GGRNA Home | Help | Advanced search

2020-10-26 19:51:48, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_022356               2696 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens leucine proline-enriched proteoglycan (leprecan) 1
            (LEPRE1), transcript variant 1, mRNA.
ACCESSION   NM_022356
VERSION     NM_022356.3  GI:186928834
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2696)
  AUTHORS   Cabral,W.A., Barnes,A.M., Adeyemo,A., Cushing,K., Chitayat,D.,
            Porter,F.D., Panny,S.R., Gulamali-Majid,F., Tishkoff,S.A.,
            Rebbeck,T.R., Gueye,S.M., Bailey-Wilson,J.E., Brody,L.C.,
            Rotimi,C.N. and Marini,J.C.
  TITLE     A founder mutation in LEPRE1 carried by 1.5% of West Africans and
            0.4% of African Americans causes lethal recessive osteogenesis
            imperfecta
  JOURNAL   Genet. Med. 14 (5), 543-551 (2012)
   PUBMED   22281939
  REMARK    GeneRIF: 0.4% of Mid-Atlantic African Americans and 1.48% West
            Africans carry mutation in LEPRE1 which causes lethal recessive
            osteogenesis imperfecta.
REFERENCE   2  (bases 1 to 2696)
  AUTHORS   Zhang,Z.L., Zhang,H., Ke,Y.H., Yue,H., Xiao,W.J., Yu,J.B., Gu,J.M.,
            Hu,W.W., Wang,C., He,J.W. and Fu,W.Z.
  TITLE     The identification of novel mutations in COL1A1, COL1A2, and LEPRE1
            genes in Chinese patients with osteogenesis imperfecta
  JOURNAL   J. Bone Miner. Metab. 30 (1), 69-77 (2012)
   PUBMED   21667357
  REMARK    GeneRIF: Mutation analyses were performed for COL1A1, COL1A2,
            CRTAP, and LEPRE1 in a cohort of 58 unrelated Chinese patients with
            osteogenesis imperfecta.
REFERENCE   3  (bases 1 to 2696)
  AUTHORS   Takagi,M., Ishii,T., Barnes,A.M., Weis,M., Amano,N., Tanaka,M.,
            Fukuzawa,R., Nishimura,G., Eyre,D.R., Marini,J.C. and Hasegawa,T.
  TITLE     A novel mutation in LEPRE1 that eliminates only the KDEL ER-
            retrieval sequence causes non-lethal osteogenesis imperfecta
  JOURNAL   PLoS ONE 7 (5), E36809 (2012)
   PUBMED   22615817
  REMARK    GeneRIF: This is the first report of a mutation in LEPRE1 that
            eliminates only the KDEL ER-retrieval sequence, whereas other
            functional domains remain intact
REFERENCE   4  (bases 1 to 2696)
  AUTHORS   van Dijk,F.S., Nikkels,P.G., den Hollander,N.S., Nesbitt,I.M., van
            Rijn,R.R., Cobben,J.M. and Pals,G.
  TITLE     Lethal/severe osteogenesis imperfecta in a large family: a novel
            homozygous LEPRE1 mutation and bone histological findings
  JOURNAL   Pediatr. Dev. Pathol. 14 (3), 228-234 (2011)
   PUBMED   20946018
  REMARK    GeneRIF: We report a large consanguineous Turkish family in which
            multiple individuals are affected with autosomal recessive lethal
            or severe osteogenesis imperfecta (OI) due to a novel homozygous
            LEPRE1 mutation
REFERENCE   5  (bases 1 to 2696)
  AUTHORS   Marini,J.C., Cabral,W.A. and Barnes,A.M.
  TITLE     Null mutations in LEPRE1 and CRTAP cause severe recessive
            osteogenesis imperfecta
  JOURNAL   Cell Tissue Res. 339 (1), 59-70 (2010)
   PUBMED   19862557
  REMARK    GeneRIF: Null mutations in LEPRE1 and CRTAP cause severe recessive
            osteogenesis imperfecta.
            Review article
REFERENCE   6  (bases 1 to 2696)
  AUTHORS   Willaert,A., Malfait,F., Symoens,S., Gevaert,K., Kayserili,H.,
            Megarbane,A., Mortier,G., Leroy,J.G., Coucke,P.J. and De Paepe,A.
