GGRNA Home | Help | Advanced search

2020-10-24 06:49:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020921              10293 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens ninein (GSK3B interacting protein) (NIN), transcript
            variant 2, mRNA.
ACCESSION   NM_020921
VERSION     NM_020921.3  GI:148536868
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 10293)
  AUTHORS   Howng,S.L., Chou,A.K., Lin,C.C., Lin,Z.A., Wang,C.J., Loh,J.K.,
            Lieu,A.S., Yen,J.H., Lee,C.I. and Hong,Y.R.
  TITLE     Autoimmunity against hNinein, a human centrosomal protein, in
            patients with rheumatoid arthritis and systemic lupus erythematosus
  JOURNAL   Mol Med Rep 4 (5), 825-830 (2011)
   PUBMED   21667027
  REMARK    GeneRIF: The prevalence of hNinein autoreactivity and its
            specificity in 22 rheumatoid arthritis and 32 systemic lupus
            erythematosus autoimmune disease sera.
REFERENCE   2  (bases 1 to 10293)
  AUTHORS   Ibi,M., Zou,P., Inoko,A., Shiromizu,T., Matsuyama,M., Hayashi,Y.,
            Enomoto,M., Mori,D., Hirotsune,S., Kiyono,T., Tsukita,S., Goto,H.
            and Inagaki,M.
  TITLE     Trichoplein controls microtubule anchoring at the centrosome by
            binding to Odf2 and ninein
  JOURNAL   J. Cell. Sci. 124 (PT 6), 857-864 (2011)
   PUBMED   21325031
  REMARK    GeneRIF: Trichoplein controls microtubule anchoring at the
            centrosome by binding to Odf2 and ninein.
REFERENCE   3  (bases 1 to 10293)
  AUTHORS   Olson,J.E., Wang,X., Pankratz,V.S., Fredericksen,Z.S., Vachon,C.M.,
            Vierkant,R.A., Cerhan,J.R. and Couch,F.J.
  TITLE     Centrosome-related genes, genetic variation, and risk of breast
            cancer
  JOURNAL   Breast Cancer Res. Treat. 125 (1), 221-228 (2011)
   PUBMED   20508983
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 10293)
  AUTHORS   Cirulli,E.T., Kasperaviciute,D., Attix,D.K., Need,A.C., Ge,D.,
            Gibson,G. and Goldstein,D.B.
  TITLE     Common genetic variation and performance on standardized cognitive
            tests
  JOURNAL   Eur. J. Hum. Genet. 18 (7), 815-820 (2010)
   PUBMED   20125193
  REMARK    Erratum:[Eur J Hum Genet. 2010 Jul;18(7):820]
REFERENCE   5  (bases 1 to 10293)
  AUTHORS   Couch,F.J., Wang,X., Bamlet,W.R., de Andrade,M., Petersen,G.M. and
            McWilliams,R.R.
  TITLE     Association of mitotic regulation pathway polymorphisms with
            pancreatic cancer risk and outcome
  JOURNAL   Cancer Epidemiol. Biomarkers Prev. 19 (1), 251-257 (2010)
   PUBMED   20056645
  REMARK    GeneRIF: Two single nucleotide polymorphisms in the APC and NIN
            loci were significantly associated with pancreatic cancer risk
            GeneRIF: Observational study of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
REFERENCE   6  (bases 1 to 10293)
  AUTHORS   Dammermann,A. and Merdes,A.
  TITLE     Assembly of centrosomal proteins and microtubule organization
            depends on PCM-1
  JOURNAL   J. Cell Biol. 159 (2), 255-266 (2002)
   PUBMED   12403812
REFERENCE   7  (bases 1 to 10293)
  AUTHORS   Ou,Y.Y., Mack,G.J., Zhang,M. and Rattner,J.B.
