GGRNA Home | Help | Advanced search

2020-10-26 19:43:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020214               2631 bp    mRNA    linear   PRI 04-MAY-2013
DEFINITION  Homo sapiens poly (ADP-ribose) polymerase family, member 6 (PARP6),
            mRNA.
ACCESSION   NM_020214
VERSION     NM_020214.2  GI:94536837
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2631)
  AUTHORS   Tuncel,H., Tanaka,S., Oka,S., Nakai,S., Fukutomi,R., Okamoto,M.,
            Ota,T., Kaneko,H., Tatsuka,M. and Shimamoto,F.
  TITLE     PARP6, a mono(ADP-ribosyl) transferase and a negative regulator of
            cell proliferation, is involved in colorectal cancer development
  JOURNAL   Int. J. Oncol. 41 (6), 2079-2086 (2012)
   PUBMED   23042038
  REMARK    GeneRIF: PARP6, a mono(ADP-ribosyl) transferase and a negative
            regulator of cell proliferation, is involved in colorectal cancer
            development, PARP6-positive colorectal cancer had a good prognosis.
REFERENCE   2  (bases 1 to 2631)
  AUTHORS   Ame,J.C., Spenlehauer,C. and de Murcia,G.
  TITLE     The PARP superfamily
  JOURNAL   Bioessays 26 (8), 882-893 (2004)
   PUBMED   15273990
  REMARK    Review article
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from DB121441.1,
            BC110902.1 and AK022547.1.
            On May 4, 2006 this sequence version replaced gi:19482155.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC110902.1 [ECO:0000331]
            RNAseq introns       :: single sample supports all introns
                                    ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-422               DB121441.1         43-464
            423-1052            BC110902.1         12-641
            1053-1767           AK022547.1         817-1531
            1768-2631           BC110902.1         1357-2220
FEATURES             Location/Qualifiers
     source          1..2631
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q23"
     gene            1..2631
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="poly (ADP-ribose) polymerase family, member 6"
                     /db_xref="GeneID:56965"
                     /db_xref="HGNC:26921"
     exon            1..265
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            266..462
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    445..447
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="upstream in-frame stop codon"
     CDS             460..2352
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /EC_number="2.4.2.30"
                     /note="PARP-6; ADP-ribosyltransferase diphtheria
                     toxin-like 17"
                     /codon_start=1
                     /product="poly [ADP-ribose] polymerase 6"
                     /protein_id="NP_064599.2"
                     /db_xref="GI:94536838"
                     /db_xref="CCDS:CCDS10241.2"
                     /db_xref="GeneID:56965"
                     /db_xref="HGNC:26921"
                     /translation="
MDIKGQFWNDDDSEGDNESEEFLYGVQGSCAADLYRHPQLDADIEAVKEIYSENSVSIREYGTIDDVDIDLHINISFLDEEVSTAWKVLRTEPIVLRLRFSLSQYLDGPEPSIEVFQPSNKEGFGLGLQLKKILGMFTSQQWKHLSNDFLKTQQEKRHSWFKASGTIKKFRAGLSIFSPIPKSPSFPIIQDSMLKGKLGVPELRVGRLMNRSISCTMKNPKVEVFGYPPSPQAGLLCPQHVGLPPPARTSPLVSGHCKNIPTLEYGFLVQIMKYAEQRIPTLNEYCVVCDEQHVFQNGSMLKPAVCTRELCVFSFYTLGVMSGAAEEVATGAEVVDLLVAMCRAALESPRKSIIFEPYPSVVDPTDPKTLAFNPKKKNYERLQKALDSVMSIREMTQGSYLEIKKQMDKLDPLAHPLLQWIISSNRSHIVKLPLSRLKFMHTSHQFLLLSSPPAKEARFRTAKKLYGSTFAFHGSHIENWHSILRNGLVNASYTKLQLHGAAYGKGIYLSPISSISFGYSGMGKGQHRMPSKDELVQRYNRMNTIPQTRSIQSRFLQSRNLNCIALCEVITSKDLQKHGNIWVCPVSDHVCTRFFFVYEDGQVGDANINTQDPKIQKEIMRVIGTQVYTN
"
     misc_feature    1123..1533
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="ADP_ribosylating enzymes catalyze the transfer of
                     ADP_ribose from NAD+ to substrates. Bacterial toxins are
                     cytoplasmic and catalyze the transfer of a single
                     ADP_ribose unit to eukaryotic elongation factor 2, halting
                     protein synthesis and killing the cell; Region:
                     ADP_ribosyl; cd01341"
                     /db_xref="CDD:238651"
     misc_feature    order(1129..1143,1150..1152,1162..1164,1183..1191,
                     1195..1197,1258..1266,1312..1314,1510..1512)
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="nad+ binding pocket [chemical binding]; other site"
                     /db_xref="CDD:238651"
     misc_feature    1867..2241
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="ADP_ribosylating enzymes catalyze the transfer of
                     ADP_ribose from NAD+ to substrates. Bacterial toxins are
                     cytoplasmic and catalyze the transfer of a single
                     ADP_ribose unit to eukaryotic elongation factor 2, halting
                     protein synthesis and killing the cell; Region:
                     ADP_ribosyl; cd01341"
                     /db_xref="CDD:238651"
     misc_feature    order(1873..1887,1894..1896,1906..1908,1918..1926,
