GGRNA Home | Help | Advanced search

2019-03-23 03:28:26, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_019619               6013 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens par-3 partitioning defective 3 homolog (C. elegans)
            (PARD3), transcript variant 1, mRNA.
ACCESSION   NM_019619
VERSION     NM_019619.3  GI:296278254
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6013)
  AUTHORS   Xue,B., Krishnamurthy,K., Allred,D.C. and Muthuswamy,S.K.
  TITLE     Loss of Par3 promotes breast cancer metastasis by compromising
            cell-cell cohesion
  JOURNAL   Nat. Cell Biol. 15 (2), 189-200 (2013)
   PUBMED   23263278
  REMARK    GeneRIF: Suggest that loss of Par3 promotes metastatic behaviour of
            ErbB2-induced breast tumour epithelial cells by decreasing
            cell-cell cohesion.
REFERENCE   2  (bases 1 to 6013)
  AUTHORS   McCaffrey,L.M., Montalbano,J., Mihai,C. and Macara,I.G.
  TITLE     Loss of the Par3 polarity protein promotes breast tumorigenesis and
            metastasis
  JOURNAL   Cancer Cell 22 (5), 601-614 (2012)
   PUBMED   23153534
  REMARK    GeneRIF: Par3 is identified as a regulator of signaling pathways
            relevant to invasive breast cancer.
REFERENCE   3  (bases 1 to 6013)
  AUTHORS   Yang,Z., Xue,B., Umitsu,M., Ikura,M., Muthuswamy,S.K. and Neel,B.G.
  TITLE     The signaling adaptor GAB1 regulates cell polarity by acting as a
            PAR protein scaffold
  JOURNAL   Mol. Cell 47 (3), 469-483 (2012)
   PUBMED   22883624
  REMARK    GeneRIF: The scaffolding adaptor GAB1 interacts with two polarity
            proteins, PAR1 and PAR3.
REFERENCE   4  (bases 1 to 6013)
  AUTHORS   Gao,Y., Chen,X., Shangguan,S., Bao,Y., Lu,X., Zou,J., Guo,J.,
            Dai,Y. and Zhang,T.
  TITLE     Association study of PARD3 gene polymorphisms with neural tube
            defects in a Chinese Han population
  JOURNAL   Reprod Sci 19 (7), 764-771 (2012)
   PUBMED   22447895
  REMARK    GeneRIF: genetic association studies in a Chinese Han population:
            Data suggest that 6 SNPs in PARD3 (rs2496720, rs2252655, rs3851068,
            rs118153230, rs10827337, rs12218196) are associated with neural
            tube defects/anencephaly in this population.
REFERENCE   5  (bases 1 to 6013)
  AUTHORS   Odell,A.F., Hollstein,M., Ponnambalam,S. and Walker,J.H.
  TITLE     A VE-cadherin-PAR3-alpha-catenin complex regulates the Golgi
            localization and activity of cytosolic phospholipase A(2)alpha in
            endothelial cells
  JOURNAL   Mol. Biol. Cell 23 (9), 1783-1796 (2012)
   PUBMED   22398721
  REMARK    GeneRIF: A VE-cadherin-PAR3-alpha-catenin complex regulates the
            Golgi localization and activity of cytosolic phospholipase
            A(2)alpha in endothelial cells.(
REFERENCE   6  (bases 1 to 6013)
  AUTHORS   Ebnet,K., Suzuki,A., Horikoshi,Y., Hirose,T., Meyer Zu
            Brickwedde,M.K., Ohno,S. and Vestweber,D.
  TITLE     The cell polarity protein ASIP/PAR-3 directly associates with
            junctional adhesion molecule (JAM)
  JOURNAL   EMBO J. 20 (14), 3738-3748 (2001)
   PUBMED   11447115
REFERENCE   7  (bases 1 to 6013)
  AUTHORS   Suzuki,A., Yamanaka,T., Hirose,T., Manabe,N., Mizuno,K.,
            Shimizu,M., Akimoto,K., Izumi,Y., Ohnishi,T. and Ohno,S.
  TITLE     Atypical protein kinase C is involved in the evolutionarily
            conserved par protein complex and plays a critical role in
            establishing epithelia-specific junctional structures
  JOURNAL   J. Cell Biol. 152 (6), 1183-1196 (2001)
   PUBMED   11257119
REFERENCE   8  (bases 1 to 6013)
  AUTHORS   Noda,Y., Takeya,R., Ohno,S., Naito,S., Ito,T. and Sumimoto,H.
  TITLE     Human homologues of the Caenorhabditis elegans cell polarity
            protein PAR6 as an adaptor that links the small GTPases Rac and
            Cdc42 to atypical protein kinase C
  JOURNAL   Genes Cells 6 (2), 107-119 (2001)
   PUBMED   11260256
REFERENCE   9  (bases 1 to 6013)
  AUTHORS   Johansson,A., Driessens,M. and Aspenstrom,P.
  TITLE     The mammalian homologue of the Caenorhabditis elegans polarity
            protein PAR-6 is a binding partner for the Rho GTPases Cdc42 and
            Rac1
  JOURNAL   J. Cell. Sci. 113 (PT 18), 3267-3275 (2000)
   PUBMED   10954424
REFERENCE   10 (bases 1 to 6013)
  AUTHORS   Joberty,G., Petersen,C., Gao,L. and Macara,I.G.
  TITLE     The cell-polarity protein Par6 links Par3 and atypical protein
            kinase C to Cdc42
  JOURNAL   Nat. Cell Biol. 2 (8), 531-539 (2000)
   PUBMED   10934474
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL450337.24, AF467002.1, AA136967.1, AL160409.12 and AW242451.1.
            On May 19, 2010 this sequence version replaced gi:21361830.
            
            Summary: This gene encodes a member of the PARD protein family.
            PARD family members interact with other PARD family members and
            other proteins; they affect asymmetrical cell division and direct
            polarized cell growth. Multiple alternatively spliced transcript
            variants have been described for this gene. [provided by RefSeq,
            Oct 2011].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and it encodes the longest protein (isoform 1). This
            variant has also been called 'variant a'.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF467002.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-330               AL450337.24        22044-22373         c
            331-2513            AF467002.1         1-2183
            2514-2868           AA136967.1         72-426
            2869-4401           AF467002.1         2539-4071
            4402-5972           AL160409.12        87642-89212         c
            5973-6013           AW242451.1         1-41                c
FEATURES             Location/Qualifiers
     source          1..6013
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10p11.21"
     gene            1..6013
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="par-3 partitioning defective 3 homolog (C.
                     elegans)"
                     /db_xref="GeneID:56288"
                     /db_xref="HGNC:16051"
                     /db_xref="HPRD:05994"
                     /db_xref="MIM:606745"
     exon            1..450
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    172..174
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="upstream in-frame stop codon"
     CDS             331..4401
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="isoform 1 is encoded by transcript variant 1;
                     partitioning defective 3 homolog; atypical PKC
                     isotype-specific interacting protein; PAR3-alpha; CTCL
                     tumor antigen se2-5; atypical PKC
                     isotype-specific-interacting protein; bazooka"
                     /codon_start=1
                     /product="partitioning defective 3 homolog isoform 1"
                     /protein_id="NP_062565.2"
                     /db_xref="GI:21361831"
                     /db_xref="CCDS:CCDS7178.1"
                     /db_xref="GeneID:56288"
                     /db_xref="HGNC:16051"
                     /db_xref="HPRD:05994"
                     /db_xref="MIM:606745"
                     /translation="
MKVTVCFGRTRVVVPCGDGHMKVFSLIQQAVTRYRKAIAKDPNYWIQVHRLEHGDGGILDLDDILCDVADDKDRLVAVFDEQDPHHGGDGTSASSTGTQSPEIFGSELGTNNVSAFQPYQATSEIEVTPSVLRANMPLHVRRSSDPALIGLSTSVSDSNFSSEEPSRKNPTRWSTTAGFLKQNTAGSPKTCDRKKDENYRSLPRDTSNWSNQFQRDNARSSLSASHPMVGKWLEKQEQDEDGTEEDNSRVEPVGHADTGLEHIPNFSLDDMVKLVEVPNDGGPLGIHVVPFSARGGRTLGLLVKRLEKGGKAEHENLFRENDCIVRINDGDLRNRRFEQAQHMFRQAMRTPIIWFHVVPAANKEQYEQLSQSEKNNYYSSRFSPDSQYIDNRSVNSAGLHTVQRAPRLNHPPEQIDSHSRLPHSAHPSGKPPSAPASAPQNVFSTTVSSGYNTKKIGKRLNIQLKKGTEGLGFSITSRDVTIGGSAPIYVKNILPRGAAIQDGRLKAGDRLIEVNGVDLVGKSQEEVVSLLRSTKMEGTVSLLVFRQEDAFHPRELNAEPSQMQIPKETKAEDEDIVLTPDGTREFLTFEVPLNDSGSAGLGVSVKGNRSKENHADLGIFVKSIINGGAASKDGRLRVNDQLIAVNGESLLGKTNQDAMETLRRSMSTEGNKRGMIQLIVARRISKCNELKSPGSPPGPELPIETALDDRERRISHSLYSGIEGLDESPSRNAALSRIMGESGKYQLSPTVNMPQDDTVIIEDDRLPVLPPHLSDQSSSSSHDDVGFVTADAGTWAKAAISDSADCSLSPDVDPVLAFQREGFGRQSMSEKRTKQFSDASQLDFVKTRKSKSMDLGIADETKLNTVDDQKAGSPSRDVGPSLGLKKSSSLESLQTAVAEVTLNGDIPFHRPRPRIIRGRGCNESFRAAIDKSYDKPAVDDDDEGMETLEEDTEESSRSGRESVSTASDQPSHSLERQMNGNQEKGDKTDRKKDKTGKEKKKDRDKEKDKMKAKKGMLKGLGDMFRFGKHRKDDKIEKTGKIKIQESFTSEEERIRMKQEQERIQAKTREFRERQARERDYAEIQDFHRTFGCDDELMYGGVSSYEGSMALNARPQSPREGHMMDALYAQVKKPRNSKPSPVDSNRSTPSNHDRIQRLRQEFQQAKQDEDVEDRRRTYSFEQPWPNARPATQSGRHSVSVEVQMQRQRQEERESSQQAQRQYSSLPRQSRKNASSVSQDSWEQNYSPGEGFQSAKENPRYSSYQGSRNGYLGGHGFNARVMLETQELLRQEQRRKEQQMKKQPPSEGPSNYDSYKKVQDPSYAPPKGPFRQDVPPSPSQVARLNRLQTPEKGRPFYS
"
     misc_feature    331..768
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="Domain of unknown function (DUF3534); Region:
                     DUF3534; pfam12053"
                     /db_xref="CDD:152488"
     misc_feature    760..762
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1144..1371
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(1177..1188,1192..1194,1348..1353,1360..1365)
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    1477..1479
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    1477..1479
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1492..1494
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1723..1962
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(1738..1749,1753..1755,1909..1914,1921..1926)
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    1795..1797
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2092..2373
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:29049"
     misc_feature    order(2128..2139,2143..2145,2302..2307,2314..2319)
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29049"
     misc_feature    2404..2406
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2413..2415
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2464..3138
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TEW0.2);
                     Region: Interacts with PRKCI and PRKCZ (By similarity)"
     misc_feature    2512..2514
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2755..2757
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2884..2886
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2947..2949
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q8TEW0.2); phosphorylation site"
     misc_feature    2947..2949
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2953..2955
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3214..3216
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by AURKA; propagated from
                     UniProtKB/Swiss-Prot (Q8TEW0.2); phosphorylation site"
     misc_feature    3709..3711
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3856..3858
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3859..3861
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            451..552
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            553..733
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            734..912
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            913..1044
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1045..1136
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1137..1220
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1221..1346
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1347..1729
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1730..1869
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1870..1998
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            1999..2037
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2038..2226
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2227..2397
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     variation       2299
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11540925"
     exon            2398..2557
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2558..2747
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2748..2899
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2900..2944
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            2945..3172
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            3173..3404
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            3405..3515
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            3516..3758
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            3759..3879
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            3880..4007
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     exon            4008..6010
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /inference="alignment:Splign:1.39.8"
     STS             5808..5930
                     /gene="PARD3"
                     /gene_synonym="ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A;
                     SE2-5L16; SE2-5LT1; SE2-5T2"
                     /standard_name="RH48447"
                     /db_xref="UniSTS:11184"
ORIGIN      
cccagcggccccgagcgagcgccagcgccacacagccccgggcagccgccggcgagcgcgccgcgacgccgaacaggtggccggaggctgcgggcgccgcggcggggagaggcgaggcaagccccgggcgaagcgaggcgaggcgagggcggccgggccgggcatgcgagctgagcggccccccggcgtcgccgccgcctgcccgcgcccctagccgcccgcgcgcccgagtccccagcggctcctccgcgcccagcgtcctcggtcccggcctcggctgctccggctgcgctcggcgaggggcgcgggcccgcccgcggcggcggcggcatgaaagtgaccgtgtgcttcggacggacccgggtggtcgtgccgtgcggggacggccacatgaaagttttcagcctcatccagcaggcggtgacccgctaccggaaggccatcgccaaggatccaaactactggatacaggtgcatcgcttggaacatggagatggaggaatactagaccttgatgacattctttgtgatgtagcagacgataaagacagactggtagcagtgtttgatgagcaggatccacatcacggaggtgatggcaccagtgccagttccacgggtacccagagcccagagatatttggtagtgagcttggcaccaacaatgtctcagcctttcagccttaccaagcaacaagtgaaattgaggtcacaccttcagtccttcgagcaaatatgcctcttcatgttcgacgcagtagtgacccagctctaattggcctctccacttctgtcagtgatagtaatttttcctctgaagagccttcaaggaaaaatcccacacgctggtcaacaacagctggcttcctcaagcagaacactgctgggagtcctaaaacctgcgacaggaagaaagatgaaaactacagaagcctcccgcgggatactagtaactggtctaaccaatttcagagagacaatgctcgctcgtctctgagtgccagtcacccaatggtgggcaagtggctggagaaacaagaacaggatgaggatgggacagaagaggataacagtcgtgttgaacctgttggacatgctgacacgggtttggagcatatacccaacttttctctggatgatatggtaaagctcgtagaagtccccaacgatggagggcctctgggaatccatgtagtgcctttcagtgctcgaggcggcagaaccctggggttattagtaaaacgattggagaaaggtggtaaagctgaacatgaaaatctttttcgtgagaatgattgcattgtcaggattaatgatggcgaccttcgaaatagaagatttgaacaagcacaacatatgtttcgccaagccatgcgtacacccatcatttggttccatgtggttcctgcagcaaataaagagcagtatgaacaactatcccaaagtgagaagaacaattactattcaagccgttttagccctgacagccagtatattgacaacaggagtgtgaacagtgcagggcttcacacggtgcagagagcaccccgactgaaccacccgcctgagcagatagactctcactcaagactacctcatagcgcacacccctcgggaaaaccaccatccgctccagcctcggcacctcagaatgtatttagtacgactgtaagcagtggttataacaccaaaaaaataggcaagaggcttaatatccagcttaagaaaggtacagaaggtttgggattcagcatcacttccagagatgtaacaataggtggctcagctccaatctatgtgaaaaacattctcccccggggggcggccattcaggatggccgacttaaggcaggagacagacttatagaggtaaatggagtagatttagtgggcaaatcccaagaggaagttgtttcgctgttgagaagcaccaagatggaaggaactgtgagccttctggtctttcgccaggaagacgccttccacccaagggaactgaatgcagagccaagccagatgcagattccaaaagaaacgaaagcagaagatgaggatattgttcttacacctgatggcaccagggaatttctgacatttgaagtcccacttaatgattcaggatctgcaggccttggtgtcagtgtcaaaggtaaccggtcaaaagagaaccacgcagatttgggaatctttgtcaagtccattattaatggaggagcagcatctaaagatggaaggcttcgggtgaatgatcaactgatagcagtaaatggagaatccctgttgggcaagacaaaccaagatgccatggaaaccctaagaaggtctatgtctactgaaggcaataaacgaggaatgatccagcttattgttgcaaggagaataagcaagtgcaatgagctgaagtcacctgggagcccccctggacctgagctgcccattgaaacagcgttggatgatagagaacgaagaatttcccattccctctacagtgggattgaggggcttgatgaatcgcccagcagaaatgctgccctcagtaggataatgggtgagtcaggtaaataccagctgtcccctacagtgaatatgccccaagatgacactgtcattatagaagatgacaggttgccagtgcttcctccacatctctctgaccagtcctcttccagctcccatgatgatgtggggtttgtgacggcagatgctggtacttgggccaaggctgcaatcagtgattcagccgactgctctttgagtccagatgttgatccagttcttgcttttcaacgagaaggatttggacgtcagagtatgtcagaaaaacgcacaaagcaattttcagatgccagtcaattggatttcgttaaaacacgaaaatcaaaaagcatggatttaggtatagctgacgagactaaactcaatacagtggatgaccagaaagcaggttctcccagcagagatgtgggtccttccctgggtctgaagaagtcaagctcgttggagagtctgcagaccgcagttgccgaggtgactttgaatggggatattcctttccatcgtccacggccgcggataatcagaggcaggggatgcaatgagagcttcagagctgccatcgacaaatcttatgataaacccgcggtagatgatgatgatgaaggcatggagaccttggaagaagacacagaagaaagttcaagatcagggagagagtctgtatccacagccagtgatcagccttcccactctctggagagacaaatgaatggaaaccaagagaaaggtgataagactgatagaaaaaaggataaaactggaaaagaaaagaagaaagatagagataaggagaaggataaaatgaaagccaagaagggaatgctgaagggcttgggagacatgttcaggtttggcaaacatcgaaaagatgacaagattgagaaaacgggtaaaataaaaatacaggaatcctttacatcagaagaggagaggatacgaatgaagcaggagcaggagaggattcaagccaaaactcgagaatttagggaacgacaagctcgagagcgtgactatgctgaaattcaagattttcatcggacatttggctgtgatgatgagttaatgtatgggggagtttcttcttatgaaggttccatggctctcaacgctagacctcagagcccacgagaagggcatatgatggatgctttgtatgcccaagtcaagaagccgcggaattccaaaccctcacctgtagacagtaacagatcaactcctagcaatcatgatcggatacagcgtctgaggcaagaatttcagcaagcaaagcaagatgaagatgtagaagatcgtcggcggacctatagttttgagcaaccctggccgaacgcacggccggcgacgcagagcgggcgacactcggtgtccgtggaggtgcagatgcagcggcagcggcaggaggagcgcgagagctcccagcaggcccagcgccagtacagctctctgcctcggcaaagcaggaaaaatgccagctcggtctcccaggactcttgggagcagaactactcccctggggaaggcttccagagtgccaaagagaaccccaggtactccagctaccaaggctccaggaacggctacctgggaggacatggcttcaacgccagggtcatgctggaaactcaggagctccttcgccaggaacagaggcggaaggagcagcagatgaagaagcagcctccttccgaggggcccagcaactatgactcgtataagaaagtccaggaccccagttacgcccctcccaaggggcccttccggcaagatgtgcccccctccccttctcaggttgcgaggctgaacagacttcagactcctgagaaagggaggcccttctattcctgagcacgcaaataacggatgcttcatgtcgcgcaataaaagacattttcctatgaagacttgtattttgggagtttttttaaaacctcgatggtactatggagtatttctgttgttggtatcagtgcctttaagcggtgtaggcaaagaaatggaaggccttaatgtctttgccactatgtctcaagtgtctgtttcatggaaggatttcccaccctgtgacaatcatctgtttgaggtgttcatatgctctgcgcctctccacagtaccaggaatctcggccctactcatgagttgtccgcggcttggttgtaacatccctgcaccacttgcagtgacaaattcacctgaagtggaggatgacgtgcggccctgtttctccctctaagttctcttagctatgggatgacatcttagtctctggtggaggaaaagtgggcgacatacaccaaaaattggggctttctggtacttcacagcacagccatttgtcgtactttgtcatcactgtggttttctctttcctttctcagctctttgtgacgggagagtcggtcatcctattacagaagctaagccatagtccaacattgtttggtcaccatgggggtccttttgtaactgccttatgactcaacattaccaataaagtgatgatcctggtctgcgtttatacatacgcttgttcggtcctgttcctgacacgtgggttgagtcaccacagctctgtgtggggaacgtgggagacaggagtggctcctgccgggggaagctgggcctgccattggccctgtgtctatcatgaggggagagctaagaaagaaattctcctaggaagagctcatggcccagtacatcctagtaattattttaattagtttttgttctgacagcttgtcaggaagggcacagaatgggacagagataaaccagacagtcattttgatctgctctctacggtttttcaagtcagaggcaattgatgcttgtctaatgcatccacacactgcatgtctgactggcgatgccgcgctcctaagtagttctgccatgaaacataaaagacaaaggaaaagccgttacacatcacacagagaacattttcgggtcccacagcggtggtggcaggaagctcactctcgcgtcagtattagagtgtgtgtgtgggtctcggggatctcggtggctcccatcttccttcattgttctgaacatcctgtattgtaaaccatggctggggtgctaaagtgcctgtgaatcccgatgtggaaaaagctggaggtgaaagctcagcataccatgtatttactttaaaaacagaaaaaaagacatgtatggatatgtctattttttttttattggcacattgtatttttgtgttgacttgtttttagaaatgatgtgtccacacacgtacccgtgtctcttctgcatttctgtgtcatggttctgtttcttaatcacgtgcggcggtgtctaagtggtgttaccagtgtacgcgcagtgaccttggatgacagtggctctttctcacagcctcccctgagctgtgagaaacagctttctctgtacatatgcaactcctaataaaaggcatatttcttcctgttcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:56288 -> Molecular function: GO:0005080 [protein kinase C binding] evidence: IEA
