GGRNA Home | Help | Advanced search

2024-04-25 09:10:19, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020799               2094 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA.
ACCESSION   NM_020799
VERSION     NM_020799.3  GI:375298740
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2094)
  AUTHORS   Lavorgna,A. and Harhaj,E.W.
  TITLE     An RNA interference screen identifies the Deubiquitinase STAMBPL1
            as a critical regulator of human T-cell leukemia virus type 1 tax
            nuclear export and NF-kappaB activation
  JOURNAL   J. Virol. 86 (6), 3357-3369 (2012)
   PUBMED   22258247
  REMARK    GeneRIF: Cellular STAMBPL1 is a positive regulator of human T-cell
            leukemia virus type 1 Tax-mediated NF-kappaB signaling.
            Erratum:[J Virol. 2012 May;86(9):5409]
REFERENCE   2  (bases 1 to 2094)
  AUTHORS   Reyes-Ibarra,A.P., Garcia-Regalado,A., Ramirez-Rangel,I.,
            Esparza-Silva,A.L., Valadez-Sanchez,M., Vazquez-Prado,J. and
            Reyes-Cruz,G.
  TITLE     Calcium-sensing receptor endocytosis links extracellular calcium
            signaling to parathyroid hormone-related peptide secretion via a
            Rab11a-dependent and AMSH-sensitive mechanism
  JOURNAL   Mol. Endocrinol. 21 (6), 1394-1407 (2007)
   PUBMED   17426287
  REMARK    GeneRIF: AMSH redirects CaR from slow recycling to down-regulation,
            reducing CaR expression and decreasing PTHrP secretion.
REFERENCE   3  (bases 1 to 2094)
  AUTHORS   Nakamura,M., Tanaka,N., Kitamura,N. and Komada,M.
  TITLE     Clathrin anchors deubiquitinating enzymes, AMSH and AMSH-like
            protein, on early endosomes
  JOURNAL   Genes Cells 11 (6), 593-606 (2006)
   PUBMED   16716190
  REMARK    GeneRIF: AMSH and AMSH-LP are anchored on the early endosomal
            membrane via interaction with the clathrin coat
REFERENCE   4  (bases 1 to 2094)
  AUTHORS   Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
            Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
            Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
            Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
            Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
            Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
            Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
  TITLE     A scan of chromosome 10 identifies a novel locus showing strong
            association with late-onset Alzheimer disease
  JOURNAL   Am. J. Hum. Genet. 78 (1), 78-88 (2006)
   PUBMED   16385451
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 2094)
  AUTHORS   Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
            French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
            Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
            Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
            Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
            Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
            Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
            Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
            Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
            Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
            Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
            Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
            Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
            Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
            Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
            Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
            Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
            Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
            Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
            Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
            Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
            Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
            Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
            Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
            Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
            Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
            Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
  TITLE     The DNA sequence and comparative analysis of human chromosome 10
  JOURNAL   Nature 429 (6990), 375-381 (2004)
   PUBMED   15164054
REFERENCE   6  (bases 1 to 2094)
  AUTHORS   Ibarrola,N., Kratchmarova,I., Nakajima,D., Schiemann,W.P.,
            Moustakas,A., Pandey,A. and Mann,M.
  TITLE     Cloning of a novel signaling molecule, AMSH-2, that potentiates
            transforming growth factor beta signaling
  JOURNAL   BMC Cell Biol. 5, 2 (2004)
   PUBMED   14728725
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 2094)
  AUTHORS   Kitajima,K., Matsumoto,K., Tahara,M., Takahashi,H., Nakamura,T. and
            Nakamura,T.
  TITLE     A newly identified AMSH-family protein is specifically expressed in
            haploid stages of testicular germ cells
  JOURNAL   Biochem. Biophys. Res. Commun. 309 (1), 135-142 (2003)
   PUBMED   12943674
REFERENCE   8  (bases 1 to 2094)
  AUTHORS   Kikuchi,K., Ishii,N., Asao,H. and Sugamura,K.
  TITLE     Identification of AMSH-LP containing a Jab1/MPN domain
            metalloenzyme motif
  JOURNAL   Biochem. Biophys. Res. Commun. 306 (3), 637-643 (2003)
   PUBMED   12810066
  REMARK    GeneRIF: Data show that associated molecule with the SH3 domain of
            STAM-like protein (AMSH-LP), unlike AMSH, fails to bind to the SH3
            domains of STAM1 (signal transducing adaptor molecule 1) and Grb2.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CD244526.1, AK056086.1 and AW006657.1.
