GGRNA Home | Help | Advanced search

2020-10-26 19:30:03, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020943               3279 bp    mRNA    linear   PRI 19-APR-2013
DEFINITION  Homo sapiens CWC22 spliceosome-associated protein homolog (S.
            cerevisiae) (CWC22), mRNA.
ACCESSION   NM_020943 XM_034594
VERSION     NM_020943.2  GI:153792116
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3279)
  AUTHORS   Alexandrov,A., Colognori,D., Shu,M.D. and Steitz,J.A.
  TITLE     Human spliceosomal protein CWC22 plays a role in coupling splicing
            to exon junction complex deposition and nonsense-mediated decay
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (52), 21313-21318 (2012)
   PUBMED   23236153
  REMARK    GeneRIF: The essential splicing factor CWC22 has acquired functions
            in exon junction complex assembly and nonsense-mediated decay
            during evolution from single-celled to complex eukaryotes.
REFERENCE   2  (bases 1 to 3279)
  AUTHORS   Barbosa,I., Haque,N., Fiorini,F., Barrandon,C., Tomasetto,C.,
            Blanchette,M. and Le Hir,H.
  TITLE     Human CWC22 escorts the helicase eIF4AIII to spliceosomes and
            promotes exon junction complex assembly
  JOURNAL   Nat. Struct. Mol. Biol. 19 (10), 983-990 (2012)
   PUBMED   22961380
  REMARK    GeneRIF: CWC22 escorts the helicase eIF4AIII to spliceosomes and
            promotes exon junction complex assembly
REFERENCE   3  (bases 1 to 3279)
  AUTHORS   Steckelberg,A.L., Boehm,V., Gromadzka,A.M. and Gehring,N.H.
  TITLE     CWC22 connects pre-mRNA splicing and exon junction complex assembly
  JOURNAL   Cell Rep 2 (3), 454-461 (2012)
   PUBMED   22959432
  REMARK    GeneRIF: CWC22 connects pre-mRNA splicing and exon junction complex
            assembly.
REFERENCE   4  (bases 1 to 3279)
  AUTHORS   Tao,S., Wang,Z., Feng,J., Hsu,F.C., Jin,G., Kim,S.T., Zhang,Z.,
            Gronberg,H., Zheng,L.S., Isaacs,W.B., Xu,J. and Sun,J.
  TITLE     A genome-wide search for loci interacting with known prostate
            cancer risk-associated genetic variants
  JOURNAL   Carcinogenesis 33 (3), 598-603 (2012)
   PUBMED   22219177
REFERENCE   5  (bases 1 to 3279)
  AUTHORS   Lehner,B. and Sanderson,C.M.
  TITLE     A protein interaction framework for human mRNA degradation
  JOURNAL   Genome Res. 14 (7), 1315-1323 (2004)
   PUBMED   15231747
REFERENCE   6  (bases 1 to 3279)
  AUTHORS   Jurica,M.S., Licklider,L.J., Gygi,S.R., Grigorieff,N. and
            Moore,M.J.
  TITLE     Purification and characterization of native spliceosomes suitable
            for three-dimensional structural analysis
  JOURNAL   RNA 8 (4), 426-439 (2002)
   PUBMED   11991638
REFERENCE   7  (bases 1 to 3279)
  AUTHORS   Kelly,W.G., Xu,S., Montgomery,M.K. and Fire,A.
  TITLE     Distinct requirements for somatic and germline expression of a
            generally expressed Caernorhabditis elegans gene
  JOURNAL   Genetics 146 (1), 227-238 (1997)
   PUBMED   9136012
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC031216.1 and AB046824.1.
            On Jul 25, 2007 this sequence version replaced gi:55749768.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC031216.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1115              BC031216.1         1-1115
            1116-3279           AB046824.1         935-3098
FEATURES             Location/Qualifiers
     source          1..3279
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31.3"
     gene            1..3279
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /note="CWC22 spliceosome-associated protein homolog (S.
