GGRNA Home | Help | Advanced search

2020-10-24 07:11:42, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020715               6540 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens pleckstrin homology domain containing, family H (with
            MyTH4 domain) member 1 (PLEKHH1), mRNA.
ACCESSION   NM_020715 XM_375087
VERSION     NM_020715.2  GI:110225343
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6540)
  AUTHORS   Demirkan,A., van Duijn,C.M., Ugocsai,P., Isaacs,A.,
            Pramstaller,P.P., Liebisch,G., Wilson,J.F., Johansson,A., Rudan,I.,
            Aulchenko,Y.S., Kirichenko,A.V., Janssens,A.C., Jansen,R.C.,
            Gnewuch,C., Domingues,F.S., Pattaro,C., Wild,S.H., Jonasson,I.,
            Polasek,O., Zorkoltseva,I.V., Hofman,A., Karssen,L.C.,
            Struchalin,M., Floyd,J., Igl,W., Biloglav,Z., Broer,L., Pfeufer,A.,
            Pichler,I., Campbell,S., Zaboli,G., Kolcic,I., Rivadeneira,F.,
            Huffman,J., Hastie,N.D., Uitterlinden,A., Franke,L., Franklin,C.S.,
            Vitart,V., Nelson,C.P., Preuss,M., Bis,J.C., O'Donnell,C.J.,
            Franceschini,N., Witteman,J.C., Axenovich,T., Oostra,B.A.,
            Meitinger,T., Hicks,A.A., Hayward,C., Wright,A.F., Gyllensten,U.,
            Campbell,H. and Schmitz,G.
  CONSRTM   DIAGRAM Consortium; CARDIoGRAM Consortium; CHARGE Consortium;
            EUROSPAN consortium
  TITLE     Genome-wide association study identifies novel loci associated with
            circulating phospho- and sphingolipid concentrations
  JOURNAL   PLoS Genet. 8 (2), E1002490 (2012)
   PUBMED   22359512
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA056171.1, AB033026.1, AI792090.1 and AL132640.4.
            On Jul 7, 2006 this sequence version replaced gi:55741446.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC146787.1, AB033026.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-24                DA056171.1         93-116
            25-1179             AB033026.1         1-1155
            1180-1382           AI792090.1         210-412
            1383-4086           AB033026.1         1359-4062
            4087-6540           AL132640.4         53770-56223         c
FEATURES             Location/Qualifiers
     source          1..6540
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q24.1"
     gene            1..6540
                     /gene="PLEKHH1"
                     /note="pleckstrin homology domain containing, family H
                     (with MyTH4 domain) member 1"
                     /db_xref="GeneID:57475"
                     /db_xref="HGNC:17733"
                     /db_xref="HPRD:17862"
     exon            1..108
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            109..268
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     CDS             143..4237
                     /gene="PLEKHH1"
                     /note="PH domain-containing family H member 1"
                     /codon_start=1
                     /product="pleckstrin homology domain-containing family H
                     member 1"
                     /protein_id="NP_065766.1"
                     /db_xref="GI:55741447"
                     /db_xref="CCDS:CCDS45128.1"
