2024-04-20 15:25:13, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_020996 744 bp mRNA linear PRI 15-JUN-2013 DEFINITION Homo sapiens fibroblast growth factor 6 (FGF6), mRNA. ACCESSION NM_020996 VERSION NM_020996.1 GI:10337586 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 744) AUTHORS Jia,W.H., Zhang,B., Matsuo,K., Shin,A., Xiang,Y.B., Jee,S.H., Kim,D.H., Ren,Z., Cai,Q., Long,J., Shi,J., Wen,W., Yang,G., Delahanty,R.J., Ji,B.T., Pan,Z.Z., Matsuda,F., Gao,Y.T., Oh,J.H., Ahn,Y.O., Park,E.J., Li,H.L., Park,J.W., Jo,J., Jeong,J.Y., Hosono,S., Casey,G., Peters,U., Shu,X.O., Zeng,Y.X. and Zheng,W. CONSRTM Colon Cancer Family Registry (CCFR); Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) TITLE Genome-wide association analyses in East Asians identify new susceptibility loci for colorectal cancer JOURNAL Nat. Genet. 45 (2), 191-196 (2013) PUBMED 23263487 REFERENCE 2 (bases 1 to 744) AUTHORS Bosetti,M., Leigheb,M., Brooks,R.A., Boccafoschi,F. and Cannas,M.F. TITLE Regulation of osteoblast and osteoclast functions by FGF-6 JOURNAL J. Cell. Physiol. 225 (2), 466-471 (2010) PUBMED 20458746 REMARK GeneRIF: These data demonstrate that FGF-6 may be considered a regulator of bone metabolism as shown by its activity on both osteoblasts and osteoclasts. REFERENCE 3 (bases 1 to 744) AUTHORS Kestenbaum,B., Glazer,N.L., Kottgen,A., Felix,J.F., Hwang,S.J., Liu,Y., Lohman,K., Kritchevsky,S.B., Hausman,D.B., Petersen,A.K., Gieger,C., Ried,J.S., Meitinger,T., Strom,T.M., Wichmann,H.E., Campbell,H., Hayward,C., Rudan,I., de Boer,I.H., Psaty,B.M., Rice,K.M., Chen,Y.D., Li,M., Arking,D.E., Boerwinkle,E., Coresh,J., Yang,Q., Levy,D., van Rooij,F.J., Dehghan,A., Rivadeneira,F., Uitterlinden,A.G., Hofman,A., van Duijn,C.M., Shlipak,M.G., Kao,W.H., Witteman,J.C., Siscovick,D.S. and Fox,C.S. TITLE Common genetic variants associate with serum phosphorus concentration JOURNAL J. Am. Soc. Nephrol. 21 (7), 1223-1232 (2010) PUBMED 20558539 REFERENCE 4 (bases 1 to 744) AUTHORS Moffa,A.B. and Ethier,S.P. TITLE Differential signal transduction of alternatively spliced FGFR2 variants expressed in human mammary epithelial cells JOURNAL J. Cell. Physiol. 210 (3), 720-731 (2007) PUBMED 17133345 REFERENCE 5 (bases 1 to 744) AUTHORS Zhang,X., Ibrahimi,O.A., Olsen,S.K., Umemori,H., Mohammadi,M. and Ornitz,D.M. TITLE Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family JOURNAL J. Biol. Chem. 281 (23), 15694-15700 (2006) PUBMED 16597617 REFERENCE 6 (bases 1 to 744) AUTHORS Vainikka,S., Partanen,J., Bellosta,P., Coulier,F., Birnbaum,D., Basilico,C., Jaye,M. and Alitalo,K. TITLE Fibroblast growth factor receptor-4 shows novel features in genomic structure, ligand binding and signal transduction JOURNAL EMBO J. 11 (12), 4273-4280 (1992) PUBMED 1385111 REMARK Erratum:[EMBO J 1993 Feb;12(2):810] REFERENCE 7 (bases 1 to 744) AUTHORS Iida,S., Yoshida,T., Naito,K., Sakamoto,H., Katoh,O., Hirohashi,S., Sato,T., Onda,M., Sugimura,T. and Terada,M. TITLE Human hst-2 (FGF-6) oncogene: cDNA cloning and characterization JOURNAL Oncogene 7 (2), 303-309 (1992) PUBMED 1549352 REFERENCE 8 (bases 1 to 744) AUTHORS Coulier,F., Batoz,M., Marics,I., de Lapeyriere,O. and Birnbaum,D. TITLE Putative structure of the FGF6 gene product and role of the signal peptide JOURNAL Oncogene 6 (8), 1437-1444 (1991) PUBMED 1886714 REFERENCE 9 (bases 1 to 744) AUTHORS Dionne,C.A., Crumley,G., Bellot,F., Kaplow,J.M., Searfoss,G., Ruta,M., Burgess,W.H., Jaye,M. and Schlessinger,J. TITLE Cloning and expression of two distinct high-affinity receptors cross-reacting with acidic and basic fibroblast growth factors JOURNAL EMBO J. 9 (9), 2685-2692 (1990) PUBMED 1697263 REFERENCE 10 (bases 1 to 744) AUTHORS Marics,I., Adelaide,J., Raybaud,F., Mattei,M.G., Coulier,F., Planche,J., de Lapeyriere,O. and Birnbaum,D. TITLE Characterization of the HST-related FGF.6 gene, a new member of the fibroblast growth factor gene family JOURNAL Oncogene 4 (3), 335-340 (1989) PUBMED 2649847 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from X63454.1. Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene displayed oncogenic transforming activity when transfected into mammalian cells. The mouse homolog of this gene exhibits a restricted expression profile predominantly in the myogenic lineage, which suggested a role in muscle regeneration or differentiation. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X63454.1, BC121097.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025084, ERS025088 [ECO:0000350] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..744 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="12" /map="12p13" gene 1..744 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="fibroblast growth factor 6" /db_xref="GeneID:2251" /db_xref="HGNC:3684" /db_xref="HPRD:00623" /db_xref="MIM:134921" STS 1..721 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /db_xref="UniSTS:480860" exon 1..390 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /inference="alignment:Splign:1.39.8" STS 12..691 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /db_xref="UniSTS:482119" STS 17..738 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /db_xref="UniSTS:490467" misc_feature 30..32 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="upstream in-frame stop codon" CDS 45..671 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="FGF-6; HST-2; HSTF-2; heparin-binding growth factor 6; heparin secretory-transforming protein 2" /codon_start=1 /product="fibroblast growth factor 6 precursor" /protein_id="NP_066276.2" /db_xref="GI:15147343" /db_xref="CCDS:CCDS8527.1" /db_xref="GeneID:2251" /db_xref="HGNC:3684" /db_xref="HPRD:00623" /db_xref="MIM:134921" /translation="