                     1930..1932,1978..1986,2014..2016,2197..2199)
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /note="nad+ binding pocket [chemical binding]; other site"
                     /db_xref="CDD:238651"
     exon            463..540
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            541..635
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            636..696
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            697..787
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            788..854
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            855..1004
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1005..1215
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1216..1269
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1270..1365
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1366..1458
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1459..1584
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1585..1650
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1651..1718
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1719..1767
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1768..1877
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1878..1950
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            1951..2020
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            2021..2100
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            2101..2164
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            2165..2249
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     exon            2250..2626
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /inference="alignment:Splign:1.39.8"
     variation       2397
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044132"
     variation       2487
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044144"
     variation       2533
                     /gene="PARP6"
                     /gene_synonym="ARTD17; PARP-6-B1; PARP-6-C; pART17"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044151"
ORIGIN      
caacagaaaccaagcagcaacagcccttggaaagaggctaaatttttcttgacttctgcagcaacaaagaccgtgaaaagttggcacttctggcctaacgctgccgtcatcctacccctcaccccagggcaacccaggctggacatttagtgcctccctctttattcctctgtgatcatccagatcagcacttgactgtttattttcaaatctcacgaacctcaccccaagatcttcacattctggatctcagctgctcttgaaggacagtgacttgttaccaccgcaacagcagagcctgccatccccaacagatcaccagttgtccctgacatcgtgccctaccttgtctccctttgtggtctcctaaatgcccatctcgttggccttggttcggctagtggtatggaggggtgctgcctagcactgacctgagagtgtgtgtgacccactgacccaatggacatcaaaggccagttctggaatgatgacgactcggagggagataatgaatcagaggaatttctctatggcgttcaggggagctgtgcagctgacctgtatcgacacccacagcttgatgcagacattgaagccgtgaaggagatctacagtgagaactctgtatccatcagagaatatggaactatcgatgacgtggacattgacctccacatcaacatcagcttcctcgatgaggaagtctctacagcctggaaggtcctccggacagaacctattgtgttgaggctgcgattttctctctcccagtacctagatggaccagaaccatccattgaggttttccagccatcaaataaggaaggatttgggctgggtcttcagttgaaaaagatcctgggtatgtttacatcccaacaatggaaacatctgagcaatgatttcttgaagacccagcaggagaagaggcacagttggttcaaggcaagtggtaccatcaagaagttccgagctggcctcagcatcttttcacccatccccaagtctcccagtttccctatcatacaggactccatgctgaaaggcaaactaggtgtaccagagcttcgggttgggcgcctcatgaaccgttccatctcctgtaccatgaagaaccccaaagtggaagtgtttggctaccctcccagcccccaggcaggtctcctgtgccctcagcacgtgggcctccctcccccagcacggacctctcctttggtcagtggtcactgcaagaacattcccactctggagtatggattcctcgttcagatcatgaagtatgcagaacagaggattccaacattgaatgagtactgtgtggtgtgtgatgagcagcatgtcttccaaaatggatctatgctgaagccagctgtctgtactcgtgaactatgcgttttctccttctacacactgggcgtcatgtctggagctgcagaggaggtggccactggagcagaggtggtggatctgctggtggccatgtgtagggcagctttagagtcccctagaaagagcatcatctttgagccttatccctctgtggtggaccccactgatcccaagactctggcctttaaccctaagaagaagaattatgagcggcttcagaaagctctggatagtgtgatgtctattcgggagatgacccagggctcatatttggaaatcaagaaacagatggacaagttggatcccctggcccatcctctcctgcagtggatcatctctagcaacaggtcacacattgtcaaactacctctcagcaggctgaagttcatgcacacctcacaccagttcctcctgctgagcagccctcctgccaaggaggctcggttccggaccgccaagaagctctatggcagcacctttgccttccatgggtcccacattgagaactggcattcgatcctgcgcaatgggctggtcaatgcatcctacaccaaactgcagctgcatggagcagcctatggcaaaggcatctacctgagccccatctccagtatttcctttggatactcaggaatgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatgaataccatcccccagacccgatccattcagtcacggttcctgcagagtcggaatctaaactgtatagcactttgtgaagtgattacatctaaggacctccagaagcatgggaacatctgggtgtgccctgtgtccgaccatgtctgcacaagattcttctttgtatatgaggatggtcaggtgggcgatgccaacattaatactcaggaccccaagatacagaaggaaatcatgcgtgtgatcggaactcaggtttacacaaactgagggggccccagccctcgtaccacccctgttaccccaggatccatctgccctcataaaagtgttcaggtacagcagctgaggctgccctgaggaatcaaggggccattaccaaggggcaggaaaaggatatgtaagaggtggccttcatggtagagcttgacccaagaactactccacattcggatggcccagactgactccatcccctgactttccctttgacttcaccctgtttgtaaataaaacaataaaatggaaggtgctgtggactggaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:56965 -> Molecular function: GO:0003950 [NAD+ ADP-ribosyltransferase activity] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_064599 -> EC 2.4.2.30

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.