                     /db_xref="GeneID:57475"
                     /db_xref="HGNC:17733"
                     /db_xref="HPRD:17862"
                     /translation="
MAELKVEAPASVDWQKRCLTLETQLFRFRLQASKIRELLADKMQELEQRLLEAEQRAENAETQVGVMEEKVKLSNLKNVDSEGSLHRKYQELLKAIKGKDELISQLEAQLEKQKQMRAEEAKTVQEKAAKIKEWVTLKLAKLEMENQHLKSHNQRLVEQVGSLQDALEAIQIAPSRKLLVPPYGAAEQDSVPSEPGIQPMGQDSGSQAQGLKAAVLAPSPGALQSKDSVSEAASPLEDSSSSTVHSGETVEAKPLQPHLGRESPPHQPCMKLLTFRCSSASWGEGLVTAQRGMLPGTKTSAREGGPGSSLTLPKVRAPGTPRDSIQLAKRHHSQPQVGHGHFGRVVNIETEAFSALHPSGLPELESRARSREEPEKMEMEEPPPAGKNEERESPKALGAELEEVELGNKPPTPPLHQFSSWESRIYAVATSGMRLSDMSPRSNTACCASSPPALVSPGSFSGLVYKNVTVPVYTALKGRATQISNMPFMDESSGSDDDCSSQASFRISVPSSESRKTSGLGSPRAIKRGVSMSSLSSEGDYAIPPDACSLDSDYSEPEHKLQRTSSYSTDGLGLGGESLEKSGYLLKMGSQVKTWKRRWFVLRQGQIMYYKSPSDVIRKPQGQVDLNSRCQIVRGEGSQTFQLISEKKTYYLTADSPSLLEEWIRVLQSLLKVQATGPPALLRGGTKPTVKGWLTKVKHGHSKVVWCALVGKIFYYYRSHEDKRPLGCLPVRDAHIEEVDRSCDSDEDYEAGGTRRLLSSHCTLVIHPTEHSPTYLLIGTKHEKDTWLYHLTVAAGGSSAKVGTAYEQLIGKLMDGEGDPDSPLWRHPMLCYSKDGLYASLTTLPSEALQTEALKLFKSCQLFINVPVEAASVDYHVSLAQTALQVCLVHPELQSEIYCQLMKQTSCRPPQKYSLMQCWQLLALCAPLFLPQHHFLWYVKQQLQRHADPRSETGQYATYCQRAVERTLRTGEREARPSRMEVVSILLRNPFHHSLPFSIPVHFTNGTYHVVGFDGSSTVDEFLQRLNQEIGMRKPSHSGFALFTDDPSGRDLEHCLQGSVKICDAISKWEQAMKELHPGKSEGGTRVVKLMYKNRLYFRSQVKGETDRERLLLASQTSREIVAGRFPINKELALEMAALMAQVEYGDLEKPALPGPGGTSPAKAQHLLQQVLDRFHPRRYRHGAPAEQLRHLADMLTTKWATLQGCSPPECIRIYLTVARKWPFFGAKLFAAQPAQLSSKENALVWIAVNEDGVSILDHNTMQVHITYPYSSVTTFGGCRDDFMLVIRSIPDKSSGKSHIEKLIFRMAAPKIAEATFIMASYMNHCTTTVNPPTNPPGACQLWELDGRQFFSSVSCATKGPTLL
"
     misc_feature    410..655
                     /gene="PLEKHH1"
                     /note="TATA element modulatory factor 1 DNA binding;
                     Region: TMF_DNA_bd; pfam12329"
                     /db_xref="CDD:204884"
     misc_feature    1901..2152
                     /gene="PLEKHH1"
                     /note="Pleckstrin homology (PH) domain; Region: PH;
                     cd00821"
                     /db_xref="CDD:176270"
     misc_feature    order(1901..1903,1928..1948,1955..1975,2006..2020,
                     2030..2044,2060..2074,2075..2077,2087..2104,2117..2152)
                     /gene="PLEKHH1"
                     /note="core domain; other site"
                     /db_xref="CDD:176270"
     misc_feature    order(1928..1930,1934..1942)
                     /gene="PLEKHH1"
                     /note="putative lipid binding motif; other site"
                     /db_xref="CDD:176270"
     misc_feature    2213..2515
                     /gene="PLEKHH1"
                     /note="Pleckstrin homology (PH) domain; Region: PH;
                     cd00821"
                     /db_xref="CDD:176270"
     misc_feature    order(2213..2233,2255..2269,2276..2296,2321..2335,
                     2345..2359,2429..2443,2447..2452,2462..2476,2489..2515)
                     /gene="PLEKHH1"
                     /note="core domain; other site"
                     /db_xref="CDD:176270"
     misc_feature    order(2228..2230,2255..2263)
                     /gene="PLEKHH1"
                     /note="putative lipid binding motif; other site"
                     /db_xref="CDD:176270"
     misc_feature    2636..3100
                     /gene="PLEKHH1"