                     cerevisiae)"
                     /db_xref="GeneID:57703"
                     /db_xref="HGNC:29322"
                     /db_xref="HPRD:17220"
                     /db_xref="MIM:615186"
     exon            1..187
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     variation       108
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201574101"
     exon            188..327
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    211..213
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /note="upstream in-frame stop codon"
     CDS             301..3027
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /note="functional spliceosome-associated protein b;
                     nucampholin homolog"
                     /codon_start=1
                     /product="pre-mRNA-splicing factor CWC22 homolog"
                     /protein_id="NP_065994.1"
                     /db_xref="GI:55749769"
                     /db_xref="CCDS:CCDS46465.1"
                     /db_xref="GeneID:57703"
                     /db_xref="HGNC:29322"
                     /db_xref="HPRD:17220"
                     /db_xref="MIM:615186"
                     /translation="
MKSSVAQIKPSSGHDRRENLNSYQRNSSPEDRYEEQERSPRDRDYFDYSRSDYEHSRRGRSYDSSMESRNRDREKRRERERDTDRKRSRKSPSPGRRNPETSVTQSSSAQDEPATKKKKDELDPLLTRTGGAYIPPAKLRMMQEQITDKNSLAYQRMSWEALKKSINGLINKVNISNISIIIQELLQENIVRGRGLLSRSVLQAQSASPIFTHVYAALVAIINSKFPQIGELILKRLILNFRKGYRRNDKQLCLTASKFVAHLINQNVAHEVLCLEMLTLLLERPTDDSVEVAIGFLKECGLKLTQVSPRGINAIFERLRNILHESEIDKRVQYMIEVMFAVRKDGFKDHPIILEGLDLVEEDDQFTHMLPLEDDYNPEDVLNVFKMDPNFMENEEKYKAIKKEILDEGDTDSNTDQDAGSSEEDEEEEEEEGEEDEEGQKVTIHDKTEINLVSFRRTIYLAIQSSLDFEECAHKLLKMEFPESQTKELCNMILDCCAQQRTYEKFFGLLAGRFCMLKKEYMESFEGIFKEQYDTIHRLETNKLRNVAKMFAHLLYTDSLPWSVLECIKLSEETTTSSSRIFVKIFFQELCEYMGLPKLNARLKDETLQPFFEGLLPRDNPRNTRFAINFFTSIGLGGLTDELREHLKNTPKVIVAQKPDVEQNKSSPSSSSSASSSSESDSSDSDSDSSDSSSESSSEESDSSSISSHSSASANDVRKKGHGKTRSKEVDKLIRNQQTNDRKQKERRQEHGHQETRTERERRSEKHRDQNSSGSNWRDPITKYTSDKDVPSERNNYSRVANDRDQEMHIDLENKHGDPKKKRGERRNSFSENEKHTHRIKDSENFRRKDRSKSKEMNRKHSGSRSDEDRYQNGAERRWEKSSRYSEQSRESKKNQDRRREKSPAKQK
"
     misc_feature    481..483
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9HCG8.3); phosphorylation site"
     misc_feature    880..1335
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /note="MIF4G domain; Region: MIF4G; pfam02854"
                     /db_xref="CDD:202432"
     misc_feature    1663..1983
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /note="Domain in DAP-5, eIF4G, MA-3 and other proteins;
                     Region: MA3; smart00544"
                     /db_xref="CDD:128817"
     misc_feature    2785..2787
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9HCG8.3); phosphorylation site"
     misc_feature    2785..2787
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            328..395
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            396..506
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            507..752
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            753..881
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            882..1050
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1051..1104
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1105..1240
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1241..1447
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1448..1510
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1511..1615
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1616..1697
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1698..1758
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1759..1836
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            1837..1989
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     STS             1923..2090
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /standard_name="RH65718"
                     /db_xref="UniSTS:89307"
     exon            1990..2117
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            2118..2219
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            2220..2440
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     exon            2441..3279
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /inference="alignment:Splign:1.39.8"
     variation       2681