  TITLE     Recessive osteogenesis imperfecta caused by LEPRE1 mutations:
            clinical documentation and identification of the splice form
            responsible for prolyl 3-hydroxylation
  JOURNAL   J. Med. Genet. 46 (4), 233-241 (2009)
   PUBMED   19088120
  REMARK    GeneRIF: Findings suggest that the 3-hydroxylation function of P3H1
            is restricted to the 736AA splice form.
REFERENCE   7  (bases 1 to 2696)
  AUTHORS   Foster,L.J., Rudich,A., Talior,I., Patel,N., Huang,X.,
            Furtado,L.M., Bilan,P.J., Mann,M. and Klip,A.
  TITLE     Insulin-dependent interactions of proteins with GLUT4 revealed
            through stable isotope labeling by amino acids in cell culture
            (SILAC)
  JOURNAL   J. Proteome Res. 5 (1), 64-75 (2006)
   PUBMED   16396496
REFERENCE   8  (bases 1 to 2696)
  AUTHORS   Vranka,J.A., Sakai,L.Y. and Bachinger,H.P.
  TITLE     Prolyl 3-hydroxylase 1, enzyme characterization and identification
            of a novel family of enzymes
  JOURNAL   J. Biol. Chem. 279 (22), 23615-23621 (2004)
   PUBMED   15044469
REFERENCE   9  (bases 1 to 2696)
  AUTHORS   Kaul,S.C., Sugihara,T., Yoshida,A., Nomura,H. and Wadhwa,R.
  TITLE     Gros1, a potential growth suppressor on chromosome 1: its identity
            to basement membrane-associated proteoglycan, leprecan
  JOURNAL   Oncogene 19 (32), 3576-3583 (2000)
   PUBMED   10951563
REFERENCE   10 (bases 1 to 2696)
  AUTHORS   Wassenhove-McCarthy,D.J. and McCarthy,K.J.
  TITLE     Molecular characterization of a novel basement membrane-associated
            proteoglycan, leprecan
  JOURNAL   J. Biol. Chem. 274 (35), 25004-25017 (1999)
   PUBMED   10455179
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC098484.2, AK027697.1 and
            R67284.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Apr 29, 2008 this sequence version replaced gi:21361917.
            
            Summary: This gene encodes an enzyme that is a member of the
            collagen prolyl hydroxylase family. These enzymes are localized to
            the endoplasmic reticulum and their activity is required for proper
            collagen synthesis and assembly. Mutations in this gene are
            associated with osteogenesis imperfecta type VIII. Three
            alternatively spliced transcript variants encoding different
            isoforms have been described. Other variants may exist, but their
            biological validity has not been determined. [provided by RefSeq,
            Aug 2011].
            
            Transcript Variant: This variant (1) differs in the 3' UTR and
            coding sequence compared to variant 3. The resulting isoform (1)
            has a shorter and distinct C-terminus compared to isoform 3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF097432.1, AK027697.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-61                AC098484.2         115002-115062       c
            62-2580             AK027697.1         1-2519
            2581-2581           AC098484.2         94418-94418         c
            2582-2646           AK027697.1         2521-2585
            2647-2696           R67284.1           1-50                c
FEATURES             Location/Qualifiers
     source          1..2696
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p34.1"
     gene            1..2696
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /note="leucine proline-enriched proteoglycan (leprecan) 1"
                     /db_xref="GeneID:64175"
                     /db_xref="HGNC:19316"
                     /db_xref="MIM:610339"
     exon            1..578
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     CDS             114..2324
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /EC_number="1.14.11.7"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; prolyl 3-hydroxylase 1; growth suppressor 1;
                     leprecan; leucine- and proline-enriched proteoglycan 1"
                     /codon_start=1
                     /product="prolyl 3-hydroxylase 1 isoform 1 precursor"
                     /protein_id="NP_071751.3"
                     /db_xref="GI:186928835"
