GGRNA Home | Help | Advanced search

2024-03-29 18:39:40, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020066               6440 bp    mRNA    linear   PRI 29-JUN-2013
DEFINITION  Homo sapiens formin 2 (FMN2), mRNA.
ACCESSION   NM_020066 XM_371352
VERSION     NM_020066.4  GI:160707880
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6440)
  AUTHORS   Sherva,R., Tripodis,Y., Bennett,D.A., Chibnik,L.B., Crane,P.K., de
            Jager,P.L., Farrer,L.A., Saykin,A.J., Shulman,J.M. and Green,R.C.
  CONSRTM   The GENAROADS Consortium, and The Alzheimer's Disease Neuroimaging
            Initiative
  TITLE     Genome-wide association study of the rate of cognitive decline in
            Alzheimer's disease
  JOURNAL   Alzheimers Dement (2013) In press
   PUBMED   23535033
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 6440)
  AUTHORS   Yamada,K., Ono,M., Perkins,N.D., Rocha,S. and Lamond,A.I.
  TITLE     Identification and functional characterization of FMN2, a regulator
            of the cyclin-dependent kinase inhibitor p21
  JOURNAL   Mol. Cell 49 (5), 922-933 (2013)
   PUBMED   23375502
  REMARK    GeneRIF: results identify FMN2 as a crucial component in the
            regulation of p21 and consequent oncogene/stress-induced cell-cycle
            arrest in human cells.
REFERENCE   3  (bases 1 to 6440)
  AUTHORS   Del-Aguila,J.L., Beitelshees,A.L., Cooper-Dehoff,R.M.,
            Chapman,A.B., Gums,J.G., Bailey,K., Gong,Y., Turner,S.T.,
            Johnson,J.A. and Boerwinkle,E.
  TITLE     Genome-wide association analyses suggest NELL1 influences adverse
            metabolic response to HCTZ in African Americans
  JOURNAL   Pharmacogenomics J. (2013) In press
   PUBMED   23400010
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   4  (bases 1 to 6440)
  AUTHORS   Paternoster,L., Lorentzon,M., Lehtimaki,T., Eriksson,J.,
            Kahonen,M., Raitakari,O., Laaksonen,M., Sievanen,H., Viikari,J.,
            Lyytikainen,L.P., Mellstrom,D., Karlsson,M., Ljunggren,O.,
            Grundberg,E., Kemp,J.P., Sayers,A., Nethander,M., Evans,D.M.,
            Vandenput,L., Tobias,J.H. and Ohlsson,C.
  TITLE     Genetic determinants of trabecular and cortical volumetric bone
            mineral densities and bone microstructure
  JOURNAL   PLoS Genet. 9 (2), E1003247 (2013)
   PUBMED   23437003
REFERENCE   5  (bases 1 to 6440)
  AUTHORS   Zeth,K., Pechlivanis,M., Samol,A., Pleiser,S., Vonrhein,C. and
            Kerkhoff,E.
  TITLE     Molecular basis of actin nucleation factor cooperativity: crystal
            structure of the Spir-1 kinase non-catalytic C-lobe domain
            (KIND)*formin-2 formin SPIR interaction motif (FSI) complex
  JOURNAL   J. Biol. Chem. 286 (35), 30732-30739 (2011)
   PUBMED   21705804
  REMARK    GeneRIF: analysis of the molecular basis of the Spir1/formin-2
            interaction
REFERENCE   6  (bases 1 to 6440)
  CONSRTM   Wellcome Trust Case Control Consortium
  TITLE     Genome-wide association study of 14,000 cases of seven common
            diseases and 3,000 shared controls
  JOURNAL   Nature 447 (7145), 661-678 (2007)
   PUBMED   17554300
REFERENCE   7  (bases 1 to 6440)
  AUTHORS   Ryley,D.A., Wu,H.H., Leader,B., Zimon,A., Reindollar,R.H. and
            Gray,M.R.
  TITLE     Characterization and mutation analysis of the human formin-2 (FMN2)
            gene in women with unexplained infertility
  JOURNAL   Fertil. Steril. 83 (5), 1363-1371 (2005)
   PUBMED   15866570
  REMARK    GeneRIF: It is likely that FMN2 has the same function as Fmn2 in
            the mouse, i.e., maintenance of the meiotic spindle.
            Identification of patients with meiosis I arrest is necessary to
            determine whether FMN2 mutations are a cause of unexplained
            infertility.
REFERENCE   8  (bases 1 to 6440)
  AUTHORS   Katoh,M. and Katoh,M.