            On Feb 14, 2012 this sequence version replaced gi:52694663.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK056086.1, BC010846.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-71                CD244526.1         26-96
            72-2077             AK056086.1         1-2006
            2078-2094           AW006657.1         4-20                c
FEATURES             Location/Qualifiers
     source          1..2094
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q23.31"
     gene            1..2094
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="STAM binding protein-like 1"
                     /db_xref="GeneID:57559"
                     /db_xref="HGNC:24105"
                     /db_xref="HPRD:16486"
                     /db_xref="MIM:612352"
     exon            1..452
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       204
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370413959"
     variation       285
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374626664"
     variation       347
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12255810"
     variation       383
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78561402"
     exon            453..535
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       457
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369091157"
     variation       476
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184154094"
     variation       480
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7907004"
     variation       481
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374001893"
     variation       485..486
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34656976"
     misc_feature    497..499
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="upstream in-frame stop codon"
     variation       501
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736945"
     CDS             506..1816
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /EC_number="3.1.2.15"
                     /note="associated molecule with the SH3 domain of STAM
                     (AMSH) like protein; associated molecule with the SH3
                     domain of STAM (AMSH) - Family Protein"
                     /codon_start=1
                     /product="AMSH-like protease"
                     /protein_id="NP_065850.1"
                     /db_xref="GI:33147080"
                     /db_xref="CCDS:CCDS7391.1"
                     /db_xref="GeneID:57559"
                     /db_xref="HGNC:24105"
                     /db_xref="HPRD:16486"
                     /db_xref="MIM:612352"
                     /translation="
MDQPFTVNSLKKLAAMPDHTDVSLSPEERVRALSKLGCNITISEDITPRRYFRSGVEMERMASVYLEEGNLENAFVLYNKFITLFVEKLPNHRDYQQCAVPEKQDIMKKLKEIAFPRTDELKNDLLKKYNVEYQEYLQSKNKYKAEILKKLEHQRLIEAERKRIAQMRQQQLESEQFLFFEDQLKKQELARGQMRSQQTSGLSEQIDGSALSCFSTHQNNSLLNVFADQPNKSDATNYASHSPPVNRALTPAATLSAVQNLVVEGLRCVVLPEDLCHKFLQLAESNTVRGIETCGILCGKLTHNEFTITHVIVPKQSAGPDYCDMENVEELFNVQDQHDLLTLGWIHTHPTQTAFLSSVDLHTHCSYQLMLPEAIAIVCSPKHKDTGIFRLTNAGMLEVSACKKKGFHPHTKEPRLFSICKHVLVKDIKIIVLDLR
"
     misc_feature    578..580
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96FJ0.2); phosphorylation site"
     misc_feature    1229..1231
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96FJ0.2); phosphorylation site"
     misc_feature    1229..1231
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1301..1813
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="Mov34/MPN/PAD-1 family; Region: MPN_AMSH_like;
                     cd08066"
                     /db_xref="CDD:163697"
     misc_feature    order(1379..1381,1544..1546,1550..1552,1574..1576,
                     1583..1585)
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="MPN+ (JAMM) motif; other site"
                     /db_xref="CDD:163697"
     misc_feature    1379..1381
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Indirect zinc-binding; propagated from
                     UniProtKB/Swiss-Prot (Q96FJ0.2); other site"
     misc_feature    order(1385..1393,1466..1480,1487..1492,1499..1501,
                     1508..1510,1526..1531,1538..1540,1544..1546,1550..1552,
                     1574..1576,1580..1585,1589..1594,1601..1606,1610..1615,
                     1724..1726)
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="Distal ubiquitin recognition interface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:163697"
     misc_feature    order(1466..1468,1550..1552,1559..1564,1568..1570,
                     1574..1579,1724..1732)
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="Proximal ubiquitin recognition interface; other
                     site"
                     /db_xref="CDD:163697"
     misc_feature    1544..1585
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96FJ0.2);
                     Region: JAMM motif"
     misc_feature    order(1544..1546,1550..1552,1583..1585)
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /note="Zinc-binding site [ion binding]; other site"
                     /db_xref="CDD:163697"
     variation       514
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370446280"
     variation       530
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372477377"
     exon            536..753
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       545
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370800113"
     variation       593
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375222641"
     variation       597
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368354676"
     variation       606
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200795909"
     variation       664
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370720049"
     variation       671
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145411494"
     variation       690
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199596291"
     variation       691
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17114071"
     variation       733
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374975621"
     variation       753
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375576635"
     exon            754..829
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       783
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181446155"
     variation       806
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368542029"
     exon            830..925
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       856
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201314718"
     variation       896
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148947892"
     exon            926..1283
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       977
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143664611"
     variation       993
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372282218"
     variation       1026
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148096389"
     variation       1043
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367672326"
     variation       1045
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371730681"
     variation       1053
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143813797"
     variation       1054
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200055658"
     variation       1089