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046356"
     STS             2912..3059
                     /gene="CWC22"
                     /gene_synonym="EIF4GL; fSAPb; NCM"
                     /standard_name="RH102467"
                     /db_xref="UniSTS:96801"
ORIGIN      
gtggagtccccgcaggcagagacgcggagtgggggtggcgggtcgccggatcgggtgggaagtaaaagacccccaggagtgggtgcgggctcactgatacggctgtgagcggcattggagtgtgcgtgggtcttctcgctacgctcgggcccgcaagaggggtgtgagagcggctaggtccaagcaggtgatgtttgcagacagaaaaagtaaactgtcaaggaattcagagcattgggtacttgttatttggaccagtttgaagcatctttgatttattggaccaactggcaacagaaaatgaaaagtagtgtggcacagataaaaccttcttctggtcatgacagaagggaaaaccttaattcatatcagaggaactcctctccagaagacagatatgaagaacaagaacgatccccccgggatagagattactttgattacagcagatcagactatgagcattcaagaagaggacgttcttatgatagtagcatggagtcacgaaacagggaccgagaaaaacgcagagaaagagaaagagatacggatcggaaaaggtctcggaaatccccatctcctgggaggagaaacccagaaacatcagtaactcagagttcctctgctcaggatgaacctgctacaaagaaaaagaaagatgagctggatcctcttcttactcgcactggtggagcatatattccccctgcaaagctcaggatgatgcaggaacagattacagataaaaacagcttagcataccagaggatgagttgggaggccctgaagaagtcaattaatggccttatcaacaaagtcaacatttccaacataagtattattattcaagagcttcttcaagaaaatatagttagaggaagaggactgctgtccaggtctgttttgcaagcacagagtgcttctccaatcttcacccatgtttatgcagcattagtggcaattatcaactcaaaatttccacaaattggagaattaatcctcaaaaggttaattcttaattttcgaaaaggctatcgaagaaatgacaagcaactttgcctgactgcttcaaaatttgtggcgcatcttattaaccaaaatgtggcacacgaagtattatgcttagagatgctcactttgctcctggaaagaccaacagatgatagcgttgaagtagctattggttttcttaaggaatgtggcctcaaattaacacaagtgtcaccaagaggaatcaatgctatatttgaacgccttcgaaacattctgcatgagtctgaaattgacaaaagagttcaatatatgattgaagtgatgtttgctgtacggaaagatggattcaaggaccaccccattatcctagaaggtcttgatttggtggaagaagatgatcaattcactcatatgctccctctggaggatgactataatccagaagatgttcttaatgttttcaagatggatcctaattttatggagaatgaagagaagtacaaagctattaagaaagaaattcttgatgagggagatactgactcgaacacagaccaggatgctgggagtagtgaagaggacgaggaagaagaagaggaagagggagaagaagatgaagaaggacaaaaagtaactattcatgacaaaacagaaattaacctggtctcatttcgtcgtacaatttatcttgctattcagtcaagtttagattttgaagaatgtgctcacaaattgctgaaaatggagtttcctgaaagccaaacaaaagaactctgcaacatgatacttgattgctgtgcccaacagaggacatacgaaaaattttttggcttattagctgggcgattttgcatgctaaagaaagagtacatggaatcctttgaaggtatattcaaagaacagtatgataccatccatcgcttggaaacaaacaagttgcgaaatgttgctaagatgtttgctcaccttttatacactgattcacttccatggagtgttcttgaatgtataaaactgagtgaagaaaccactacatcatccagtagaatttttgtcaaaatatttttccaggaactgtgtgaatacatgggtcttcctaaacttaatgcaagattaaaggatgaaactctgcagccattctttgaaggattattaccccgagataatccaagaaacactcggtttgccatcaacttctttacttctataggtcttggaggtttaacggatgaactgcgggagcatctcaaaaatacaccaaaggtcattgtggcgcagaaaccagatgttgagcaaaataaatcctccccatcctcttcctcttcagcgtcctcctcttcagagtctgactcatccgactctgattctgacagcagtgatagcagttcagagtcttccagtgaagagagcgactcttcatccatcagtagtcatagctctgcctcagctaatgatgtaagaaagaagggacatgggaagaccagaagtaaagaggtagataaattgatcagaaaccagcaaacaaatgataggaaacaaaaagaaagaagacaagaacacgggcaccaggaaacaaggactgagagagaaagaaggtcagaaaaacacagagatcaaaattcaagtggttcaaattggagagatcctataacaaagtacacatcagacaaagatgttccttctgaacgaaataactacagtagagttgcgaatgacagagaccaagaaatgcatatagatttggaaaataagcatggtgatcccaaaaagaagagaggagagagaagaaattctttttctgaaaatgagaagcatacacaccgaattaaagacagtgaaaatttcagaagaaaagatagatcaaagtcaaaggaaatgaatagaaagcactcaggctcaagaagtgatgaagatagatatcaaaatggtgccgagagacgatgggaaaaatctagcagatactctgaacaatccagagaatcaaagaaaaatcaggaccggcgaagagaaaagtctccagcaaaacaaaaataattctacaaaatgacataaactggacatgccttatattcagttgaaacaaattattttttactttgacgaactttatagagaattcttgtataaagtattggtttgtatttgtaaatttaaaaaatgttttcattttaacatgttttataattgatacatctcaaggccctacccataaaattatttgaaaactttcaccagaaagggatgtaagtctcgcttatattttgtgaataaaatgatcaaaagctc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:57703 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:57703 -> Molecular function: GO:0003723 [RNA binding] evidence: IDA
            GeneID:57703 -> Biological process: GO:0000398 [mRNA splicing, via spliceosome] evidence: IC
            GeneID:57703 -> Biological process: GO:0048024 [regulation of mRNA splicing, via spliceosome] evidence: IC
            GeneID:57703 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:57703 -> Cellular component: GO:0005681 [spliceosomal complex] evidence: IDA
            GeneID:57703 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:57703 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:57703 -> Cellular component: GO:0071013 [catalytic step 2 spliceosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.