  TITLE     CEP110 and ninein are located in a specific domain of the
            centrosome associated with centrosome maturation
  JOURNAL   J. Cell. Sci. 115 (PT 9), 1825-1835 (2002)
   PUBMED   11956314
  REMARK    GeneRIF: Ninein is essential for the reformation of specific
            aspects of the interphase centrosome architecture following mitosis
            as well as being required for the centrosome to function as a MTOC.
REFERENCE   8  (bases 1 to 10293)
  AUTHORS   Hong,Y.R., Chen,C.H., Chuo,M.H., Liou,S.Y. and Howng,S.L.
  TITLE     Genomic organization and molecular characterization of the human
            ninein gene
  JOURNAL   Biochem. Biophys. Res. Commun. 279 (3), 989-995 (2000)
   PUBMED   11162463
REFERENCE   9  (bases 1 to 10293)
  AUTHORS   Hong,Y.R., Chen,C.H., Chang,J.H., Wang,S., Sy,W.D., Chou,C.K. and
            Howng,S.L.
  TITLE     Cloning and characterization of a novel human ninein protein that
            interacts with the glycogen synthase kinase 3beta
  JOURNAL   Biochim. Biophys. Acta 1492 (2-3), 513-516 (2000)
   PUBMED   11004522
REFERENCE   10 (bases 1 to 10293)
  AUTHORS   Mack,G.J., Rees,J., Sandblom,O., Balczon,R., Fritzler,M.J. and
            Rattner,J.B.
  TITLE     Autoantibodies to a group of centrosomal proteins in human
            autoimmune sera reactive with the centrosome
  JOURNAL   Arthritis Rheum. 41 (3), 551-558 (1998)
   PUBMED   9506584
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from CR993064.1, BC090932.1,
            AF223937.1, AY736182.1, AF212162.2, AF302773.2, AF223938.1 and
            AL606834.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 1, 2007 this sequence version replaced gi:33946314.
            
            Summary: This gene encodes one of the proteins important for
            centrosomal function. This protein is important for positioning and
            anchoring the microtubules minus-ends in epithelial cells.
            Localization of this protein to the centrosome requires three
            leucine zippers in the central coiled-coil domain. Multiple
            alternatively spliced transcript variants that encode different
            isoforms have been reported. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) is the longest transcript and
            it encodes the longest isoform (2).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-467               CR993064.1         20-486
            468-2590            BC090932.1         312-2434
            2591-2984           AF223937.1         2550-2943
            2985-3024           AY736182.1         2985-3024
            3025-3280           AF223937.1         2984-3239
            3281-3399           AF212162.2         3310-3428
            3400-3693           AF223937.1         3359-3652
            3694-3823           AF212162.2         3723-3852
            3824-5566           AF302773.2         3824-5566
            5567-5767           AF212162.2         5596-5796
            5768-6383           AF302773.2         5768-6383
