Home |
Help |
Advanced search
2024-04-26 00:09:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021973 2368 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens heart and neural crest derivatives expressed 2
(HAND2), mRNA.
ACCESSION NM_021973
VERSION NM_021973.2 GI:88999597
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2368)
AUTHORS Martinelli,M., Girardi,A., Farinella,F., Carinci,F., Pezzetti,F.,
Caramelli,E. and Scapoli,L.
TITLE No evidence of HAND2 involvement in nonsyndromic cleft lip with or
without cleft palate
JOURNAL Clin Oral Investig 16 (2), 619-623 (2012)
PUBMED 21431856
REMARK GeneRIF: No evidence of linkage between HAND2 and CL/P was
obtained. Levelss of exclusion were obtained with different
inheritance models. results did not support HAND2 in CL/P
REFERENCE 2 (bases 1 to 2368)
AUTHORS Vincentz,J.W., VanDusen,N.J., Fleming,A.B., Rubart,M.,
Firulli,B.A., Howard,M.J. and Firulli,A.B.
TITLE A Phox2- and Hand2-dependent Hand1 cis-regulatory element reveals a
unique gene dosage requirement for Hand2 during sympathetic
neurogenesis
JOURNAL J. Neurosci. 32 (6), 2110-2120 (2012)
PUBMED 22323723
REMARK GeneRIF: Expression analyses on both Hand2 conditionally null and
hypomorphic backgrounds demonstrate that Hand2 is required for
reporter activation in a gene dosage-dependent manner during
sympathetic neurogenesis.
REFERENCE 3 (bases 1 to 2368)
AUTHORS Huyen,D.V. and Bany,B.M.
TITLE Evidence for a conserved function of heart and neural crest
derivatives expressed transcript 2 in mouse and human
decidualization
JOURNAL Reproduction 142 (2), 353-368 (2011)
PUBMED 21527398
REMARK GeneRIF: Data suggest Hand2 plays an important role in
decidualization; expression of Hand2 is significantly increased in
response to prostaglandin E2.
REFERENCE 4 (bases 1 to 2368)
AUTHORS Barnes,R.M., Firulli,B.A., VanDusen,N.J., Morikawa,Y., Conway,S.J.,
Cserjesi,P., Vincentz,J.W. and Firulli,A.B.
TITLE Hand2 loss-of-function in Hand1-expressing cells reveals distinct
roles in epicardial and coronary vessel development
JOURNAL Circ. Res. 108 (8), 940-949 (2011)
PUBMED 21350214
REMARK GeneRIF: Hand2 performs an essential role during transgenic
epicardialization, directly impacting epicardial cell
differentiation and formation of the coronary vasculature.
REFERENCE 5 (bases 1 to 2368)
AUTHORS Pellegrino,M.J., Parrish,D.C., Zigmond,R.E. and Habecker,B.A.
TITLE Cytokines inhibit norepinephrine transporter expression by
decreasing Hand2
JOURNAL Mol. Cell. Neurosci. 46 (3), 671-680 (2011)
PUBMED 21241805
REMARK GeneRIF: These data suggest that cytokines can inhibit
norepinephrine transporter expression through downregulation of
Hand2 or Gata3 in cultured sympathetic neurons, but axotomy in
adult animals selectively suppresses Hand2 expression.
REFERENCE 6 (bases 1 to 2368)
AUTHORS McFadden,D.G., Charite,J., Richardson,J.A., Srivastava,D.,
Firulli,A.B. and Olson,E.N.
TITLE A GATA-dependent right ventricular enhancer controls dHAND
transcription in the developing heart
JOURNAL Development 127 (24), 5331-5341 (2000)
PUBMED 11076755
REFERENCE 7 (bases 1 to 2368)
AUTHORS Firulli,B.A., Hadzic,D.B., McDaid,J.R. and Firulli,A.B.
TITLE The basic helix-loop-helix transcription factors dHAND and eHAND
exhibit dimerization characteristics that suggest complex
regulation of function
JOURNAL J. Biol. Chem. 275 (43), 33567-33573 (2000)
PUBMED 10924525
REFERENCE 8 (bases 1 to 2368)
AUTHORS Srivastava,D.