  TITLE     Characterization of FMN2 gene at human chromosome 1q43
  JOURNAL   Int. J. Mol. Med. 14 (3), 469-474 (2004)
   PUBMED   15289902
  REMARK    GeneRIF: FMN2 was characterized at human chromosome 1q43.
REFERENCE   9  (bases 1 to 6440)
  AUTHORS   Leader,B., Lim,H., Carabatsos,M.J., Harrington,A., Ecsedy,J.,
            Pellman,D., Maas,R. and Leder,P.
  TITLE     Formin-2, polyploidy, hypofertility and positioning of the meiotic
            spindle in mouse oocytes
  JOURNAL   Nat. Cell Biol. 4 (12), 921-928 (2002)
   PUBMED   12447394
REFERENCE   10 (bases 1 to 6440)
  AUTHORS   Leader,B. and Leder,P.
  TITLE     Formin-2, a novel formin homology protein of the cappuccino
            subfamily, is highly expressed in the developing and adult central
            nervous system
  JOURNAL   Mech. Dev. 93 (1-2), 221-231 (2000)
   PUBMED   10781961
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB476003.1, AL359918.43, AF218941.1, DN990332.1, AF218942.1 and
            AF225426.1.
            On Nov 20, 2007 this sequence version replaced gi:74136553.
            
            Summary: Formin homology (FH) domain proteins (see FMN1; MIM
            136535) play a role in cytoskeletal organization and/or
            establishment of cell polarity.[supplied by OMIM, Apr 2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns ERS025084,
                              ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-489               DB476003.1         1-489
            490-1410            AL359918.43        74553-75473
            1411-1637           AF218941.1         1-227
            1638-1638           AL359918.43        75701-75701
            1639-2405           AF218941.1         229-995
            2406-4003           AL359918.43        189172-190769
            4004-4506           DN990332.1         8-510
            4507-6417           AF218942.1         7-1917
            6418-6440           AF225426.1         1941-1963
FEATURES             Location/Qualifiers
     source          1..6440
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q43"
     gene            1..6440
                     /gene="FMN2"
                     /note="formin 2"
                     /db_xref="GeneID:56776"
                     /db_xref="HGNC:14074"
                     /db_xref="MIM:606373"
     exon            1..1840
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       19
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12727981"
     variation       77
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6675871"
     variation       193
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371374779"
     CDS             226..5394
                     /gene="FMN2"
                     /codon_start=1
                     /product="formin-2"
                     /protein_id="NP_064450.3"
                     /db_xref="GI:160707881"
                     /db_xref="CCDS:CCDS31069.2"
                     /db_xref="GeneID:56776"
                     /db_xref="HGNC:14074"
                     /db_xref="MIM:606373"
                     /translation="
MGNQDGKLKRSAGDALHEGGGGAEDALGPRDVEATKKGSGGKKALGKHGKGGGGGGGGGESGKKKSKSDSRASVFSNLRIRKNLSKGKGAGGSREDVLDSQALQTGELDSAHSLLTKTPDLSLSADEAGLSDTECADPFEVTGPGGPGPAEARVGGRPIAEDVETAAGAQDGQRTSSGSDTDIYSFHSATEQEDLLSDIQQAIRLQQQQQQQLQLQLQQQQQQQQLQGAEEPAAPPTAVSPQPGAFLGLDRFLLGPSGGAGEAPGSPDTEQALSALSDLPESLAAEPREPQQPPSPGGLPVSEAPSLPAAQPAAKDSPSSTAFPFPEAGPGEEAAGAPVRGAGDTDEEGEEDAFEDAPRGSPGEEWAPEVGEDAPQRLGEEPEEEAQGPDAPAAASLPGSPAPSQRCFKPYPLITPCYIKTTTRQLSSPNHSPSQSPNQSPRIKRRPEPSLSRGSRTALASVAAPAKKHRADGGLAAGLSRSADWTEELGARTPRVGGSAHLLERGVASDSGGGVSPALAAKASGAPAAADGFQNVFTGRTLLEKLFSQQENGPPEEAEKFCSRIIAMGLLLPFSDCFREPCNQNAQTNAASFDQDQLYTWAAVSQPTHSLDYSEGQFPRRVPSMGPPSKPPDEEHRLEDAETESQSAVSETPQKRSDAVQKEVVDMKSEGQATVIQQLEQTIEDLRTKIAELERQYPALDTEVASGHQGLENGVTASGDVCLEALRLEEKEVRHHRILEAKSIQTSPTEEGGVLTLPPVDGLPGRPPCPPGAESGPQTKFCSEISLIVSPRRISVQLDSHQPTQSISQPPPPPSLLWSAGQGQPGSQPPHSISTEFQTSHEHSVSSAFKNSCNIPSPPPLPCTESSSSMPGLGMVPPPPPPLPGMTVPTLPSTAIPQPPPLQGTEMLPPPPPPLPGAGIPPPPPLPGAGILPLPPLPGAGIPPPPPLPGAAIPPPPPLPGAGIPLPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGVGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPRVGIPPPPPLPGAGIPPPPPLPGAGIPPPPPLPGVGIPPPPPLPGVGIPPPPPLPGAGIPPPPPLPGMGIPPAPAPPLPPPGTGIPPPPLLPVSGPPLLPQVGSSTLPTPQVCGFLPPPLPSGLFGLGMNQDKGSRKQPIEPCRPMKPLYWTRIQLHSKRDSSTSLIWEKIEEPSIDCHEFEELFSKTAVKERKKPISDTISKTKAKQVVKLLSNKRSQAVGILMSSLHLDMKDIQHAVVNLDNSVVDLETLQALYENRAQSDELEKIEKHGRSSKDKENAKSLDKPEQFLYELSLIPNFSERVFCILFQSTFSESICSIRRKLELLQKLCETLKNGPGVMQVLGLVLAFGNYMNGGNKTRGQADGFGLDILPKLKDVKSSDNSRSLLSYIVSYYLRNFDEDAGKEQCLFPLPEPQDLFQASQMKFEDFQKDLRKLKKDLKACEVEAGKVYQVSSKEHMQPFKENMEQFIIQAKIDQEAEENSLTETHKCFLETTAYFFMKPKLGEKEVSPNAFFSIWHEFSSDFKDFWKKENKLLLQERVKEAEEVCRQKKGKSLYKIKPRHDSGIKAKISMKT
"
     misc_feature    4072..5244
                     /gene="FMN2"
                     /note="Formin Homology 2 Domain; Region: FH2; pfam02181"
                     /db_xref="CDD:202141"
     misc_feature    4075..5358
                     /gene="FMN2"
                     /note="Formin Homology 2 Domain; Region: FH2; smart00498"
                     /db_xref="CDD:197762"
     variation       256
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200734668"
     variation       358..359
                     /gene="FMN2"
                     /replace=""
                     /replace="cgg"
                     /db_xref="dbSNP:10613472"
     variation       383..384
                     /gene="FMN2"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:140531536"
     variation       385..386
                     /gene="FMN2"
                     /replace=""
                     /replace="cgg"
                     /db_xref="dbSNP:71929261"
     variation       385
                     /gene="FMN2"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:35817759"
     variation       389..391
                     /gene="FMN2"
                     /replace=""
                     /replace="gcg"
                     /db_xref="dbSNP:72215772"
     variation       401
                     /gene="FMN2"
                     /replace=""
                     /replace="cgg"
                     /db_xref="dbSNP:71168893"
     variation       405
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199572295"
     variation       451
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201857219"
     variation       477
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200561900"
     variation       501
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145799385"
     variation       546
