E.,
            Bergsma,D.J. and Li,Y.
  TITLE     A cDNA encoding the calcitonin gene-related peptide type 1 receptor
  JOURNAL   J. Biol. Chem. 271 (19), 11325-11329 (1996)
   PUBMED   8626685
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BI545474.1, AK023320.1,
            AC007342.6 and BG568989.1.
            On Mar 24, 2005 this sequence version replaced gi:11968026.
            
            Summary: The mouse homolog of this gene produces fused toes and
            thymic hyperplasia in heterozygous mutant animals while homozygous
            mutants die in early development. This gene may play a role in
            apoptosis as these morphological abnormalities are caused by
            altered patterns of programmed cell death. The protein encoded by
            this gene is similar to the ubiquitin ligase domain of other
            ubiquitin-conjugating enzymes but lacks the conserved cysteine
            residue that enables those enzymes to conjugate ubiquitin to the
            target protein. This protein interacts directly with
            serine/threonine kinase protein kinase B (PKB)/Akt and modulates
            PKB activity by enhancing the phosphorylation of PKB's regulatory
            sites. Alternative splicing results in two transcript variants
            encoding the same protein. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) uses an alternate splice site
            in the 5' UTR compared to variant 1. Variants 1 and 2 encode the
            same protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK023320.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-35                BI545474.1         14-48
            36-1692             AK023320.1         17-1673
            1693-2067           AC007342.6         28204-28578
            2068-2193           BG568989.1         384-509
FEATURES             Location/Qualifiers
     source          1..2193
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16q12.2"
     gene            1..2193
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="AKT interacting protein"
                     /db_xref="GeneID:64400"
                     /db_xref="HGNC:16710"
                     /db_xref="HPRD:07467"
                     /db_xref="MIM:608483"
     exon            1..112
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            113..224
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    156..158
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="upstream in-frame stop codon"
     CDS             183..1061
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="fused toes protein homolog; fused toes homolog"
                     /codon_start=1
                     /product="AKT-interacting protein"
                     /protein_id="NP_071921.1"
                     /db_xref="GI:11968027"
                     /db_xref="CCDS:CCDS10749.1"
                     /db_xref="GeneID:64400"
                     /db_xref="HGNC:16710"
                     /db_xref="HPRD:07467"
                     /db_xref="MIM:608483"
                     /translation="

MNPFWSMSTSSVRKRSEGEEKTLTGDVKTSPPRTAPKKQLPSIPKNALPITKPTSPAPAAQSTNGTHASYGPFYLEYSLLAEFTLVVKQKLPGVYVQPSYRSALMWFGVIFIRHGLYQDGVFKFTVYIPDNYPDGDCPRLVFDIPVFHPLVDPTSGELDVKRAFAKWRRNHNHIWQVLMYARRVFYKIDTASPLNPEAAVLYEKDIQLFKSKVVDSVKVCTARLFDQPKIEDPYAISFSPWNPSVHDEAREKMLTQKKPEEQHNKSVHVAGLSWVKPGSVQPFSKEEKTVAT

"
     misc_feature    417..848
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="Ubiquitin-conjugating enzyme E2, catalytic domain
                     homologues; Region: UBCc; smart00212"
                     /db_xref="CDD:197575"
     misc_feature    order(579..584,687..692)
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="E3 interaction residues; other site"
                     /db_xref="CDD:29157"
     misc_feature    order(615..620,630..635,639..641,654..656,660..665,
                     681..686,693..695,711..713,720..722,729..731,738..743,
                     747..749,753..758)
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /note="Ub thioester intermediate interaction residues;
                     other site"
                     /db_xref="CDD:29157"
     exon            225..430
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            431..495
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            496..596
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            597..685
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            686..784
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            785..892
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            893..953
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     exon            954..2193
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /inference="alignment:Splign:1.39.8"
     variation       1083
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2892438"
     variation       1143
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3956281"
     STS             1169..1311
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /standard_name="RH94082"
                     /db_xref="UniSTS:89039"
     variation       1249
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4002162"
     variation       1319..1322
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /replace=""
                     /replace="agta"
                     /db_xref="dbSNP:4002163"
     STS             1514..1710
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /standard_name="RH75186"
                     /db_xref="UniSTS:84678"
     polyA_signal    1750..1755
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
     variation       1752
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4002164"
     polyA_signal    1758..1763
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
     polyA_site      1783
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_signal    2070..2075
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
     polyA_site      2090
                     /gene="AKTIP"
                     /gene_synonym="FT1; FTS"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN

ggggtggggcggggcggggatcaagcaggggcagggctggcgctgcggcgggagatgctgtcgggccgcggcggcgcttggcagccaggagctctgcattgaaggcactggggtaaagtgaatgccgaagacagaagatttggatgatacaccactgactttctttgtttggaatacacgttatgaaccctttctggagcatgtctacaagctctgtacgcaaacgatctgaaggtgaagagaagacattaacaggggacgtgaaaaccagtcctccacgaactgcaccaaagaaacagctgccttctattcccaaaaatgctttgcccataactaagcctacatctcctgccccagcagcacagtcaacaaatggcacgcatgcgtcctatggacccttctacctggaatactctcttcttgcagaatttaccttggttgtgaagcagaagctaccaggcgtctatgtgcagccatcttatcgctctgcattaatgtggtttggagtaatattcatacggcatggactttaccaagatggcgtatttaagtttacagtttacatccctgataactatccagatggtgactgtccacgcttggtgttcgatattcctgtctttcacccgctagttgatcccacctcaggtgagctggatgtgaagagagcatttgcaaaatggaggcggaaccataatcatatttggcaggtattaatgtatgcaaggagagttttctacaagattgatacagcaagccccctgaacccagaggctgcagtactgtatgaaaaagatattcagctttttaaaagtaaagttgttgacagtgttaaggtgtgcactgctcgtttgtttgaccaacctaaaatagaagacccctatgcaattagcttttctccatggaatccttctgtacatgatgaagccagagaaaagatgctgactcagaaaaagcctgaagaacagcacaataaaagtgttcatgttgctggcctgtcatgggtaaagcctggctcagtacagcctttcagtaaagaagagaaaacagtggcgacttaagagatggtgaatctggtgcaccatgcactttcctgctagactctggcctagttcaagctgaccaatggcagaggactgcctgaagagtaaaactgtgtgaacaatgactgactgccagtgttttccatgtatgcataggttctaacagcagggtttggaaacctgtctctaagtaatgcattacttctgtcagaagtgtcttagggtggttatctagttcagtactccaaattattggggaccttgaggcttaagtaagtatttttctgaatataatgctaaaggtaagttgcattcatttaaactaatagagcagacagaattcagcactacttaatagtttataaatcagtggtttcagttgtatatatgttaggaaatggagaggtatagagagagcaggttccatagctcagcacttttaagtggaagatcatttgaatctcagtcttcagcctgcactgatttgtagcctgcactgtcttactgatttacaaactgaaatcactgagaaatgtctttagttcagtgagaagaaaccagaacacttgttcctagtgttgtgttgttttttttaagcaaattacttactgtatttttatggcaggagggagaaaaagtgttacaacggtttctaatgaagtccggtatttaaatgataaatgactaatgtgtttagtagagacaaaataaaccaataaatgattgttctttgccatttatgcaggaaactacccttttctcaatataaccaaacaaaggctaatttataaatgctttattgaaaaatacacttatcttcatataaaattacagtagcagtatcttgagaagttttataaatatttttgcagaacactattctaattgaacaatgtaagttccatatttctctcagcaatatgaagttacctagtaactttgtttatactgattcaatttacaattgaattttctccctaataagattattaatttgacttgaaaactgctggaacaatagtgattaataaagatatgtatagataattcagctgttaaataacattttctaatttgtataaatggtactatggtactaataaaaacctaaattctccaaccaatttttttaaactgccaggaacaccca

//

Annotations: