GGRNA Home | Help | Advanced search

2020-10-24 06:46:51, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_021872               3578 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens cell division cycle 25B (CDC25B), transcript variant
            3, mRNA.
ACCESSION   NM_021872
VERSION     NM_021872.2  GI:47078251
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3578)
  AUTHORS   Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H.
  TITLE     Indirubin, an acting component of indigo naturalis, inhibits EGFR
            activation and EGF-induced CDC25B gene expression in epidermal
            keratinocytes
  JOURNAL   J. Dermatol. Sci. 67 (2), 140-146 (2012)
   PUBMED   22721997
  REMARK    GeneRIF: Indirubin, an acting component of indigo naturalis,
            inhibits EGFR activation and EGF-induced CDC25B gene expression in
            epidermal ke
REFERENCE   2  (bases 1 to 3578)
  AUTHORS   Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z.
  TITLE     Knockdown of Cdc25B in renal cell carcinoma is associated with
            decreased malignant features
  JOURNAL   Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012)
   PUBMED   22631674
  REMARK    GeneRIF: downregulation of Cdc25B resulted in slower growth, more
            G2/M cells, weaker capacity for migration and invasion and
            induction of apoptosis in renal carcinoma cell line 769-P
            transfectants; findings suggest an important role of Cdc25B in
            renal cell carcinoma development
REFERENCE   3  (bases 1 to 3578)
  AUTHORS   Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B.,
            Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and
            Tannapfel,A.
  TITLE     MicroRNA-148a is down-regulated in human pancreatic ductal
            adenocarcinomas and regulates cell survival by targeting CDC25B
  JOURNAL   Lab. Invest. 91 (10), 1472-1479 (2011)
   PUBMED   21709669
  REMARK    GeneRIF: We identified CDC25B as novel miR-148a target which may
            confer a proliferative advantage in pancreatic ductal
            adenocarcinomas.
REFERENCE   4  (bases 1 to 3578)
  AUTHORS   Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O.,
            Ducommun,B. and Bouche,J.P.
  TITLE     Study of the docking-dependent PLK1 phosphorylation of the CDC25B
            phosphatase
  JOURNAL   Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011)
   PUBMED   21640712
  REMARK    GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This
            study illustrates the complexity of the phosphorylation pattern and
            of the subsequent regulation of CDC25B activity.
REFERENCE   5  (bases 1 to 3578)
  AUTHORS   Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M.,
            Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K.,
            Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M.
  TITLE     Transcriptional repression of Cdc25B by IER5 inhibits the
            proliferation of leukemic progenitor cells through NF-YB and p300
            in acute myeloid leukemia
  JOURNAL   PLoS ONE 6 (11), E28011 (2011)
   PUBMED   22132193
  REMARK    GeneRIF: Transcriptional repression mediated by IER5 regulates
            Cdc25B expression levels via the release of NF-YB and p300 in acute
            myeloid leukemia.
REFERENCE   6  (bases 1 to 3578)
  AUTHORS   Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B.
  TITLE     Alternative splicing of the human CDC25B tyrosine phosphatase.
            Possible implications for growth control?
  JOURNAL   Oncogene 14 (20), 2485-2495 (1997)
   PUBMED   9188863
REFERENCE   7  (bases 1 to 3578)
  AUTHORS   Conklin,D.S., Galaktionov,K. and Beach,D.
  TITLE     14-3-3 proteins associate with cdc25 phosphatases
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995)
   PUBMED   7644510
REFERENCE   8  (bases 1 to 3578)
  AUTHORS   Galaktionov,K. and Beach,D.
  TITLE     Specific activation of cdc25 tyrosine phosphatases by B-type
            cyclins: evidence for multiple roles of mitotic cyclins
  JOURNAL   Cell 67 (6), 1181-1194 (1991)
   PUBMED   1836978
REFERENCE   9  (bases 1 to 3578)
  AUTHORS   Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H.
  TITLE     An additional homolog of the fission yeast cdc25+ gene occurs in
            humans and is highly expressed in some cancer cells
  JOURNAL   New Biol. 3 (10), 959-968 (1991)
   PUBMED   1662986
REFERENCE   10 (bases 1 to 3578)
  AUTHORS   Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A.,
            Sadhu,K., Russell,P. and Doree,M.
  TITLE     Dephosphorylation and activation of a p34cdc2/cyclin B complex in
            vitro by human CDC25 protein
  JOURNAL   Nature 351 (6323), 242-245 (1991)
   PUBMED   1828290
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK092713.1, BC051711.1,
            S78187.1, Z68092.1 and BX640836.1.