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376733678"
     variation       563
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372489487"
     variation       588
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112904598"
     variation       609
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200157875"
     variation       624
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375101837"
     variation       651
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143096048"
     variation       662
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138394305"
     variation       693
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370945971"
     variation       739
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142782397"
     variation       756
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148480631"
     variation       800
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150505248"
     variation       843
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200364388"
     variation       921
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11583501"
     variation       928
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149103365"
     variation       987
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142232913"
     variation       1003
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147858483"
     variation       1026
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369650259"
     variation       1108
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201538863"
     variation       1395
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202231609"
     variation       1407
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372473032"
     variation       1454
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201437013"
     variation       1469
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200347646"
     variation       1484
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146681532"
     variation       1488
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374512507"
     variation       1509
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150033699"
     variation       1514
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201430864"
     variation       1519
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368925775"
     variation       1575
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377516551"
     variation       1577
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145379416"
     variation       1583
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147961923"
     variation       1591
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141492081"
     variation       1597
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142335257"
     variation       1602
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138052423"
     variation       1634
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201558855"
     variation       1638
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10926124"
     variation       1653
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374209120"
     variation       1670
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377670694"
     variation       1748
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376836605"
     variation       1761..1762
                     /gene="FMN2"
                     /replace=""
                     /replace="gggggg"
                     /db_xref="dbSNP:139188401"
     exon            1841..2007
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       1848
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367849953"
     variation       1857
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372095380"
     variation       1876
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370593818"
     variation       1878
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149514160"
     variation       1882
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201654893"
     variation       1895
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113562797"
     variation       1914
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141488751"
     variation       1915
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147501995"
     variation       1938
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368340532"
     variation       1941
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372544106"
     variation       1944
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200336233"
     variation       1972
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146195271"
     exon            2008..2155
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       2028
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375865107"
     variation       2055
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3765588"
     variation       2056
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200182734"
     variation       2094
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147945249"
     variation       2109
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369120788"
     variation       2121
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141897898"
     exon            2156..2211
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       2163
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74784382"
     variation       2183
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141043862"
     variation       2187
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144870942"
     variation       2191
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199730080"
     variation       2192
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371725737"
     exon            2212..4145
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       2221
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141879002"
     variation       2248
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370558399"
     variation       2325
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145252718"
     variation       2337
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:137903301"
     variation       2348
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375178797"
     variation       2355
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149459435"
     variation       2368
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76382773"
     variation       2376