            6384-6443           AF223938.1         6343-6402
            6444-10293          AL606834.1         16405-20254
FEATURES             Location/Qualifiers
     source          1..10293
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q22.1"
     gene            1..10293
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /note="ninein (GSK3B interacting protein)"
                     /db_xref="GeneID:51199"
                     /db_xref="HGNC:14906"
                     /db_xref="MIM:608684"
     exon            1..116
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            117..170
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            171..374
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     CDS             192..6593
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /note="isoform 2 is encoded by transcript variant 2;
                     ninein centrosomal protein; glycogen synthase kinase 3
                     beta-interacting protein; hNinein"
                     /codon_start=1
                     /product="ninein isoform 2"
                     /protein_id="NP_065972.3"
                     /db_xref="GI:148536869"
                     /db_xref="GeneID:51199"
                     /db_xref="HGNC:14906"
                     /db_xref="MIM:608684"
                     /translation="
MDEVEQDQHEARLKELFDSFDTTGTGSLGQEELTDLCHMLSLEEVAPVLQQTLLQDNLLGRVHFDQFKEALILILSRTLSNEEHFQEPDCSLEAQPKYVRGGKRYGRRSLPEFQESVEEFPEVTVIEPLDEEARPSHIPAGDCSEHWKTQRSEEYEAEGQLRFWNPDDLNASQSGSSPPQDWIEEKLQEVCEDLGITRDGHLNRKKLVSICEQYGLQNVDGEMLEEVFHNLDPDGTMSVEDFFYGLFKNGKSLTPSASTPYRQLKRHLSMQSFDESGRRTTTSSAMTSTIGFRVFSCLDDGMGHASVERILDTWQEEGIENSQEILKALDFSLDGNINLTELTLALENELLVTKNSIHQAALASFKAEIRHLLERVDQVVREKEKLRSDLDKAEKLKSLMASEVDDHHAAIERRNEYNLRKLDEEYKERIAALKNELRKEREQILQQAGKQRLELEQEIEKAKTEENYIRDRLALSLKENSRLENELLENAEKLAEYENLTNKLQRNLENVLAEKFGDLDPSSAEFFLQEERLTQMRNEYERQCRVLQDQVDELQSELEEYRAQGRVLRLPLKNSPSEEVEANSGGIEPEHGLGSEECNPLNMSIEAELVIEQMKEQHHRDICCLRLELEDKVRHYEKQLDETVVSCKKAQENMKQRHENETHTLEKQISDLKNEIAELQGQAAVLKEAHHEATCRHEEEKKQLQVKLEEEKTHLQEKLRLQHEMELKARLTQAQASFEREREGLQSSAWTEEKVRGLTQELEQFHQEQLTSLVEKHTLEKEELRKELLEKHQRELQEGREKMETECNRRTSQIEAQFQSDCQKVTERCESALQSLEGRYRQELKDLQEQQREEKSQWEFEKDELTQECAEAQELLKETLKREKTTSLVLTQEREMLEKTYKEHLNSMVVERQQLLQDLEDLRNVSETQQSLLSDQILELKSSHKRELREREEVLCQAGASEQLASQRLERLEMEHDQERQEMMSKLLAMENIHKATCETADRERAEMSTEISRLQSKIKEMQQATSPLSMLQSGCQVIGEEEVEGDGALSLLQQGEQLLEENGDVLLSLQRAHEQAVKENVKMATEISRLQQRLQKLEPGLVMSSCLDEPATEFFGNTAEQTEPFLQQNRTKQVEGVTRRHVLSDLEDDEVRDLGSTGTSSVQRQEVKIEESEASVEGFSELENSEETRTESWELKNQISQLQEQLMMLCADCDRASEKKQDLLFDVSVLKKKLKMLERIPEASPKYKLLYEDVSRENDCLQEELRMMETRYDEALENNKELTAEVFRLQDELKKMEEVTETFLSLEKSYDEVKIENEELNVLVLRLQGKIEKLQESVVQRCDCCLWEASLENLEIEPDGNILQLNQTLEECVPRVRSVHHVIEECKQENQYLEGNTQLLEKVKAHEIAWLHGTIQTHQERPRVQNQVILEENTTLLGFQDKHFQHQATIAELELEKTKLQELTRKLKERVTILVKQKDVLSHGEKEEELKAMMHDLQITCSEMQQKVELLRYESEKLQQENSILRNEITTLNEEDSISNLKLGTLNGSQEEMWQKTETVKQENAAVQKMVENLKKQISELKIKNQQLDLENTELSQKNSQNQEKLQELNQRLTEMLCQKEKEPGNSALEEREQEKFNLKEELERCKVQSSTLVSSLEAELSEVKIQTHIVQQENHLLKDELEKMKQLHRCPDLSDFQQKISSVLSYNEKLLKEKEALSEELNSCVDKLAKSSLLEHRIATMKQEQKSWEHQSASLKSQLVASQEKVQNLEDTVQNVNLQMSRMKSDLRVTQQEKEALKQEVMSLHKQLQNAGGKSWAPEIATHPSGLHNQQKRLSWDKLDHLMNEEQQLLWQENERLQTMVQNTKAELTHSREKVRQLESNLLPKHQKHLNPSGTMNPTEQEKLSLKRECDQFQKEQSPANRKVSQMNSLEQELETIHLENEGLKKKQVKLDEQLMEMQHLRSTATPSPSPHAWDLQLLQQQACPMVPREQFLQLQRQLLQAERINQHLQEELENRTSETNTPQGNQEQLVTVMEERMIEVEQKLKLVKRLLQEKVNQLKEQLCKNTKADAMVKDLYVENAQLLKALEVTEQRQKTAEKKNYLLEEKIASLSNIVRNLTPAPLTSTPPLRS