            On May 7, 2004 this sequence version replaced gi:11641410.
            
            Summary: CDC25B is a member of the CDC25 family of phosphatases.
            CDC25B activates the cyclin dependent kinase CDC2 by removing two
            phosphate groups and it is required for entry into mitosis. CDC25B
            shuttles between the nucleus and the cytoplasm due to nuclear
            localization and nuclear export signals. The protein is nuclear in
            the M and G1 phases of the cell cycle and moves to the cytoplasm
            during S and G2. CDC25B has oncogenic properties, although its role
            in tumor formation has not been determined. Multiple transcript
            variants for this gene exist. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (3), also known as CDC25B2, lacks
            an alternate in-frame exon, compared to variant 1, resulting in a
            shorter protein (isoform 3) compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: Z68092.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025095 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-86                AK092713.1         16-101
            87-556              BC051711.1         6-475
            557-745             S78187.1           19-207
            746-2520            Z68092.1           69-1843
            2521-2922           BC051711.1         2564-2965
            2923-3543           BX640836.1         1984-2604
            3544-3578           S78187.1           3084-3118
FEATURES             Location/Qualifiers
     source          1..3578
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20p13"
     gene            1..3578
                     /gene="CDC25B"
                     /note="cell division cycle 25B"
                     /db_xref="GeneID:994"
                     /db_xref="HGNC:1726"
                     /db_xref="HPRD:00307"
                     /db_xref="MIM:116949"
     exon            1..978
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       69
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183999341"
     variation       158
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11569978"
     variation       251
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374054731"
     misc_feature    470..472
                     /gene="CDC25B"
                     /note="upstream in-frame stop codon"
     variation       568
                     /gene="CDC25B"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6116042"
     variation       662
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13038734"
     variation       665..666
                     /gene="CDC25B"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:11462398"
     variation       666..667
                     /gene="CDC25B"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:71678223"
     variation       772
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11087603"
     variation       775
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372029025"
     CDS             779..2398
                     /gene="CDC25B"
                     /EC_number="3.1.3.48"
                     /note="isoform 3 is encoded by transcript variant 3;
                     M-phase inducer phosphatase 2; dual specificity
                     phosphatase Cdc25B"
                     /codon_start=1
                     /product="M-phase inducer phosphatase 2 isoform 3"
                     /protein_id="NP_068658.1"
                     /db_xref="GI:11641411"
                     /db_xref="CCDS:CCDS13066.1"
                     /db_xref="GeneID:994"
                     /db_xref="HGNC:1726"
                     /db_xref="HPRD:00307"
                     /db_xref="MIM:116949"
                     /translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSETPKSQVGTLLFRSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
"
     misc_feature    1115..1807
                     /gene="CDC25B"
                     /note="M-phase inducer phosphatase; Region:
                     M-inducer_phosp; pfam06617"
                     /db_xref="CDD:115287"
     misc_feature    1616..1618
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:06119"
     misc_feature    1712..1714
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:04066"
     misc_feature    1889..2248
                     /gene="CDC25B"
                     /note="Cdc25 phosphatases are members of the Rhodanese
                     Homology Domain superfamily. They activate the cell
                     division kinases throughout the cell cycle progression.
                     Cdc25 phosphatases dephosphorylate phosphotyrosine and
                     phosphothreonine residues, in order to...; Region: Cdc25;
                     cd01530"
                     /db_xref="CDD:29093"
     misc_feature    2114..2134
                     /gene="CDC25B"
                     /note="oxyanion binding site; other site"
                     /db_xref="CDD:29093"
     misc_feature    2114..2116
                     /gene="CDC25B"
                     /note="active site residue [active]"
                     /db_xref="CDD:29093"
     variation       820
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11569979"
     variation       838
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375122468"
     variation       889
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368274446"
     variation       953
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372183442"
     variation       965
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145700972"
     variation       973
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373847564"
     exon            979..1106
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       984
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373910055"
     variation       1014
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202156665"
     variation       1017
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76772959"
     variation       1023
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146567070"
     variation       1031
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141031701"
     variation       1038
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375803588"
     variation       1039
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370072424"
     variation       1063
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201619391"
     variation       1069
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374599445"
     variation       1078
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147311787"
     variation       1081
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368877264"
     variation       1091
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199501910"
     exon            1107..1158
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1126
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371577332"
     variation       1149
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376436608"
     variation       1150
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148241851"
     variation       1154
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141382375"
     variation       1156
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139123058"
     variation       1158
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370155414"
     exon            1159..1200
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1159
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150375046"
     variation       1187
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137919521"
     variation       1188
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143386679"
     variation       1197
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143369164"
     exon            1201..1237
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1212
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111654983"
     variation       1220
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147172963"
     variation       1221
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371528141"
     variation       1228
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61755298"
     variation       1231
                     /gene="CDC25B"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368675680"
     variation       1232
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140433155"
     variation       1237
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201436986"
     exon            1238..1360
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1242
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202155757"
     variation       1286
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368042199"
     variation       1307
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142459784"
     variation       1325
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200968688"
     exon            1361..1495
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1363..1364
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35741868"
     variation       1367
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111545759"
     variation       1376
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202222511"
     variation       1377
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201435494"
     variation       1419
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151315259"
     variation       1431
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372916640"
     variation       1432
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375854669"
     variation       1433
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202059655"
     variation       1437
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139531565"
     variation       1490
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373171092"
     exon            1496..1576
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1511
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144187197"
     variation       1565
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201902192"
     variation       1575..1576
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35824153"
     exon            1577..1753
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1582
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145108436"
     variation       1600
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200104998"
     variation       1613
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141314132"
     variation       1620
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375465349"
     variation       1625
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371407165"
     variation       1637
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149795416"
     variation       1643
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376224294"
     variation       1686
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369403610"
     variation       1687
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372954698"
     variation       1690
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61746575"
     variation       1707
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376488245"
     variation       1708
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2228465"
     exon            1754..1849
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1762
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143612466"
     variation       1765
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570010"
     variation       1770
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374005977"
     variation       1805
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376924240"
     variation       1808
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371158244"
     variation       1823
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138180783"
     exon            1850..1912
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1873
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371343744"
     exon            1913..2011
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1922
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2228464"
     variation       1929
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376914644"
     variation       1930
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146556613"
     variation       1949
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199832947"
     exon            2012..2145
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2036
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377681163"
     variation       2037
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138651339"
     variation       2039
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61742036"
     variation       2041
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570015"
     variation       2044
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141229949"
     variation       2069
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370128666"
     variation       2071
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056720"
     variation       2073
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61755297"
     variation       2113
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374888909"
     variation       2137
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149394412"
     variation       2141
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199659921"
     variation       2142
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200957584"
     exon            2146..2257
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2227
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146399677"
     variation       2251
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143897481"
     exon            2258..3552
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2272
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374526361"
     variation       2297
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11570019"
     variation       2341
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368410035"
     variation       2354
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371947700"
     variation       2361
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:514523"
     variation       2362
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:514521"
     variation       2381
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369357260"
     variation       2394
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200551395"
     variation       2407
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371951429"
     variation       2417
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372117595"
     variation       2436
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375603041"
     variation       2462
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41279402"
     variation       2463
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2229592"
     variation       2526
                     /gene="CDC25B"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201707296"
     variation       2609
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570020"
     variation       2620
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368742502"
     variation       2631
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139271260"
     variation       2639
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:55732615"
     variation       2668
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189019990"
     variation       2748
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6052085"
     variation       2768
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11087604"
     variation       2774
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11087605"
     variation       2842
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635163"
     variation       2883..2884
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35980638"
     variation       2896
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570021"
     STS             2967..3303
                     /gene="CDC25B"
                     /standard_name="D20S1012"
                     /db_xref="UniSTS:32857"
     variation       3037
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181412320"
     variation       3064..3085
                     /gene="CDC25B"
                     /replace=""
                     /replace="tacccactcggtcccagttttg"
                     /db_xref="dbSNP:71331068"
     variation       3065..3086
                     /gene="CDC25B"
                     /replace=""
                     /replace="acccactcggtcccagttttgt"
                     /db_xref="dbSNP:11570022"
     variation       3073
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11570023"
     variation       3135
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367792437"
     variation       3282
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186687615"
     variation       3357
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1803263"
     STS             3404..3528
                     /gene="CDC25B"
                     /standard_name="SHGC-30160"
                     /db_xref="UniSTS:79344"
     variation       3427
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8156"
     variation       3471
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3516"
     polyA_signal    3527..3532
                     /gene="CDC25B"
     polyA_site      3548
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      3552
                     /gene="CDC25B"
ORIGIN      
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagcgaaaccccaaagagtcaggtagggaccctgctcttccgcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS
            GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
            GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS
            GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA
            GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
            GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA
            GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA
            GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
            GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP
            GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS
            GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA
            GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP
            GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA
            GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
            GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS
            GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_068658 -> EC 3.1.3.48

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.