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201885010"
     variation       2392
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201575501"
     variation       2399
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142397272"
     variation       2416
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147518212"
     variation       2425
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145706266"
     variation       2426
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140911005"
     variation       2427
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148757660"
     variation       2431
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148963860"
     variation       2448
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144753167"
     variation       2454
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368104157"
     variation       2456
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200185606"
     variation       2467
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200439578"
     variation       2471
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371967368"
     variation       2481
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140392779"
     variation       2482
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367554600"
     variation       2529
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371254127"
     variation       2534
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368527329"
     variation       2551
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148060493"
     variation       2554
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201800161"
     variation       2582
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201048870"
     variation       2589
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372839255"
     variation       2616
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200499808"
     variation       2617
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370148847"
     variation       2671
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150519570"
     variation       2672
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149284185"
     variation       2696
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140042858"
     variation       2729
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147318481"
     variation       2742
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:10926166"
     variation       2758
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146579158"
     variation       2797
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140315493"
     variation       2800
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145077825"
     variation       2815
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114291166"
     variation       2820
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143847498"
     variation       2849
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202173304"
     variation       2881
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146945154"
     variation       2882
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146874723"
     variation       2952..2953
                     /gene="FMN2"
                     /replace=""
                     /replace="ccccct"
                     /db_xref="dbSNP:200863572"
     variation       2959
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186784023"
     variation       2961
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72475042"
     variation       2962..2964
                     /gene="FMN2"
                     /replace=""
                     /replace="cct"
                     /db_xref="dbSNP:201217362"
     variation       2988
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200259735"
     variation       2993
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149443295"
     variation       2997
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148496994"
     variation       3007
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150996647"
     variation       3026
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140879072"
     variation       3043
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371697625"
     variation       3045
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145628188"
     variation       3046
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141094573"
     variation       3047
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4997328"
     variation       3048
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188083977"
     variation       3053
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199628038"
     variation       3054
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4997329"
     variation       3059
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193049501"
     variation       3064
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150891575"
     variation       3065
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201741828"
     variation       3069
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142725738"
     variation       3078
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146070457"
     variation       3079
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367627381"
     variation       3080..3113
                     /gene="FMN2"
                     /replace=""
                     /replace="gaatacctcctccgccccctctacccggagcgg"
                     /db_xref="dbSNP:71170718"
     variation       3080
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200503778"
     variation       3081
                     /gene="FMN2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72444563"
     variation       3081
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200886762"
     variation       3084
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144739133"
     variation       3085
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372401580"
     variation       3087
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142178619"
     variation       3098..3130
                     /gene="FMN2"
                     /replace=""
                     /replace="ctctacccggagcggcaataccccctccgcccc"
                     /db_xref="dbSNP:6143701"
     variation       3098
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111896385"
     variation       3102
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201221641"
     variation       3106