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146916734"
     variation       1092
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12254856"
     variation       1108
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41284104"
     variation       1115
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34270879"
     variation       1132
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139103435"
     variation       1133
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9988723"
     variation       1138
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35493467"
     variation       1194
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139826615"
     variation       1224
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200966286"
     variation       1225
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200014710"
     variation       1255
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17850686"
     variation       1266
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202238568"
     variation       1271
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146759776"
     exon            1284..1408
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       1286
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369751532"
     variation       1289
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139363999"
     variation       1305
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200651856"
     variation       1338
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373894376"
     variation       1368
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142629776"
     variation       1375
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139001360"
     exon            1409..1546
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       1409
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377504895"
     variation       1458
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140820995"
     variation       1459
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183704316"
     variation       1479
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371236373"
     variation       1521
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374147577"
     variation       1537..1538
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71022548"
     exon            1547..1659
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       1555
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34083181"
     variation       1566
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372446951"
     variation       1580
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375685316"
     variation       1593
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369740177"
     variation       1599
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372860750"
     variation       1614
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199781509"
     variation       1654
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377199878"
     exon            1660..1759
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       1681
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376816365"
     variation       1693
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371084787"
     variation       1753
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374576837"
     exon            1760..2094
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /inference="alignment:Splign:1.39.8"
     variation       1764
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145246768"
     variation       1778
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368433252"
     variation       1784
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142754924"
     variation       1792
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374507048"
     variation       1796
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367828982"
     STS             1799..2075
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /standard_name="WI-10275"
                     /db_xref="UniSTS:79799"
     variation       1820
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200476724"
     STS             1834..2000
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /standard_name="RH66053"
                     /db_xref="UniSTS:40315"
     variation       1837
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376278638"
     variation       1856
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184125227"
     variation       1875
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147342229"
     variation       1891
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80093227"
     variation       1959
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1530281"
     variation       1991
                     /gene="STAMBPL1"
                     /gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188575421"
ORIGIN      
gcggaggcagaggcggaggcggcacccaggggccggggcaggggaggccgggaccatcgcagtgacaatttattttcctgcagcagcggcagcagggacggttgctgcaggttcggggtcggccggcctgcgcgtgggcttgcgaggacgctgttcgtcccctgcgctggggtgtccgacagcgaggaggagaacgacgcacggagcccgcgcgactggaaccagcaaagctccatctgtcggcagaggagaagggggaggaggcacggccgaggcaaacgagcggacgcctcgtcgccgggtgccggtatcaccccgctgcaacgccttccagcaaaagccaccgcggcccgggttgcagcagccggacggatgccaaggccacacggcagccacgggggcagccgtcgcagtcgccgtcccacacgggctgcggacaccaagggttgctaatgaagtgattgagaagaaacagtgaacatcctcatttcacagataagacaacatggatcagccttttactgtgaattctctgaaaaagttagctgctatgcctgaccatacagatgtttccctaagcccagaagagcgagtccgtgccctaagcaagcttggttgtaatatcaccatcagtgaagacatcactccacgacgttactttaggtctggagtagagatggagaggatggcgtctgtgtatttggaagaaggaaatttggaaaatgcctttgttctttataataaatttataaccttatttgtagaaaagcttcctaaccatcgagattaccagcaatgtgcagtacctgaaaagcaggatattatgaagaaactgaaggagattgcattcccaaggacagatgaattgaaaaacgaccttttaaagaaatataacgtagaataccaagaatatttgcaaagcaaaaacaaatataaagctgaaattctcaaaaaattggagcatcagagattgatagaggcagaaaggaagcggattgctcagatgcgccagcagcagctagaatcggagcagtttctgtttttcgaagatcaactcaagaagcaagagttagcccgaggtcaaatgcgaagtcagcaaacctcagggctgtcagagcagattgatgggagcgctttgtcctgcttttccacacaccagaacaattccttgctgaatgtatttgcagatcaacctaataaaagtgatgcaaccaattatgctagccactctcctcctgtaaacagggccttaacgccagctgctactctaagtgctgttcagaatttagtggttgaaggactgcgatgtgtagttttgccagaagatctttgccacaaatttctgcaactggcagaatctaatacagtgagaggaatagaaacctgtggaatactctgtggaaaactgacacataatgaatttactattacccatgtaattgtgccaaagcagtctgcgggaccagactattgtgacatggagaatgtagaggaattattcaatgttcaggatcaacatgatctcctcactctaggatggatccatacacatcccactcaaactgcatttttatccagcgttgatcttcacactcactgttcctatcaactcatgttgccagaggccattgccattgtttgctcaccaaagcataaagacactggcatcttcaggctcaccaatgctggcatgcttgaggtttctgcttgtaaaaaaaagggctttcatccacacaccaaggagcccaggctgttcagtatatgcaaacatgtgttggtaaaagacataaaaataattgtgttggatctgaggtgatatgttctgaatgtaagcaccgtcaacatcagacacctactcatggacatgtggttgccggattttcttaagatgtttccagaaatgactgatattttatatttatacattttagatgacaaagcttgatatttattgctgttgcacattttaaagttttctttttgggttgctctgtgtcaagagaggttacatggtgttaaatcggtacctgataatgtacccaaatactatggccagataataaattgtgctgcaaacaacatgtcttgtattta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:57559 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:57559 -> Molecular function: GO:0008237 [metallopeptidase activity] evidence: IEA
            GeneID:57559 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:57559 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_065850 -> EC 3.1.2.15

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.