TITLE HAND proteins: molecular mediators of cardiac development and
congenital heart disease
JOURNAL Trends Cardiovasc. Med. 9 (1-2), 11-18 (1999)
PUBMED 10189962
REMARK Review article
REFERENCE 9 (bases 1 to 2368)
AUTHORS Russell,M.W., Kemp,P., Wang,L., Brody,L.C. and Izumo,S.
TITLE Molecular cloning of the human HAND2 gene
JOURNAL Biochim. Biophys. Acta 1443 (3), 393-399 (1998)
PUBMED 9878849
REFERENCE 10 (bases 1 to 2368)
AUTHORS Firulli,A.B., McFadden,D.G., Lin,Q., Srivastava,D. and Olson,E.N.
TITLE Heart and extra-embryonic mesodermal defects in mouse embryos
lacking the bHLH transcription factor Hand1
JOURNAL Nat. Genet. 18 (3), 266-270 (1998)
PUBMED 9500550
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC093849.2.
On Feb 28, 2006 this sequence version replaced gi:12545383.
Summary: The protein encoded by this gene belongs to the basic
helix-loop-helix family of transcription factors. This gene product
is one of two closely related family members, the HAND proteins,
which are asymmetrically expressed in the developing ventricular
chambers and play an essential role in cardiac morphogenesis.
Working in a complementary fashion, they function in the formation
of the right ventricle and aortic arch arteries, implicating them
as mediators of congenital heart disease. In addition, this
transcription factor plays an important role in limb and branchial
arch development. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: FJ226608.1, BX404434.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1493 AC093849.2 137257-138749 c
1494-2368 AC093849.2 135023-135897 c
FEATURES Location/Qualifiers
source 1..2368
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4q33"
gene 1..2368
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="heart and neural crest derivatives expressed 2"
/db_xref="GeneID:9464"
/db_xref="HGNC:4808"
/db_xref="HPRD:03872"
/db_xref="MIM:602407"
exon 1..1493
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/inference="alignment:Splign:1.39.8"
variation 286
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="a"
/replace="c"
/db_xref="dbSNP:199527389"
misc_feature 570..572
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="upstream in-frame stop codon"
STS 849..1677
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/db_xref="UniSTS:482963"
CDS 939..1592
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="basic helix-loop-helix transcription factor HAND2;
class A basic helix-loop-helix protein 26; deciduum,
heart, autonomic nervous system and neural crest
derivatives-expressed protein 2"
/codon_start=1
/product="heart- and neural crest derivatives-expressed
protein 2"
/protein_id="NP_068808.1"
/db_xref="GI:12545384"
/db_xref="CCDS:CCDS3819.1"
/db_xref="GeneID:9464"
/db_xref="HGNC:4808"
/db_xref="HPRD:03872"
/db_xref="MIM:602407"
/translation="
MSLVGGFPHHPVVHHEGYPFAAAAAAAAAAAASRCSHEENPYFHGWLIGHPEMSPPDYSMALSYSPEYASGAAGLDHSHYGGVPPGAGPPGLGGPRPVKRRGTANRKERRRTQSINSAFAELRECIPNVPADTKLSKIKTLRLATSYIAYLMDLLAKDDQNGEAEAFKAEIKKTDVKEEKRKKELNEILKSTVSSNDKKTKGRTGWPQHVWALELKQ
"
misc_feature 1245..1406
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="Helix-loop-helix domain, found in specific DNA-
binding proteins that act as transcription factors; 60-100
amino acids long. A DNA-binding basic region is followed
by two alpha-helices separated by a variable loop region;
HLH forms homo- and heterodimers; Region: HLH; cd00083"
/db_xref="CDD:238036"
misc_feature order(1257..1265,1269..1271,1338..1340,1347..1349)
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="DNA binding region [nucleotide binding]"
/db_xref="CDD:238036"
misc_feature 1260..1262
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="E-box/N-box specificity site; other site"
/db_xref="CDD:238036"
misc_feature order(1278..1283,1290..1295,1299..1304,1350..1352,
1359..1361,1371..1373,1377..1382,1392..1394,1398..1403)
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/note="dimerization interface [polypeptide binding]; other
site"
/db_xref="CDD:238036"
STS 975..1546
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/standard_name="Hand2"