                     /db_xref="CCDS:CCDS472.2"
                     /db_xref="GeneID:64175"
                     /db_xref="HGNC:19316"
                     /db_xref="MIM:610339"
                     /translation="
MAVRALKLLTTLLAVVAAASQAEVESEAGWGMVTPDLLFAEGTAAYARGDWPGVVLSMERALRSRAALRALRLRCRTQCAADFPWELDPDWSPSPAQASGAAALRDLSFFGGLLRRAACLRRCLGPPAAHSLSEEMELEFRKRSPYNYLQVAYFKINKLEKAVAAAHTFFVGNPEHMEMQQNLDYYQTMSGVKEADFKDLETQPHMQEFRLGVRLYSEEQPQEAVPHLEAALQEYFVAYEECRALCEGPYDYDGYNYLEYNADLFQAITDHYIQVLNCKQNCVTELASHPSREKPFEDFLPSHYNYLQFAYYNIGNYTQAVECAKTYLLFFPNDEVMNQNLAYYAAMLGEEHTRSIGPRESAKEYRQRSLLEKELLFFAYDVFGIPFVDPDSWTPEEVIPKRLQEKQKSERETAVRISQEIGNLMKEIETLVEEKTKESLDVSRLTREGGPLLYEGISLTMNSKLLNGSQRVVMDGVISDHECQELQRLTNVAATSGDGYRGQTSPHTPNEKFYGVTVFKALKLGQEGKVPLQSAHLYYNVTEKVRRIMESYFRLDTPLYFSYSHLVCRTAIEEVQAERKDDSHPVHVDNCILNAETLVCVKEPPAYTFRDYSAILYLNGDFDGGNFYFTELDAKTVTAEVQPQCGRAVGFSSGTENPHGVKAVTRGQRCAIALWFTLDPRHSERDRVQADDLVKMLFSPEEMDLSQEQPLDAQQGPPEPAQESLSGSESKPKDEL
"
     sig_peptide     114..179
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Potential; propagated from UniProtKB/Swiss-Prot
                     (Q32P28.2)"
     mat_peptide     180..2321
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /product="Prolyl 3-hydroxylase 1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2)"
     misc_feature    216..317
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2);
                     Region: TPR 1"
     misc_feature    540..641
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2);
                     Region: TPR 2"
     misc_feature    726..827
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2);
                     Region: TPR 3"
     misc_feature    1014..1115
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2);
                     Region: TPR 4"
     misc_feature    1548..2144
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /note="Prolyl 4-hydroxylase alpha subunit homologues;
                     Region: P4Hc; smart00702"
                     /db_xref="CDD:197834"
     misc_feature    1848..2144
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /note="2OG-Fe(II) oxygenase superfamily; Region:
                     2OG-FeII_Oxy_3; pfam13640"
                     /db_xref="CDD:205817"
     misc_feature    2310..2321
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q32P28.2);
                     Region: Prevents secretion from ER (Potential)"
     exon            579..731
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            732..921
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            922..1053
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1054..1193
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1194..1283
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1284..1336
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1337..1458
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1459..1586
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     STS             1531..1682
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /standard_name="LEPRE1"
                     /db_xref="UniSTS:503225"
     exon            1587..1682
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1683..1833
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1834..1951
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            1952..2027
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            2028..2168
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     exon            2169..2686
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /inference="alignment:Splign:1.39.8"
     STS             2306..2592
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /standard_name="SHGC-74679"
                     /db_xref="UniSTS:74729"
     STS             2334..2467
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /standard_name="D1S3562"
                     /db_xref="UniSTS:56354"
     variation       2480
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3180453"
     variation       2581
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6882"
     polyA_signal    2623..2628
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
     polyA_site      2647
