2024-04-25 14:51:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_019599 1355 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA. ACCESSION NM_019599 VERSION NM_019599.2 GI:67782322 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1355) AUTHORS An,S.S., Wang,W.C., Koziol-White,C.J., Ahn,K., Lee,D.Y., Kurten,R.C., Panettieri,R.A. Jr. and Liggett,S.B. TITLE TAS2R activation promotes airway smooth muscle relaxation despite beta(2)-adrenergic receptor tachyphylaxis JOURNAL Am. J. Physiol. Lung Cell Mol. Physiol. 303 (4), L304-L311 (2012) PUBMED 22683571 REMARK GeneRIF: Intracellular signaling and cell mechanics using isolated human airway smooth muscle, mouse tracheal responses, and human bronchial responses to characterize TAS2R relaxation in the context of beta(2)AR desensitization. REFERENCE 2 (bases 1 to 1355) AUTHORS Singh,N., Pydi,S.P., Upadhyaya,J. and Chelikani,P. TITLE Structural basis of activation of bitter taste receptor T2R1 and comparison with Class A G-protein-coupled receptors (GPCRs) JOURNAL J. Biol. Chem. 286 (41), 36032-36041 (2011) PUBMED 21852241 REMARK GeneRIF: Structural basis of activation of bitter taste receptor T2R1 and comparison with Class A G-protein-coupled receptors (GPCRs). REFERENCE 3 (bases 1 to 1355) AUTHORS Dai,W., You,Z., Zhou,H., Zhang,J. and Hu,Y. TITLE Structure-function relationships of the human bitter taste receptor hTAS2R1: insights from molecular modeling studies JOURNAL J. Recept. Signal Transduct. Res. 31 (3), 229-240 (2011) PUBMED 21619450 REMARK GeneRIF: The formation of a short helical segment in intracellular loop II may be necessary for the activation of hTAS2R1. REFERENCE 4 (bases 1 to 1355) AUTHORS Upadhyaya,J., Pydi,S.P., Singh,N., Aluko,R.E. and Chelikani,P. TITLE Bitter taste receptor T2R1 is activated by dipeptides and tripeptides JOURNAL Biochem. Biophys. Res. Commun. 398 (2), 331-335 (2010) PUBMED 20599705 REMARK GeneRIF: The ligand binding pocket in T2R1 is present on the extracellular surface of the receptor, and is formed by the transmembrane helices 1, 2, 3 and 7 and with extracellular loops 1 and 2 forming a cap like structure on the binding pocket. REFERENCE 5 (bases 1 to 1355) AUTHORS Weiss,L.A., Arking,D.E., Daly,M.J. and Chakravarti,A. CONSRTM Gene Discovery Project of Johns Hopkins & the Autism Consortium TITLE A genome-wide linkage and association scan reveals novel loci for autism JOURNAL Nature 461 (7265), 802-808 (2009) PUBMED 19812673 REMARK GeneRIF: Observational study and genome-wide association study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 1355) AUTHORS Matsunami,H., Montmayeur,J.P. and Buck,L.B. TITLE A family of candidate taste receptors in human and mouse JOURNAL Nature 404 (6778), 601-604 (2000) PUBMED 10766242 REFERENCE 7 (bases 1 to 1355) AUTHORS Firestein,S. TITLE The good taste of genomics JOURNAL Nature 404 (6778), 552-553 (2000) PUBMED 10766221 REFERENCE 8 (bases 1 to 1355) AUTHORS Chandrashekar,J., Mueller,K.L., Hoon,M.A., Adler,E., Feng,L., Guo,W., Zuker,C.S. and Ryba,N.J. TITLE T2Rs function as bitter taste receptors JOURNAL Cell 100 (6), 703-711 (2000) PUBMED 10761935 REFERENCE 9 (bases 1 to 1355) AUTHORS Adler,E., Hoon,M.A., Mueller,K.L., Chandrashekar,J., Ryba,N.J. and Zuker,C.S. TITLE A novel family of mammalian taste receptors JOURNAL Cell 100 (6), 693-702 (2000) PUBMED 10761934 REFERENCE 10 (bases 1 to 1355) AUTHORS Kinnamon,S.C. TITLE A plethora of taste receptors JOURNAL Neuron 25 (3), 507-510 (2000) PUBMED 10774719 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC095521.1 and AC034214.5. On Jun 15, 2005 this sequence version replaced gi:9625042. Summary: This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: BC095521.