/db_xref="UniSTS:547235"
STS 1110..1579
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/standard_name="Hand2"
/db_xref="UniSTS:238134"
variation 1221
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="c"
/replace="g"
/db_xref="dbSNP:75152023"
STS 1370..1489
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/standard_name="Hand2"
/db_xref="UniSTS:478956"
exon 1494..2368
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/inference="alignment:Splign:1.39.8"
variation 1503
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="c"
/replace="t"
/db_xref="dbSNP:111068720"
variation 1532
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="c"
/replace="g"
/db_xref="dbSNP:79728781"
variation 1559
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75005999"
variation 1643
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="g"
/replace="t"
/db_xref="dbSNP:75706356"
STS 2011..2160
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/standard_name="WI-12683"
/db_xref="UniSTS:2450"
variation 2148
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
/replace="a"
/replace="c"
/db_xref="dbSNP:201780340"
polyA_site 2368
/gene="HAND2"
/gene_synonym="bHLHa26; dHand; DHAND2; Hed; Thing2"
ORIGIN
ctgtacatggagatcttgctgggaaaatccgcttgctcccctcacgtcgtccagcccaggagaaccaccgccgtcaccccggagcttcctcggccaccgcgcagagccctccgagagcccgagccgcggtcttcgagctccaaggctcattcagggccccagatccttgccccgaaaggagaggatctgagaaaatggatgcactgagacctctctgaaaaccctccgagagagcgcgagaggagcgaggacacgttactcgcagctaaaatcacatttaaggaccaaaacaacaacaaccaaaaatttcattaaaacaataagcgcccaagaacccagatcgggctggtggggggaggggaagaggcgggaaggggagggtcgcacggaggtagctttgcagtgagcagtcgaccccgccgccccccggcacagctggaccggctcctccagccgcggctcagactcgcccctggattccgggttagcttcggtgccaggaccgcggcccgggcttggattcccgagactccgcgtaccagcctcgcgggagccccggcacctttgtatgagcacgagaggattctgcctccgcgcagcagcccgggaagcaggagccgaagcgcgggccgtggagcaaggcgggaaccggaggcggcggcggcggcggccaggggcgcacggtgccaggaccagctcgccgcgccccatggggagccggcggccgcagcgctgctgaggcgggcccggctggccaggcggggggacggggcccgggctgcagcagccccctctgcggctgccgggcgggcccgggcgcccgggggctggggggtggggggtgggggaggacgccgagcgctgaggcaggggcccgggccgagggcgcggcggggctgcgcgcacgctggggcgcgtggaggggcgcggagggcgaaatgagtctggtaggtggttttccccaccacccggtggtgcaccacgagggctacccgtttgccgccgccgccgccgcagctgccgccgccgccgccagccgctgcagccatgaggagaacccctacttccatggctggctcatcggccaccccgagatgtcgccccccgactacagcatggccctgtcctacagccccgagtatgccagcggcgccgccggcctggaccactcccattacgggggggtgccgccgggcgccgggcccccgggcctgggggggccgcgcccggtgaagcgccgaggcaccgccaaccgcaaggagcggcgcaggactcagagcatcaacagcgccttcgccgaactgcgcgagtgcatccccaacgtacccgccgacaccaaactctccaaaatcaagaccctgcgcctggccaccagctacatcgcctacctcatggacctgctggccaaggacgaccagaatggcgaggcggaggccttcaaggcagagatcaagaagaccgacgtgaaagaggagaagaggaagaaggagctgaacgaaatcttgaaaagcacagtgagcagcaacgacaagaaaaccaaaggccggacgggctggccgcagcacgtctgggccctggagctcaagcagtgaggaggaggagaaggaggaggaggagagcgcgagtgagcaggggccaaggcgccagatgcagacccaggactccggaaaagccgtccgcgctccgctctgaggactccttgcatttggaatcatccggtttatttatgtgcaatttccttcccctctctttgaccccctttgaggcatctgctccccgtctccccctccaaaaaaaaagtggatatttgaagaaaagcattccatattttaatacgaagaggacactcccgtgtggtaagggatcccgtcgtctcatagattctgtgtgcgtgaatgttccctcttggctgtgtagacaccagcgttgccccccgccaacctactcaaccccttccagataaagacagtgggcactagtgcgtttgtgaagtgtatctttaatacttggcctttggatataaatattcctgggtattataaagttttatttcaaagcagaaaacagggccgctaacatttccgttggggtcggtatctagtgctatccattcatctgtggtcgttccctctttgaagatgtttccaacagccacttgttttgtgcacttccgtcctctaaaactaaatggaatttaattaatattgaaggtgtaaacgttgtaagtattcaataaaccactgtgttttttttttacaaaaaccttaatcttttaatggctgatacctcaaaagagttttgaaaacaaagctgttatacttgttttcgtaatatttaaaatattcagaagtaaactaaattatcatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9464 -> Molecular function: GO:0000977 [RNA polymerase II regulatory region sequence-specific DNA binding] evidence: IDA
GeneID:9464 -> Molecular function: GO:0001077 [RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IDA
GeneID:9464 -> Molecular function: GO:0003680 [AT DNA binding] evidence: IDA
GeneID:9464 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: ISS
GeneID:9464 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9464 -> Molecular function: GO:0008134 [transcription factor binding] evidence: ISS