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145005157"
     variation       3108
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201866430"
     variation       3111
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199866405"
     variation       3122
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200975594"
     variation       3132
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202054320"
     variation       3141
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150923193"
     variation       3142
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138468405"
     variation       3144
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140720010"
     variation       3147
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150102515"
     variation       3153
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200418654"
     variation       3155
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150843940"
     variation       3156
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376697094"
     variation       3159
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201199944"
     variation       3160
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199853440"
     variation       3162
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149715160"
     variation       3168
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369734693"
     variation       3178
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139764401"
     variation       3179
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141912031"
     variation       3180
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373490785"
     variation       3188
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71646825"
     variation       3198
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71646826"
     variation       3209
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375298881"
     variation       3210
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71646827"
     variation       3212
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202207586"
     variation       3213
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:71646887"
     variation       3219
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11586155"
     variation       3225
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:71646889"
     variation       3231
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71646890"
     variation       3234
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71646891"
     variation       3254..3255
                     /gene="FMN2"
                     /replace=""
                     /replace="tcctcccccacttcccggagcgggcatacctcctccaccccctctacc
                     cggagcgggcataccccc"
                     /db_xref="dbSNP:71170719"
     variation       3258
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:71535326"
     variation       3261
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201918371"
     variation       3264
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71646892"
     variation       3284
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373388302"
     variation       3285
                     /gene="FMN2"
                     /replace="ccctcctcccccactt"
                     /replace="tcctccaccccctcta"
                     /db_xref="dbSNP:71297736"
     variation       3291
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200618987"
     variation       3300
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:71646893"
     variation       3303
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201810089"
     variation       3308
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111629917"
     variation       3309
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201173147"
     variation       3318..3336
                     /gene="FMN2"
                     /replace="ccctccgcccccacttcct"
                     /replace="tcctccaccccctctaccc"
                     /db_xref="dbSNP:71297737"
     variation       3323
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200366868"
     variation       3324
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201587786"
     variation       3330
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199897169"
     variation       3334
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148115484"
     variation       3351
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201302496"
     variation       3356
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202165125"
     variation       3357
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200328010"
     variation       3386
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201048681"
     variation       3390
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200857897"
     variation       3396
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201761863"
     variation       3399
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200287374"
     variation       3407
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201685864"
     variation       3417
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71646894"
     variation       3423
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201229245"
     variation       3440
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200276415"
     variation       3441
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71646895"
     variation       3456
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200416403"
     variation       3462
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141917612"
     variation       3468
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201681961"
     variation       3486
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199766654"
     variation       3501
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372592302"
     variation       3506
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201701711"
     variation       3521
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370099468"
     variation       3522
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373533409"
     variation       3526
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377496280"
     variation       3527
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199799762"
     variation       3531
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201253596"
     variation       3539
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200640213"