MALGQKLFITMSRGAGRLQGTLWALVFLGILVGMVVPSPAGTRANNTLLDSRGWGTLLSRSRAGLAGEIAGVNWESGYLVGIKRQRRLYCNVGIGFHLQVLPDGRISGTHEENPYSLLEISTVERGVVSLFGVRSALFVAMNSKGRLYATPSFQEECKFRETLLPNNYNAYESDLYQGTYIALSKYGRVKRGSKVSPIMTVTHFLPRI
" sig_peptide 45..155 /gene="FGF6" /gene_synonym="HBGF-6; HST2" misc_feature 75..77 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /experiment="experimental evidence, no additional details recorded" /note="Region: alternative start codon" misc_feature 144..146 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /experiment="experimental evidence, no additional details recorded" /note="Region: alternative start codon" mat_peptide 156..638 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /product="fibroblast growth factor 6" misc_feature 300..668 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="Acidic and basic fibroblast growth factor family; FGFs are mitogens, which stimulate growth or differentiation of cells of mesodermal or neuroectodermal origin. The family plays essential roles in patterning and differentiation during vertebrate...; Region: FGF; cd00058" /db_xref="CDD:28940" misc_feature order(300..302,309..311,405..407,411..413,417..419, 501..503,525..527,534..551,555..557,651..653,657..659, 663..665) /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="receptor interaction site; other site" /db_xref="CDD:28940" misc_feature order(594..599,612..614,624..626,642..644) /gene="FGF6" /gene_synonym="HBGF-6; HST2" /note="heparin binding site (glycine box) [chemical binding]; other site" /db_xref="CDD:28940" variation 119 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:17183515" variation 232 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:17183529" exon 391..494 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /inference="alignment:Splign:1.39.8" variation 410 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:2241279" variation 461 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:2241280" exon 495..744 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /inference="alignment:Splign:1.39.8" variation 615 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:17183778" variation 691 /gene="FGF6" /gene_synonym="HBGF-6; HST2" /replace="c" /replace="t" /db_xref="dbSNP:2241286" ORIGIN
tttagggccattaattctgaccacgtgcctgagaggcaaggtggatggccctgggacagaaactgttcatcactatgtcccggggagcaggacgtctgcagggcacgctgtgggctctcgtcttcctaggcatcctagtgggcatggtggtgccctcgcctgcaggcacccgtgccaacaacacgctgctggactcgaggggctggggcaccctgctgtccaggtctcgcgcggggctagctggagagattgccggggtgaactgggaaagtggctatttggtggggatcaagcggcagcggaggctctactgcaacgtgggcatcggctttcacctccaggtgctccccgacggccggatcagcgggacccacgaggagaacccctacagcctgctggaaatttccactgtggagcgaggcgtggtgagtctctttggagtgagaagtgccctcttcgttgccatgaacagtaaaggaagattgtacgcaacgcccagcttccaagaagaatgcaagttcagagaaaccctcctgcccaacaattacaatgcctacgagtcagacttgtaccaagggacctacattgccctgagcaaatacggacgggtaaagcggggcagcaaggtgtccccgatcatgactgtcactcatttccttcccaggatctaaggacccacaaaagaaggcttacagatttaaagcatcatctgttcgattgaaattttgcaccagcgaagaattc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2251 -> Molecular function: GO:0008083 [growth factor activity] evidence: IEA GeneID:2251 -> Biological process: GO:0001502 [cartilage condensation] evidence: IEA GeneID:2251 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA GeneID:2251 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:2251 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS GeneID:2251 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:2251 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS GeneID:2251 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IGI GeneID:2251 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: IGI GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS GeneID:2251 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS GeneID:2251 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:2251 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IEA GeneID:2251 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS GeneID:2251 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: TAS GeneID:2251 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA GeneID:2251 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS GeneID:2251 -> Cellular component: GO:0005615 [extracellular space] evidence: IEA GeneID:2251 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.