                     /note="Domain in Myosin and Kinesin Tails; Region: MyTH4;
                     smart00139"
                     /db_xref="CDD:197536"
     misc_feature    3137..3832
                     /gene="PLEKHH1"
                     /note="Band 4.1 homologues; Region: B41; smart00295"
                     /db_xref="CDD:197635"
     misc_feature    3455..3832
                     /gene="PLEKHH1"
                     /note="FERM central domain; Region: FERM_M; pfam00373"
                     /db_xref="CDD:201187"
     exon            269..331
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            332..481
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            482..565
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            566..647
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            648..1405
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1406..1484
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1485..1576
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1577..1727
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1728..1870
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1871..1981
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            1982..2068
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2069..2230
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2231..2311
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2312..2494
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2495..2603
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2604..2716
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2717..2893
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2894..2991
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            2992..3169
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3170..3325
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3326..3426
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3427..3568
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3569..3711
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3712..3841
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3842..3928
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            3929..4075
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     exon            4076..6540
                     /gene="PLEKHH1"
                     /inference="alignment:Splign:1.39.8"
     STS             4653..4741
                     /gene="PLEKHH1"
                     /standard_name="D8S2279"
                     /db_xref="UniSTS:473907"
     STS             4723..4827
                     /gene="PLEKHH1"
                     /standard_name="D11S3114"
                     /db_xref="UniSTS:152207"
     variation       complement(6377)
                     /gene="PLEKHH1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10162"
     variation       complement(6435)
                     /gene="PLEKHH1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1803668"
ORIGIN      