            GeneID:56288 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:56288 -> Molecular function: GO:0005546 [phosphatidylinositol-4,5-bisphosphate binding] evidence: ISS
            GeneID:56288 -> Molecular function: GO:0005547 [phosphatidylinositol-3,4,5-trisphosphate binding] evidence: ISS
            GeneID:56288 -> Molecular function: GO:0019903 [protein phosphatase binding] evidence: IEA
            GeneID:56288 -> Molecular function: GO:0032266 [phosphatidylinositol-3-phosphate binding] evidence: ISS
            GeneID:56288 -> Biological process: GO:0000226 [microtubule cytoskeleton organization] evidence: IEA
            GeneID:56288 -> Biological process: GO:0003383 [apical constriction] evidence: IEA
            GeneID:56288 -> Biological process: GO:0006461 [protein complex assembly] evidence: TAS
            GeneID:56288 -> Biological process: GO:0006612 [protein targeting to membrane] evidence: ISS
            GeneID:56288 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
            GeneID:56288 -> Biological process: GO:0007163 [establishment or maintenance of cell polarity] evidence: TAS
            GeneID:56288 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS
            GeneID:56288 -> Biological process: GO:0007205 [protein kinase C-activating G-protein coupled receptor signaling pathway] evidence: TAS
            GeneID:56288 -> Biological process: GO:0007409 [axonogenesis] evidence: TAS
            GeneID:56288 -> Biological process: GO:0008356 [asymmetric cell division] evidence: TAS
            GeneID:56288 -> Biological process: GO:0032970 [regulation of actin filament-based process] evidence: IEA
            GeneID:56288 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS
            GeneID:56288 -> Biological process: GO:0044319 [wound healing, spreading of cells] evidence: IEA
            GeneID:56288 -> Biological process: GO:0045216 [cell-cell junction organization] evidence: TAS
            GeneID:56288 -> Biological process: GO:0051642 [centrosome localization] evidence: IEA
            GeneID:56288 -> Biological process: GO:0060341 [regulation of cellular localization] evidence: IEA
            GeneID:56288 -> Biological process: GO:0070830 [tight junction assembly] evidence: ISS
            GeneID:56288 -> Biological process: GO:0070830 [tight junction assembly] evidence: TAS
            GeneID:56288 -> Biological process: GO:0090162 [establishment of epithelial cell polarity] evidence: ISS
            GeneID:56288 -> Cellular component: GO:0005819 [spindle] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:56288 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:56288 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IDA
            GeneID:56288 -> Cellular component: GO:0005911 [cell-cell junction] evidence: ISS
            GeneID:56288 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0005923 [tight junction] evidence: IDA
            GeneID:56288 -> Cellular component: GO:0005923 [tight junction] evidence: ISS
            GeneID:56288 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0012505 [endomembrane system] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0030054 [cell junction] evidence: TAS
            GeneID:56288 -> Cellular component: GO:0043025 [neuronal cell body] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0044295 [axonal growth cone] evidence: IEA
            GeneID:56288 -> Cellular component: GO:0045177 [apical part of cell] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.