GeneID:9464 -> Molecular function: GO:0033613 [activating transcription factor binding] evidence: ISS
GeneID:9464 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: ISS
GeneID:9464 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: ISS
GeneID:9464 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IEA
GeneID:9464 -> Molecular function: GO:0070888 [E-box binding] evidence: IDA
GeneID:9464 -> Molecular function: GO:0070888 [E-box binding] evidence: ISS
GeneID:9464 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:0001701 [in utero embryonic development] evidence: ISS
GeneID:9464 -> Biological process: GO:0001947 [heart looping] evidence: ISS
GeneID:9464 -> Biological process: GO:0001967 [suckling behavior] evidence: IEA
GeneID:9464 -> Biological process: GO:0003007 [heart morphogenesis] evidence: ISS
GeneID:9464 -> Biological process: GO:0003219 [cardiac right ventricle formation] evidence: IEA
GeneID:9464 -> Biological process: GO:0003253 [cardiac neural crest cell migration involved in outflow tract morphogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:0003266 [regulation of secondary heart field cardioblast proliferation] evidence: ISS
GeneID:9464 -> Biological process: GO:0003357 [noradrenergic neuron differentiation] evidence: NAS
GeneID:9464 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: ISS
GeneID:9464 -> Biological process: GO:0006915 [apoptotic process] evidence: ISS
GeneID:9464 -> Biological process: GO:0007507 [heart development] evidence: NAS
GeneID:9464 -> Biological process: GO:0007512 [adult heart development] evidence: IEP
GeneID:9464 -> Biological process: GO:0010463 [mesenchymal cell proliferation] evidence: IEA
GeneID:9464 -> Biological process: GO:0010667 [negative regulation of cardiac muscle cell apoptotic process] evidence: ISS
GeneID:9464 -> Biological process: GO:0014032 [neural crest cell development] evidence: ISS
GeneID:9464 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: IEA
GeneID:9464 -> Biological process: GO:0042733 [embryonic digit morphogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:0043392 [negative regulation of DNA binding] evidence: IEA
GeneID:9464 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:9464 -> Biological process: GO:0043586 [tongue development] evidence: IEA
GeneID:9464 -> Biological process: GO:0045668 [negative regulation of osteoblast differentiation] evidence: IEA
GeneID:9464 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: ISS
GeneID:9464 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:9464 -> Biological process: GO:0048485 [sympathetic nervous system development] evidence: IEA
GeneID:9464 -> Biological process: GO:0048538 [thymus development] evidence: ISS
GeneID:9464 -> Biological process: GO:0048935 [peripheral nervous system neuron development] evidence: IEA
GeneID:9464 -> Biological process: GO:0060021 [palate development] evidence: IEA
GeneID:9464 -> Biological process: GO:0060536 [cartilage morphogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:0060982 [coronary artery morphogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:0061032 [visceral serous pericardium development] evidence: IEA
GeneID:9464 -> Biological process: GO:0061309 [cardiac neural crest cell development involved in outflow tract morphogenesis] evidence: ISS
GeneID:9464 -> Biological process: GO:0061325 [cell proliferation involved in outflow tract morphogenesis] evidence: IEA
GeneID:9464 -> Biological process: GO:2000679 [positive regulation of transcription regulatory region DNA binding] evidence: IDA
GeneID:9464 -> Biological process: GO:2000763 [positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process] evidence: ISS
GeneID:9464 -> Biological process: GO:2000764 [positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis] evidence: ISS
GeneID:9464 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA
GeneID:9464 -> Cellular component: GO:0005667 [transcription factor complex] evidence: ISS
GeneID:9464 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.