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
     polyA_site      2686
                     /gene="LEPRE1"
                     /gene_synonym="GROS1; OI8; P3H1"
ORIGIN      
atgcgccgcccggcttggaaggtggggcttcgcccgggggcgggccttcgccgggggtaggactccggccttggtggcgggtggctggcggttccgttaggtctgagggagcgatggcggtacgcgcgttgaagctgctgaccacactgctggctgtcgtggccgctgcctcccaagccgaggtcgagtccgaggcaggatggggcatggtgacgcctgatctgctcttcgccgaggggaccgcagcctacgcgcgcggggactggcccggggtggtcctgagcatggaacgggcgctgcgctcccgggcagccctccgcgcccttcgcctgcgctgccgcacccagtgtgccgccgacttcccgtgggagctggaccccgactggtcccccagcccggcccaggcctcgggcgccgccgccctgcgcgacctgagcttcttcgggggccttctgcgtcgcgctgcctgcctgcgccgctgcctcgggccgccggccgcccactcgctcagcgaagagatggagctggagttccgcaagcggagcccctacaactacctgcaggtcgcctacttcaagatcaacaagttggagaaagctgttgctgcagcacacaccttcttcgtgggcaatcctgagcacatggaaatgcagcagaacctagactattaccaaaccatgtctggagtgaaggaggccgacttcaaggatcttgagactcaaccccatatgcaagaatttcgactgggagtgcgactctactcagaggaacagccacaggaagctgtgccccacctagaggcggcgctgcaagaatactttgtggcctatgaggagtgccgtgccctctgcgaagggccctatgactacgatggctacaactaccttgagtacaacgctgacctcttccaggccatcacagatcattacatccaggtcctcaactgtaagcagaactgtgtcacggagcttgcttcccacccaagtcgagagaagccctttgaagacttcctcccatcgcattataattatctgcagtttgcctactataacattgggaattatacacaggctgttgaatgtgccaagacctatcttctcttcttccccaatgacgaggtgatgaaccaaaatttggcctattatgcagctatgcttggagaagaacacaccagatccatcggcccccgtgagagtgccaaggagtaccgacagcgaagcctactggaaaaagaactgcttttcttcgcttatgatgtttttggaattccctttgtggatccggattcatggactccagaagaagtgattcccaagagattgcaagagaaacagaagtcagaacgggaaacagccgtacgcatctcccaggagattgggaaccttatgaaggaaatcgagacccttgtggaagagaagaccaaggagtcactggatgtgagcagactgacccgggaaggtggccccctgctgtatgaaggcatcagtctcaccatgaactccaaactcctgaatggttcccagcgggtggtgatggacggcgtaatctctgaccacgagtgtcaggagctgcagagactgaccaatgtggcagcaacctcaggagatggctaccggggtcagacctccccacatactcccaatgaaaagttctatggtgtcactgtcttcaaagccctcaagctggggcaagaaggcaaagttcctctgcagagtgcccacctgtactacaacgtgacggagaaggtgcggcgcatcatggagtcctacttccgcctggatacgcccctctacttttcctactctcatctggtgtgccgcactgccatcgaagaggtccaggcagagaggaaggatgatagtcatccagtccacgtggacaactgcatcctgaatgccgagaccctcgtgtgtgtcaaagagcccccagcctacaccttccgcgactacagcgccatcctttacctaaatggggacttcgatggcggaaacttttatttcactgaactggatgccaagaccgtgacggcagaggtgcagcctcagtgtggaagagccgtgggattctcttcaggcactgaaaacccacatggagtgaaggctgtcaccagggggcagcgctgtgccatcgccctgtggttcaccctggaccctcgacacagcgagcgggacagggtgcaggcagatgacctggtgaagatgctcttcagcccagaagagatggacctctcccaggagcagcccctggatgcccagcagggcccccccgaacctgcacaagagtctctctcaggcagtgaatcgaagcccaaggatgagctatgacagcgtccaggtcagacggatgggtgactagacccatggagaggaactcttctgcactctgagctggccagcccctcggggctgcagagcagtgagcctacatctgccactcagccgaggggaccctgctcacagccttctacatggtgctactgctcttggagtggacatgaccagacaccgcaccccctggatctggctgagggctcaggacacaggcccagccacccccaggggcctccacaggccgctgcatgacagcgatacagtacttaagtgtctgtgtagacaaccaaagaataaatgattcatggttttttttacttggtttgttcagacaatggaaatttgcccattctgtcaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:64175 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:64175 -> Molecular function: GO:0005506 [iron ion binding] evidence: IEA
            GeneID:64175 -> Molecular function: GO:0016702 [oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen] evidence: IEA
            GeneID:64175 -> Molecular function: GO:0019797 [procollagen-proline 3-dioxygenase activity] evidence: IEA
            GeneID:64175 -> Molecular function: GO:0031418 [L-ascorbic acid binding] evidence: IEA
            GeneID:64175 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: NAS
            GeneID:64175 -> Biological process: GO:0016049 [cell growth] evidence: IEA
            GeneID:64175 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:64175 -> Biological process: GO:0030199 [collagen fibril organization] evidence: IEA
            GeneID:64175 -> Biological process: GO:0030278 [regulation of ossification] evidence: IEA
            GeneID:64175 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:64175 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: IEA
            GeneID:64175 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:64175 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_071751 -> EC 1.14.11.7

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.