     variation       3554
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370745797"
     variation       3555
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191253930"
     variation       3572
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201396397"
     variation       3573
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367816204"
     variation       3575
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199702261"
     variation       3580
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112021213"
     variation       3582
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199920451"
     variation       3584
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200800873"
     variation       3585
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181634878"
     variation       3588
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200682272"
     variation       3597
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202006855"
     variation       3600
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200022577"
     variation       3615
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200984130"
     variation       3617
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201911169"
     variation       3618
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372049087"
     variation       3621
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201646328"
     variation       3627
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75765330"
     variation       3630
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369474345"
     variation       3638
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199570117"
     variation       3639
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200036152"
     variation       3642
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75688931"
     variation       3654
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202161866"
     variation       3667
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12732924"
     variation       3671
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12737015"
     variation       3687
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12750401"
     variation       3721
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201329780"
     variation       3732
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374929692"
     variation       3737
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190820789"
     variation       3752
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142072223"
     variation       3753
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183336748"
     variation       3758
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76758921"
     variation       3781
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369075397"
     variation       3785
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372947608"
     variation       3786
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376983479"
     variation       3813
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140228578"
     variation       3819
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200759129"
     variation       3825
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138448278"
     variation       3844
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145138533"
     variation       3865
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368876164"
     variation       3931
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200053623"
     variation       3934
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111521184"
     variation       4011
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202169567"
     variation       4019
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147210965"
     variation       4028
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377271075"
     variation       4038
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200892944"
     variation       4049
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371426944"
     variation       4064
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373721402"
     variation       4113
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149661682"
     exon            4146..4290
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4154
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201716974"
     variation       4165
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373007799"
     variation       4186
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199721402"
     variation       4192
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145474534"
     variation       4200
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369796046"
     variation       4206
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144021481"
     exon            4291..4378
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4293
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141335669"
     variation       4348
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146873580"
     exon            4379..4440
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4398
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113021213"
     variation       4428
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200267919"
     exon            4441..4532
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4443
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150401752"
     variation       4461
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374165127"
     variation       4479
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6677726"
     exon            4533..4662
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4536
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143591952"
     variation       4542
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374500757"
     variation       4593
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368774315"
     variation       4628
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3795677"
     variation       4636
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12031760"
     exon            4663..4809
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4675
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375018806"
     variation       4705
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374743076"
     exon            4810..4869
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4815
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368399693"
     variation       4844
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150801382"
     variation       4845
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369715134"
     exon            4870..4990
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       4902
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146444036"
     variation       4932
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139884638"
     exon            4991..5083
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       5040
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370415981"
     variation       5072
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373287219"
     exon            5084..5135
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       5098
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200959613"
     variation       5099
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112553360"
     exon            5136..5285
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       5151
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368475818"
     variation       5190
                     /gene="FMN2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201067071"
     variation       5235
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149004492"
     variation       5237
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199995902"
     exon            5286..5367
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       5297
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183078344"
     variation       5342
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150138448"
     variation       5361
                     /gene="FMN2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143796494"
     exon            5368..6429
                     /gene="FMN2"
                     /inference="alignment:Splign:1.39.8"
     variation       5402
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371497648"
     variation       5426
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201324843"
     variation       5430
                     /gene="FMN2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376076479"
     variation       5439
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76724708"
     variation       5460..5461
                     /gene="FMN2"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:371083983"
     variation       5476
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369556407"
     variation       5511
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:882869"
     variation       5707
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35166026"
     variation       5713
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74149141"
     variation       5717
                     /gene="FMN2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:111431164"
     STS             5724..6030
                     /gene="FMN2"
                     /standard_name="SHGC-148105"
                     /db_xref="UniSTS:176196"
     variation       5765
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180839468"
     variation       5788
                     /gene="FMN2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72769840"
     variation       5955..5956
                     /gene="FMN2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:139197792"
     variation       5964..5965
                     /gene="FMN2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71650012"
     variation       5978
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190173841"
     variation       5995
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181319897"
     variation       6036
                     /gene="FMN2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146057851"
     variation       6178
                     /gene="FMN2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113776485"
     variation       6226
                     /gene="FMN2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:142674996"
     variation       6275..6276
                     /gene="FMN2"
                     /replace=""
                     /replace="tgt"
                     /db_xref="dbSNP:368769176"
ORIGIN      
agccgcagccgcagcgacggcagccacgggagccgccgcgcattatgcaaagcggcggcagatgcgagcggggccagccgggcgcgcgtcggcctcccctcccagcggctccccccgccgccgcctgactctcccgggagactccctaggcccggacctggggccgaggagggccgggatggcctgagtgcccgcggcgcggcggcgcagcagcgggattgcaccatggggaaccaggatgggaagctgaagaggagcgcaggtgatgctttgcacgaaggcggcggtggcgccgaggatgcgctggggcccagggatgtggaagccacaaagaaggggagcgggggcaagaaggcgctaggcaagcacggcaaggggggagggggcggcggcggcggcggggagtcgggcaagaagaagagcaagtccgactccagagcctcggtgttttccaacctgcggatcaggaagaatctgtccaaggggaaaggcgccggcggctcccgcgaagatgtactggattcccaggccctgcagaccggggagctggacagcgctcactccctgctcaccaagactccagacctcagcctctcggcggacgaggccggcctgtcggataccgagtgtgcggacccttttgaggtgaccggtccagggggtcctgggcctgccgaggctagggtcgggggccggccgatcgccgaggatgtggaaactgcagcaggggcgcaggatggacaaaggaccagctcgggctcggacacggacatctatagcttccattcggctacggagcaagaggatttgctttcagacatccagcaggcgatccgcctgcagcagcagcagcagcagcagctccagctccagctccagcaacagcagcagcagcagcagctccagggcgccgaggagcctgcagcgccccccactgccgtctcccctcagcccggggccttcctgggcctggaccggttcctgctggggccgagcggcggggctggggaggccccgggcagtccggacaccgagcaggcgctgtccgcgctctccgacctgcccgagagcctggccgccgagccccgggagccccagcaaccgccgtcccccggcggcctcccggtctccgaggcgcccagtctcccggcagcgcaacccgcggccaaagactcgccctcctccacggctttcccatttcccgaggccgggccgggggaggaagcggccggagcccccgtgcgaggggctggggacacggatgaggagggtgaggaggatgcttttgaggatgcgccccggggctctccgggggaggagtgggccccggaggtgggagaggacgccccgcagaggctgggggaagagccggaggaggaggcgcaaggacctgacgcccccgcggccgcttccctgcccggcagccccgcgcctagccagcgctgtttcaagccctacccgctcatcaccccctgctacatcaagaccaccacccggcagctcagctcgcccaatcactccccgtctcagtcccctaatcagagccccaggatcaagaggcggccggaaccctccctgagccgagggtccagaactgccctggcctccgtagccgccccggccaagaagcaccgggccgacggcggccttgcggccggcctgagccgctcggctgactggacggaggagctaggcgcccgcacgccccgggtgggaggctccgcgcacctgctggagcgcggggtggcgagtgacagcggcggtggggtgtccccagcactggccgccaaggcgtctggggcccccgcggctgcggatggcttccagaacgtgttcacagggcgaacgctgttggagaagctgttcagccagcaggagaacgggcctccagaagaagcagagaagttttgctcccggatcattgccatgggtcttctccttccttttagtgattgcttcagggaaccgtgtaatcagaatgcccagacgaatgcagcttcgtttgatcaagatcaactttatacctgggctgcagttagtcaacccacacactcattggactattcagaagggcagtttcctaggcgagttccatccatggggccaccatccaaacctcccgatgaggaacacaggctcgaggatgctgaaacagaatctcaatctgctgtttcagaaactccccaaaaacgctcagatgctgtccagaaggaagttgttgacatgaagtctgagggacaggccactgtaattcagcagctggaacagactattgaggatctgagaaccaaaatagctgaactagagaggcagtatcctgccctggacacagaggtggccagtggtcatcaagggcttgagaatggagtgacagcctcaggcgatgtctgtctcgaagctctcaggttagaagaaaaggaagtacggcatcataggattttagaggcgaaatcgatacagacttcccccacggaagagggcggggtgctgacactgcctcctgtggatgggctgccagggcgtcctccatgcccccctggggctgaaagtggacctcagacaaagttctgttcagagatttctttgattgtgtctccaaggcgaatatcagtccagctcgacagccatcagcccacacagagcatctcacagcctccaccacctccatcccttctgtggtctgctgggcaaggacagcctgggtcacagccgccccattctatttctaccgagtttcaaaccagccacgaacactctgtttcctctgcctttaaaaacagctgtaacatcccatctccaccacctctgccttgcacagagtcctccagctccatgcctggcctgggcatggtgcctcccccacctccccctctccctggcatgacagtgcctactctgcccagtacagccattccccaacctcctcctctgcagggtacagaaatgctgccaccccctccccctcctcttcccggagcgggcatacctcctccgccgcctctacccggagcaggcatactccctctgccccctctacccggagcgggaatacctcctccgccccctctacccggagcggcaataccccctccgccccctcttcccggggcaggcataccccttcctccccctcttcccggagcaggaatacctcctccaccccctctacccggagcgggcataccccctcctcccccacttcccggagcgggcataccccctccgcccccacttcccggagcgggcataccccctcctccccctcttcccggagcgggcatacctcctccaccccctctacccggagcgggcataccccctccgcccccacttcccggagcgggcataccccctccgcccccacttcccggagcgggcataccccctcctccccctcttcccggagcgggcatacctcctccaccccctctacccggagcgggcataccccctccgcccccacttcccggagcgggcatacccccacctccccctctacccggagcgggcataccccctccgccccctctacccggagtgggcatacctcctccgccccctctacccggagcgggcataccccctcctccccctctacccggagcgggcataccccctcctccccctcttcccggagcgggcatacctcctccaccccctctacccagagtgggcataccccctccgcccccacttcccggagcgggcatacccccacctccccctctacccggagcgggcataccccctccgccccctctacctggagtgggaatacctcctccgccccctctacctggagtgggaatacctcctccgccccctctacctggtgctgggattcccccacctcctcccttgccaggtatggggattccacctgctccagctcccccactccctccacctgggacaggaatcccaccgccccctctgcttcctgtatcaggccctccactcctcccacaagttgggagtagcactttaccaaccccacaggtgtgtggatttcttcctcctccattgccaagtggcttgtttggattagggatgaatcaggacaaagggagtaggaagcagcccatagagccttgtcgaccaatgaagcctctttactggaccaggattcaactacatagtaaaagagactccagtacttcacttatttgggaaaaaattgaagagccatccatagattgtcatgaatttgaggaattattttctaaaactgctgtaaaggagagaaagaaacctatctctgatactatctcaaagacgaaggctaaacaagttgtcaagttattaagcaacaaaagatcacaagcagttggaatactaatgtctagccttcatttagatatgaaagacatacaacatgctgttgtgaacttggataattctgtggttgacctggagacccttcaagctctctatgagaatagagcacagtcagacgaactcgaaaaaatagaaaagcatggccgatcttccaaagacaaggaaaatgccaagtctctggacaaacctgaacagttcctttatgaactgtcactaatccccaacttttcagagcgagtcttttgcatcctgttccagtccacattttcagaaagcatttgctcaattcgtcgcaaactggaattactacagaaattgtgtgagacattaaaaaatggcccaggggttatgcaggttctaggtttggttcttgcctttggcaactacatgaatggaggaaataagactcgaggacaggcagatggctttggattagacattcttccaaaactgaaagatgtcaagagcagtgacaatagcagaagccttttgtcatatattgtttcgtattatctccgaaattttgatgaggatgctggaaaagaacagtgcctctttccactgccagaaccccaggacctttttcaggcctcacagatgaagtttgaagattttcaaaaagatctcagaaaactgaagaaagacttgaaagcctgtgaagttgaagcagggaaagtataccaggtctcctcaaaagagcatatgcagcctttcaaggaaaacatggaacaatttattattcaagccaaaattgaccaagaggcagaggaaaattcactgacagagactcataaatgctttttggagaccacggcatatttcttcatgaaaccaaaacttggagagaaggaggtgtccccaaatgctttcttcagtatctggcatgaattcagctctgactttaaagacttctggaagaaagagaacaaacttcttctacaagagagagtaaaagaagccgaagaggtgtgtagacagaagaaaggaaaatcactttataaaataaaaccaagacatgactctggaattaaagcaaagataagcatgaaaacttgaacaatgaaaagcagaatgaaaatgagtcattgcaacgactttcacaaaattcagctgacctgagagtgggagggaaactaccgtcattctgctcatgtttcttcttgacctcttgcataatctttttgttttctagacagttcactaattgttgaattttactgtatattcatataaaaatgcaaacgtactagaccagtggagaatttgacaccttttctttttgtaaaagtttatggtattataccgatagaccaaaacagcatgtgtaagaggcagtatctgcactaattctcaacatgctaaacattaactacaattcactgttgtgagaatattcctcgtcacagcaaaaacactttcctttctactgacaaccagtcctccacatcacagcatttagacatatgggtaaaatgttatttctagtgaattgtttgtatcagtttcatgtctaagtataaattttctattttaaaatttaagaaccgtttataatcagtgctttcccaactcttgggttgctctccataactatgtatttgtgaaagaaaatggtcattttttttactgaagtcatataatgacttgggtcagctcgtaatgcattgtgatggttttgtatgagctgggtgtttttttccattacttttaatgatcttcgttgcaagttatagttgtggataaaggggagaatttattgctcttgcaaaccaattatggaaagcaacttaagaaaaccaatgttctaaatcataattgtttgtatttatgtaaagtatggtctcttactttttagtttgtagtttaagtgcaaagaaacagtagtggttttttttctattgttttgtagtcttcctgtccccttcagtccctccagtgtgtatattaccattctccaatgaaataatagggcatttaacaaagatcgctatgtgcaatactgtatttagtgtttctatttcaatttttctaggatgttaatttatatgaaaataaaatgaataataaaagaataaagatacttgcaaaagaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:56776 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:56776 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
            GeneID:56776 -> Biological process: GO:0006915 [apoptotic process] evidence: IMP
            GeneID:56776 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IMP
            GeneID:56776 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:56776 -> Biological process: GO:0015031 [protein transport] evidence: IEA
            GeneID:56776 -> Biological process: GO:0016192 [vesicle-mediated transport] evidence: ISS
            GeneID:56776 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: IEA
            GeneID:56776 -> Biological process: GO:0040038 [polar body extrusion after meiotic divisions] evidence: ISS
            GeneID:56776 -> Biological process: GO:0042177 [negative regulation of protein catabolic process] evidence: IMP
            GeneID:56776 -> Biological process: GO:0045010 [actin nucleation] evidence: IEA
            GeneID:56776 -> Biological process: GO:0046907 [intracellular transport] evidence: ISS
            GeneID:56776 -> Biological process: GO:0048477 [oogenesis] evidence: ISS
            GeneID:56776 -> Biological process: GO:0051295 [establishment of meiotic spindle localization] evidence: ISS
            GeneID:56776 -> Biological process: GO:0051758 [homologous chromosome movement towards spindle pole involved in homologous chromosome segregation] evidence: ISS
            GeneID:56776 -> Biological process: GO:0070649 [formin-nucleated actin cable assembly] evidence: ISS
            GeneID:56776 -> Biological process: GO:0071456 [cellular response to hypoxia] evidence: IMP
            GeneID:56776 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:56776 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:56776 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
            GeneID:56776 -> Cellular component: GO:0005884 [actin filament] evidence: IEA
            GeneID:56776 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:56776 -> Cellular component: GO:0005938 [cell cortex] evidence: ISS
            GeneID:56776 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IDA
            GeneID:56776 -> Cellular component: GO:0030659 [cytoplasmic vesicle membrane] evidence: ISS
            GeneID:56776 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.