gcggcagcccgggactccggcgagagcgacgcaaggtcggctgcggcggcggcccgagggcgcccgtgtgcccagtgcgcggcggggacggccgcgagctcgctggagggctccccagaataatccagaagtcgattccatcatggcagaactcaaggtggaggcgccggccagcgtagactggcagaaacgctgcctgaccctggaaactcagcttttccggttccgcctacaggccagcaagataagggagctgctggctgacaagatgcaggagctggagcagaggctgctggaggcagagcagagagcagagaacgctgagacccaggtgggtgtcatggaagagaaggtaaaactatccaatctgaagaatgtggactctgaggggagcctgcaccggaaataccaagaattgctgaaagccataaagggcaaagatgagctcatcagccagctagaggctcagctggagaagcagaagcagatgagggcagaggaagcaaaaactgttcaagaaaaagctgcaaagatcaaggaatgggtgacactcaagttggcaaagcttgagatggagaatcagcatctgaaaagccataatcagcgcctggtggagcaggtgggatcccttcaagatgcgctagaagctattcagatagctccttcacggaagctgctggtgcccccctacggagctgcagagcaggattctgtcccttcagagccgggaatccagcctatgggccaggacagtggctcccaggcccagggtctgaaggcagctgtgcttgcaccttccccaggtgccctgcagagcaaggactctgtttctgaagcagcaagccccttggaggattctagttccagcacggtccattctggggaaacagtagaggccaagccccttcaacctcatctgggaagagagagccctccccaccagccatgcatgaagcttcttaccttcagatgtagttcagcttcctggggtgagggtctggttactgctcagagagggatgctccctgggacaaagacctctgccagggaaggtggtcctggcagcagtctgaccctaccaaaggtgcgggctcctggcaccccgcgggacagcatccagttggccaaaaggcaccacagccagccccaggtgggccatgggcactttggccgtgtggtgaacattgagactgaggccttctcagccctccacccctctggccttcctgagctggagtcccgagctaggtcccgggaggaaccagagaagatggagatggaggagccacccccagcagggaagaatgaggaaagagagagcccaaaggcccttggagctgagctggaggaagtggagctgggtaacaagccacctacacccccgctgcaccagttttcatcctgggagagccggatctatgctgtggccacatcgggcatgcggctctcagatatgtctcccagaagtaatactgcatgctgcgcttcaagccctcctgcccttgtttcccctgggtctttctctggcctggtctacaagaatgtcactgtgcctgtctacacagcactgaaggggagagctacacagatcagcaacatgccctttatggacgagtcctctgggtctgacgatgactgcagctctcaggcgagtttccgaatctcggtcccctcctctgagtccaggaagaccagcggactaggcagcccccgggccatcaagagaggcgtctccatgtcctcactgagctccgagggtgactacgccatccccccggacgcctgctcactggacagtgactactcagagcctgagcacaaactgcagcgcacctcatcctactccaccgacgggctgggcctgggcggggagtcactggagaagtcgggctacctgctgaaaatggggagccaggtgaagacgtggaagaggcgctggtttgtcctgagacagggacagattatgtactacaagtccccgagtgatgtcatccggaaacctcaaggccaagtggatctgaactcccgctgccaaattgttcgaggggagggttcacagacgtttcagctcatctctgagaagaaaacctactacctgacggccgattcacccagcctgctggaggagtggatccgagtactccagagcctgctgaaggtgcaggccaccgggcctccagctctgcttcggggtggcaccaagcccaccgtgaagggctggctgaccaaggtaaagcatggccactccaaggtggtctggtgcgctcttgttgggaaaatcttctactactatcggagccatgaggacaagcgacccctgggctgcctgcctgtgcgggatgcgcacatagaggaagtagatcgatcctgtgactcagacgaggactatgaggctggaggaaccagacggttgctttcctcccactgcaccctggtgatccaccccacagagcacagccccacctacctcctcattggcaccaagcatgaaaaggatacgtggctctaccacctcacagtggctgcaggtggcagcagtgccaaggtgggcactgcctatgagcagctcattggaaaactgatggatggtgaaggagatccagattcgccgctctggaggcaccccatgctgtgctacagcaaagacggcctatacgcctccctcaccaccctgccctctgaggccttgcagacggaggccctcaagctcttcaagtcctgccagctcttcatcaacgtgccggtggaagctgcctcggtggactaccatgtgtccctggcccagaccgcactgcaggtctgcctggttcaccccgagctgcagagtgagatctactgccaactcatgaagcagaccagctgccgcccacctcagaagtactccctcatgcagtgctggcagctcctcgctctgtgtgctccacttttcctgcctcagcatcacttcctctggtatgtcaagcagcagctccaacgccatgcagatcccagaagtgaaactggccagtatgccacctactgccagcgggcagtggagcggaccctgcggaccggggagcgggaagccaggccatcgcgcatggaagtggtgtccatcctgctgcgtaaccccttccaccactccttgcccttcagcatccccgtgcactttaccaacgggacttaccatgtggttggttttgacggctcttccacggttgatgagttcctccagcggctgaaccaggagataggcatgagaaagccatcccactctggctttgccctcttcacggacgatccctcgggcagggacctggagcactgcctgcagggaagtgtcaagatctgtgatgccatctccaagtgggaacaagccatgaaggagctgcaccccggaaagtctgagggtgggacacgcgtcgtgaagctgatgtacaagaacaggctgtactttcgcagtcaagtcaaaggggagacggaccgagaacggctgctccttgcctctcaaaccagtagagagatagtggcagggaggtttcctatcaacaaggaattggctcttgagatggctgccctgatggcccaggtagaatatggggacttggagaagcctgccctgccaggccctggaggcacatcccctgccaaggctcagcatcttctccagcaggtcctagacaggttccaccccaggcgctatagacatggggcccccgctgaacagctgaggcacctggcagatatgttgaccacaaaatgggcaacattgcaaggatgctcccctcctgagtgcatccgcatctacctgaccgtggccaggaaatggcctttctttggtgctaaactttttgctgctcagcctgcccagctgtcttccaaggagaacgctctggtgtggattgctgtgaatgaggatggcgtcagcatcctggaccacaacactatgcaagtgcacatcacttacccctactcttcagtgacaacgtttggtggctgcagggatgacttcatgcttgtgattagatctatcccagacaagagctctggaaaaagccacattgagaagttgatcttccggatggctgctcccaagattgcagaagctaccttcatcatggccagctatatgaaccattgcactacaactgtgaacccccccaccaacccacccggagcctgccagctgtgggaactggatggacgacagttcttttcttctgtttcctgtgctaccaaggggccaacgttgctgtgaatatttctcctacccgattccccaacaccactagtgcctctggatttagagatatatatcctagggtatgatactactgtgacgggtctaacagcccccggctactcttgttctgtgaaatgtgtattttagtctctgtgaagcctttactctctaggtgccttataatgtttcagggctcaactttttaaaatccagacccagtgttaaaaccatttattccttttttcataagaataatgactccagatgctacctgattctagacatagacagggatgatccactgttactgagggcatcagtgctataagttaaggctttctgcactggtactctcaaggaagctaattttctttctggggggggcgggggacacagtgtcactatgtcacccagtccacagggttcaagcaattctcctgcctcagccttcggagtggctgggattacaggtgtgcgccaccatgcccggctaatttttgtatttttagtagagacggggtttcaccatgttggccaggctggtctcgaactcctgacctcaggtgatctgcccactttggcctcccaaagtgctgggattacaggcatgagccatcgcccagcccagaagctaattttttaatattgtatatggtcttatttatacttgaagttttgtgaacgtcgctaaacaggataggactaaaatttccaattctcctacactctgtcagaagcctagaactcactaaactgggctgcctttcccaaatgggaaaggtgctgacagagttggagaaaaaagaatagactcatttttccccattattggtatgtaggcattggtacagccccttctggggcagtctttgcaggataacatgctatacctgctaagattcaagctgttttcctcacactggactttaggccaaacccagtaccacgcaatgtgcaagcaagggcaggaggtaggtccaatctgacccctccctgtctcattttaatgactggacagcgctcggtgaaggctgtgttcactgtagtgggccatcatttgtttccttcttcttgtaaaagaccaagcaaatgcactctgctttttgctgctgtaagaccaccaaaaatgagtcagaaacacagaagactatttcaggcatgtgggcctggatatgctccttgagacttctggcaaacttctgctgggaattagtttgagggtgagggtacatatgtgacatttgccctagcctaagagtagcaggtaaaaaaaagtttctttcatcttttgccttactgataataccataatccccctcaattcagaccttctgattgagtgcagaggagactagacagtctcctctagacaggttgtagacacaccctcccctaacaaaaacaaaacgaaagagttcatactctgattttccaacatctaggaaactgagttttatttcctagctctaaggcagccttactatatgtcagtaaagtgctgaaaactgtatatttagcagtagcacccaaaaccaagcctttaaccccaacaatgtgtgtatcttttgcacagcaaaaactgcgaggccagaactagtttatctgaacacctcagctgctgtaagcttctcctctctcaccccgtaaactgacaagcatgatgaaaaaagaagcacatccaagtttctgcctcttttaaatgtacttgactttgcaaggcaagtagttttacagccatttctgttcacacttttcaccccacaacttggggatctagctgagacatttctacctcgaacaagtcacatgtaccacaggttcctgaataattcctgcagggctggtgacagacataacagctctggttttataatatcttgggtatctctaaggccaataaggataacattatctacccagagagtttagaagaaaagtaggagtccaaaggaagagtaaacaagaatggagctgtgttcacactgaatttggggtcaatctatttcccccaccctctctcctccccaacccttcaggaaccctttagtttattaatcttatacagaagaaactaacttagaaacaaaggattcaatatttgcttatttattctttgttaacatgagagtcccatgtctgaaaaccaaagtccaatttctgtctggccttttgtctcatccttcttggcaaaagtagcttttgaactgatataaaaaaaaatgctgagtaacagaaaagtattaatgtgcttgacaccatgactgaaatactatgatcttgtttgtcaataaaaagcagctatctgtgaaccaggtaac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:57475 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
            GeneID:57475 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.