"
     misc_feature    <1266..2228
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:162739"
     misc_feature    4632..>5660
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /note="Chromosome segregation ATPases [Cell division and
                     chromosome partitioning]; Region: Smc; COG1196"
                     /db_xref="CDD:31389"
     misc_feature    4839..4841
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8N4C6.4); phosphorylation site"
     misc_feature    4839..4841
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            375..456
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            457..626
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            627..666
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            667..857
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            858..1004
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1005..1172
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1173..1309
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1310..1450
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1451..1625
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1626..1736
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1737..1826
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1827..1965
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            1966..2087
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            2088..2590
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            2591..4729
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     STS             3408..3560
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /standard_name="RH65693"
                     /db_xref="UniSTS:49882"
     exon            4730..4855
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            4856..4925
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            4926..5141
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5142..5255
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5256..5378
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5379..5492
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5493..5639
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5640..5819
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            5820..5966
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     variation       5828
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11376"
     exon            5967..6068
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     variation       6035
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055883"
     exon            6069..6269
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            6270..6383
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     exon            6384..10293
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /inference="alignment:Splign:1.39.8"
     STS             6740..6850
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /standard_name="RH44954"
                     /db_xref="UniSTS:27625"
     STS             8166..8311
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /standard_name="RH93653"
                     /db_xref="UniSTS:91520"
     variation       9660
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3184490"
     STS             10094..10208
                     /gene="NIN"
                     /gene_synonym="SCKL7"
                     /standard_name="SHGC-32079"
                     /db_xref="UniSTS:13791"
     polyA_signal    10270..10275
                     /gene="NIN"
                     /gene_synonym="SCKL7"
     polyA_site      10293
                     /gene="NIN"
                     /gene_synonym="SCKL7"
ORIGIN      
ccgagccgggagccgagcgcgctgggcgcggccgtcccgctgccgccgccaagcccggagtgcgccagcggccatggttcccgcggcggcgccgggcgcctgagccccgggacgcaagcgctggaggcgggctgccggctgtgcgggcgctccggagagaccgacagaaggtgagcactgtgggctatgggatggatgaggtggagcaggaccagcatgaggcccgactcaaggagctgtttgacagttttgacacgacgggcacagggtccctggggcaggaggaactcaccgacctttgccacatgttgagcttggaggaggtggccccagtgctgcagcagacattacttcaggacaacctcttgggcagggtacattttgaccaatttaaagaagcattaatactcatcttgtccagaactctgtcaaatgaagaacactttcaagaaccagactgctcactagaagctcagcccaaatatgttagaggtgggaagcgttacggacgaaggtccttgcccgagttccaagagtccgtggaggagtttcctgaagtgacggtgattgagccactggatgaagaagcgcggccttcacacatcccagccggtgactgcagtgagcactggaagacgcaacgcagtgaggagtatgaagcggaaggccagttaaggttttggaacccagatgacttgaatgcttcacagagtggatcttcccctccccaagactggatagaagagaaactgcaagaagtttgtgaagatttggggatcacccgtgatggtcacctgaaccggaagaagctggtctccatctgtgagcagtatggtttacagaatgtggatggagagatgctcgaggaagtattccataatcttgatcctgacggtacaatgagtgtagaagattttttctatggtttgtttaaaaatggaaaatctcttacaccatcagcatctactccatatagacaactaaaaaggcacctttccatgcagtctttcgatgagagtggacgacgtaccacaacctcatcagcaatgacaagtaccattggctttcgggtcttctcctgcctggatgatgggatgggccatgcatctgtggagagaatactggacacctggcaggaagagggcattgagaacagccaggagatcctgaaggccttggatttcagcctcgatggaaacatcaatttgacagaattaacactggcccttgaaaatgaacttttggttaccaagaacagcattcaccaggcggctctggccagctttaaggctgaaatccggcatttgttggaacgagttgatcaggtggtcagagaaaaagagaagctacggtcagatctggacaaggccgagaagctcaagtctttaatggcctcggaggtggatgatcaccatgcggccatagagcggcggaatgagtacaacctcaggaaactggatgaagagtacaaggagcgaatagcagccttaaaaaatgaactccgaaaagagagagagcagatcctgcagcaggcaggcaagcagcgtttagaacttgaacaggaaattgaaaaggcaaaaacagaagagaactatatccgggaccgccttgccctctctttaaaggaaaacagtcgtctggaaaatgagcttctagaaaatgcagagaagttggcagaatatgagaatctgacaaacaaacttcagagaaatttggaaaatgtgttagcagaaaagtttggtgacctcgatcctagcagtgctgagttcttcctgcaagaagagagactgacacagatgagaaatgaatatgagcggcagtgcagggtactacaagaccaagtagatgaactccagtctgagctggaagaatatcgtgcacaaggcagagtgctcaggcttccgttgaagaactcaccgtcagaagaagttgaggctaacagcggtggcattgagcccgaacacgggctcggttctgaagaatgcaatccattgaatatgagcattgaggcagagctggtcattgaacagatgaaagaacaacatcacagggacatatgttgcctcagactggagctcgaagataaagtgcgccattatgaaaagcagctggacgaaaccgtggtcagctgcaagaaggcacaggagaacatgaagcaaaggcatgagaacgaaacgcacaccttagaaaaacaaataagtgaccttaaaaatgaaattgctgaacttcaggggcaagcagcagtgctcaaggaggcacatcatgaggccacttgcaggcatgaggaggagaaaaaacaactgcaagtgaagcttgaggaggaaaagactcacctgcaggagaagctgaggctgcaacatgagatggagctcaaggctagactgacacaggctcaagcaagctttgagcgggagagggaaggccttcagagtagcgcctggacagaagagaaggtgagaggcttgactcaggaactagagcagtttcaccaggagcagctgacaagcctggtggagaaacacactcttgagaaagaggagttaagaaaagagctcttggaaaagcaccaaagggagcttcaggagggaagggaaaaaatggaaacagagtgtaatagaagaacctctcaaatagaagcccagtttcagtctgattgtcagaaagtcactgagaggtgtgaaagcgctctgcaaagcctggaggggcgctaccgccaagagctgaaggacctccaggaacagcagcgtgaggagaaatcccagtgggaatttgagaaggacgagctcacccaggagtgtgcggaagcccaggagctgctgaaagagactcttaagagagagaaaacaacttctctggtcctgacccaggagagagagatgctggagaaaacatacaaagaacatttgaacagcatggtcgtcgagagacagcagctactccaagacctggaagacctaagaaatgtatctgaaacccagcaaagcctgctgtctgaccagatacttgagctgaagagcagtcacaaaagggaactgagggagcgtgaggaggtcctgtgccaggcaggggcttcggagcagctggccagccagcggctggaaagactagaaatggaacatgaccaggaaaggcaggaaatgatgtccaagcttctagccatggagaacattcacaaagcgacctgtgagacagcagatcgagaaagagccgagatgagcacagaaatctccagacttcagagtaaaataaaggaaatgcagcaggcaacatctcctctctcaatgcttcagagtggttgccaggtgataggagaggaggaggtggaaggagatggagccctgtccctgcttcagcaaggggagcagctgttggaagaaaatggggacgtcctcttaagcctgcagagagctcatgaacaggcagtgaaggaaaatgtgaaaatggctactgaaatttctagattgcaacagaggctacaaaagttagagccagggttagtaatgtcttcttgtttggatgagccagctactgagttttttggaaatactgcggaacaaacagagccgtttttacagcaaaaccgaacgaagcaagtagaaggtgtgaccaggcggcatgtcctaagtgacctggaagatgatgaggtccgggacctgggaagtacagggacgagctctgttcagagacaggaagtcaaaatagaggagtctgaagcttcagtagagggtttttctgagcttgaaaacagtgaagagaccaggactgaatcctgggagctgaagaatcagattagtcagcttcaggaacagctaatgatgttatgtgcggactgtgatcgagcttctgaaaagaaacaggacctactttttgatgtttctgtgctaaaaaagaaactgaagatgcttgagagaatccctgaggcttctcccaaatataagctgttgtatgaagatgtgagccgagaaaatgactgccttcaggaagagctgagaatgatggagacacgctacgatgaggcactagaaaataacaaagaactcactgcagaggttttcaggttgcaggatgagctgaagaaaatggaggaagtcactgaaacattcctcagcctggaaaagagttacgatgaggtcaaaatagaaaatgaggagctgaatgttctggttttgagacttcaaggcaagattgagaagcttcaggaaagcgtggtccagcggtgtgactgctgcttatgggaagccagtttagagaacctggaaatcgaacctgatggaaatatactccagctcaatcagacactggaagagtgtgtgcccagggttaggagtgtacatcatgtcatagaggaatgtaagcaagaaaaccagtaccttgaggggaacacacagctcttggaaaaagtaaaagcacatgaaattgcctggttacatggaacaattcagacacatcaagaaaggccaagagtacagaatcaagttatactggaggaaaacactactctcctaggctttcaagacaaacattttcagcatcaggccaccatagcagagttagaactggagaaaacaaagttacaggagctgactaggaagttgaaggagagagtcactattttagttaagcaaaaagatgtactttctcacggagaaaaggaggaagagctgaaggcaatgatgcatgacttgcagatcacgtgcagtgagatgcagcaaaaagttgaacttctgagatatgaatctgaaaagcttcaacaggaaaattctattttgagaaatgaaattactactttaaatgaagaagatagcatttctaacctgaaattagggacattaaatggatctcaggaagaaatgtggcaaaaaacggaaactgtaaaacaagaaaatgctgcagttcagaagatggttgaaaatttaaagaaacagatttcagaattaaaaatcaaaaaccaacaattggatttggaaaatacagaacttagccaaaagaactctcaaaaccaggaaaaactgcaagaacttaatcaacgtctaacagaaatgctatgccagaaggaaaaagagccaggaaacagtgcattggaggaacgggaacaagagaagtttaatctgaaagaagaactggaacgttgtaaagtgcagtcctccactttagtgtcttctctggaggcggagctctctgaagttaaaatacagacccatattgtgcaacaggaaaaccaccttctcaaagatgaactggagaaaatgaaacagctgcacagatgtcccgatctctctgacttccagcaaaaaatctctagtgttctaagctacaacgaaaaactgctgaaagaaaaggaagctctgagtgaggaattaaatagctgtgtcgataagttggcaaaatcaagtcttttagagcatagaattgcgacgatgaagcaggaacagaaatcctgggaacatcagagtgcgagcttaaagtcacagctggtggcttctcaggaaaaggttcagaatttagaagacaccgtgcagaatgtaaacctgcaaatgtcccggatgaaatctgacctacgagtgactcagcaggaaaaggaggctttaaaacaagaagtgatgtctttacataagcaacttcagaatgctggtggcaagagctgggccccagagatagctactcatccatcagggctccataaccagcagaaaaggctgtcctgggacaagttggatcatctgatgaatgaggaacagcagctgctttggcaagagaatgagaggctccagaccatggtacagaacaccaaagccgaactcacgcactcccgggagaaggtccgtcagttggaatccaatcttcttcccaagcaccaaaaacatctaaacccatcaggtaccatgaatcccacagagcaagaaaaattgagcttaaagagagagtgtgatcagtttcagaaagaacaatctcctgctaacaggaaggtcagtcagatgaattcccttgaacaagaattagaaacaattcatttggaaaatgaaggcctgaaaaagaaacaagtaaaactggatgagcagctcatggagatgcagcacctgaggtccactgcgacgcctagcccgtcccctcatgcttgggatttgcagctgctccagcagcaagcctgtccgatggtgcccagggagcagtttctgcagcttcaacgccagctgctgcaggcagaaaggataaaccagcacctgcaggaggaacttgaaaacaggacctccgaaaccaacacaccacagggaaaccaggaacaactggtaactgtcatggaggaacgaatgatagaagttgaacagaaactgaaactagtgaaaaggcttcttcaagagaaagtgaatcagctcaaagaacaactctgcaagaacactaaggcagacgcaatggtgaaggacttgtatgttgaaaatgcccagttgttgaaagctctggaagtgactgaacagcgacagaaaacagcagagaagaaaaattacctcctggaggagaagattgccagcctcagtaatatagttaggaatctgacaccagcgccattgacttctacacctcctttgaggtcatagccaaaccaaagggtacactcatatttgtgcactttactgaaatagatgaacatttcagtaggttctcaacttaaaattaagcctaacctaaaactgccagcaacacaactggagtttccatttatcataattagtttttctaaatagacccttatgggagtttgaaaataaatactcacatatttcactacttaaattattcccaagatttgaatttattttaaaattttaatagccaccaagaatgtggacatatgaaaattcaagaacctaaaaaataccagttttgaatgagtttttgtggttttggttttttttttaattattacaaatctatgtgtaaaatctagatatttgaagtttgagatctgatgagaatggttgttataaactttattttaaaaccaaatttaggtgttcttacatatttaaatactggaaagtcattataatagttttggttctttgaattggtagacaattagtagagtataattggttaggaggcagggcttattaagtggttattaaccgctgacatcagacaaacccaaatctgtagaattctaaccttctaacacctgtgacagtattaccactcttcttgtattatagatttagaactgatttactcaattgcactcttaactaatgttaaaagcttacttgctttaaacagccttttcttctttctcttaaaagtttcatttggggagctggtcttctaagaaacggataaagccacataattaaagcagttgaactatagggaaagcactgaacaaaccactttggagtaaatagctactcttagaaaagagggataagcagaccatgtaggttttctgtctctcaaatcttagagttcataaatttacttgaggttgcctcaagaactcagggaacaatactgtaaactgtcttcctgaactactgtagggcctctctaagaatttgaaatgtataaaccatgtgacctcatttatttgtcttatatatttacagccatactagaatttttatttctacgtttttagtaaatttaatattctgggggaaaaaaggccttgattttagggttaaaaacctgacttatagaagagtttatttaatataggtcaaaattttctgtgtttcttattccttctatacctcaaatctgattctaagaatttcttactgtgataatcattggcatgccacctgaggtcaaggagtgccaaataggactttccactcatgctcaagatcaaaactttatagaacagtcaacattttagattcggtaaccttttttttcttccaattataatctctgctagccacttccgccagcagttggtggaagacttactaggtgcagggcactttccaagttcatcacaacaacctgcttgttttcatgagacaataatccgaaaagttcgctttgatatattcctggagggccaagcccatctatttacaaaaggtgaacagcaaaatcaagcactgctttatgggcaggaacacaagagaaagcaaactgcccaagaagtcatcatgtcagaaactcaatctcaacaaaataatttccatcagggaacttcagggtttcttgggggcttatgagtctcaccggtcaacccaggaggcctcactacaagagccttgacaaggcactgttttttgtgggactgggagttcacactgatgaagcaaacctttgaatttttgcacagctcttgtcagaaagccctgagttccccctggataaagagttaattttaatccttccctataattatacttcaaaatatttgacatctgctattatgccttctttagatctttcttctgtggtgcagacatttctagtaagtgtttgactacttgtatggcattagctttcacagaaaattgtttcacttaaaactgtggattggcctaggctaaggacaaaaataaactaagtacctgtagtgtatttatgtgatatgtgtcaagttactcaaagttattgctgttggaactgaacaataatatttcccagatagctggccttagcatgtgatcacggttgttgtatttttaatttttgtcttttacagtatgagaggtgtaggttaatttgtttatttcctataaatttgtatttatgtgtatataaaatgtacaatgaatgtaaatatgactttctggaaagtttagactacatttagaatctctattcaaaatcaaaatgctgctcaaatgaatttaaccaacatctaggtgcttaatttctcattttatcccacttatgagattgggaaaaagatcaatatgagaaataccatacagataccttaaatgtatgcatttgtgcaacaatttttgagaaggtgagtggcaatttataatttagttggcaatttataatagaacttatagcttttaaaagaccttttaaagacattaaatgtaaacttaaaaatgtttagatcttgtttcaaactttacaatagcattcttcaaaatattaagttatatattttataggcatttagttgcttattaaaagcactgattttcaaactttttgatttaagaacaattatttaagatcgtctcagaagatgggatcttcgtttcaagaaaagggaatcaagtttgcctttgagataatacgttacactaagaaaaggaaaatgtggatagtaaaacccacctctctcatcctattgtactctcttctgctttttagaagcctgcacttaagcttagatttgtgaagggagagtagaaggggagaagtagaaccacagtgttttatttatttttctaaaactcttactaaatccagattttttaaactgttttaaatgtgaattcttcccagaaatttcaatgcattgcatatttagccttcggcatatttttcatgaatagatcatgaagtcataggcttccaaggcataggaagagatcttgcaggtctagtattttaataatgcactattacccagggcagatattatgagaaactgtttcttctctaagggtttatggcagactttgcttttttaacatgtgagaaatgaattttttattttgtgatttatgtgatttcttttgctgagtgaaggaaaggagaaattgttgctattgtcagcatcttaaaggtatttccagtcaaggcaaggctaagtgctttgtgatagtattaagcaagtcatgttttgaatggattacctgtagtgactcattggaatgatataattatacaagtaatgccaaaaaccaagtcaaagcctaattaaccaaagcactcatttaaaaatcatcatgtttggacctatctggacctctcagcactgtaaaatagttttggttttgtggcatatgaatagctgtttaacaaatcaaagttagctttttgcttctcagcttttttgggcaatacaagttaagttcttaatggggagacattatcatggcatgacttaagggaacattggtttgtgaaggaaaaacagattatctaaagccatctctatgtttctgttcagataaagattaatgagttctgtgtttatatcagctttgtatatttcatcttagccattctatcctagaaagattttaatgtgagcttaagatgtaaataaataattttgcaaacatgccttttgttttctatataccctgaccttttaataaagtttcagtgtatttatca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51199 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:51199 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51199 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
            GeneID:51199 -> Biological process: GO:0034454 [microtubule anchoring at centrosome] evidence: IEA
            GeneID:51199 -> Biological process: GO:0051642 [centrosome localization] evidence: TAS
            GeneID:51199 -> Biological process: GO:0090222 [centrosome-templated microtubule nucleation] evidence: IEA
            GeneID:51199 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:51199 -> Cellular component: GO:0005814 [centriole] evidence: IEA
            GeneID:51199 -> Cellular component: GO:0005874 [microtubule] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.