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-779 BC095521.1 1-779 780-1355 AC034214.5 5214-5789 FEATURES Location/Qualifiers source 1..1355 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="5" /map="5p15" gene 1..1355 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /note="taste receptor, type 2, member 1" /db_xref="GeneID:50834" /db_xref="HGNC:14909" /db_xref="HPRD:07267" /db_xref="MIM:604796" exon 1..1355 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="alignment:Splign:1.39.8" STS 247..1288 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /db_xref="UniSTS:485625" variation 248 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="c" /replace="t" /db_xref="dbSNP:2234229" variation 257 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="a" /replace="c" /db_xref="dbSNP:2234230" variation 277 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="a" /replace="g" /db_xref="dbSNP:41470" misc_feature 302..304 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /note="upstream in-frame stop codon" CDS 320..1219 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /note="taste receptor, family B, member 7; taste receptor family B member 7" /codon_start=1 /product="taste receptor type 2 member 1" /protein_id="NP_062545.1" /db_xref="GI:9625043" /db_xref="CCDS:CCDS3876.1" /db_xref="GeneID:50834" /db_xref="HGNC:14909" /db_xref="HPRD:07267" /db_xref="MIM:604796" /translation="
MLESHLIIYFLLAVIQFLLGIFTNGIIVVVNGIDLIKHRKMAPLDLLLSCLAVSRIFLQLFIFYVNVIVIFFIEFIMCSANCAILLFINELELWLATWLGVFYCAKVASVRHPLFIWLKMRISKLVPWMILGSLLYVSMICVFHSKYAGFMVPYFLRKFFSQNATIQKEDTLAIQIFSFVAEFSVPLLIFLFAVLLLIFSLGRHTRQMRNTVAGSRVPGRGAPISALLSILSFLILYFSHCMIKVFLSSLKFHIRRFIFLFFILVIGIYPSGHSLILILGNPKLKQNAKKFLLHSKCCQ
" misc_feature 320..1207 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /note="Mammalian taste receptor protein (TAS2R); Region: TAS2R; pfam05296" /db_xref="CDD:203230" misc_feature 347..409 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 485..547 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 563..625 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 692..754 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 854..916 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 986..1048 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" misc_feature 1091..1153 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1); transmembrane region" STS 320..1219 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /db_xref="UniSTS:480624" variation 447 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="c" /replace="t" /db_xref="dbSNP:2234231" variation 651 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="a" /replace="g" /db_xref="dbSNP:41469" variation 741 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="a" /replace="g" /db_xref="dbSNP:2234232" variation 935 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="c" /replace="t" /db_xref="dbSNP:2234233" variation 994 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="c" /replace="t" /db_xref="dbSNP:2234234" variation 1169 /gene="TAS2R1" /gene_synonym="T2R1; TRB7" /replace="c" /replace="t" /db_xref="dbSNP:2234235" ORIGIN
ttctcccagctgtctgaaggtgtctgattccattatttgcctgtgatgactttgaaagctaggtaaacctgtaaaatgcaaaagccatcaataagaagcaaattgatgctagagtatctcctccttatttgactgtctcagaactaaatagagaaagcagtgacataaacaaatgtacaccaccttcctgccccatgcctttattgttagtcttcttccccagaggagtcctgatctaattgaagagcgtgaacaacccaacctgtccaaaactttataacttcattattttttaagtaaataattttttattcctaaaatgctagagtctcacctcattatctattttcttcttgcagtgatacaatttcttcttgggattttcacaaatggcatcattgtggtggtgaatggcattgacttgatcaagcacagaaaaatggctccgctggatctccttctttcttgtctggcagtttctagaatttttctgcagttgttcatcttctacgttaatgtgattgttatcttcttcatagaattcatcatgtgttctgcgaattgtgcaattctcttatttataaatgaattggaactttggcttgccacatggctcggcgttttctattgtgccaaggttgccagcgtccgtcacccactcttcatctggttgaagatgaggatatccaagctggtcccatggatgatcctggggtctctgctatatgtatctatgatttgtgttttccatagcaaatatgcagggtttatggtcccatacttcctaaggaaatttttctcccaaaatgccacaattcaaaaagaagatacactggctatacagattttctcttttgttgctgagttctcagtgccattgcttatcttcctttttgctgttttgctcttgattttctctctggggaggcacacccggcaaatgagaaacacagtggccggcagcagggttcctggcaggggtgcacccatcagcgcgttgctgtctatcctgtccttcctgatcctctacttctcccactgcatgataaaagtttttctctcttctctaaagtttcacatcagaaggttcatctttctgttcttcatccttgtgattggtatatacccttctggacactctctcatcttaattttaggaaatcctaaattgaaacaaaatgcaaaaaagttcctcctccacagtaagtgctgtcagtgagagagaagttggatcagttcaaagaacccatgattcaatgatttacccatgcctgccacacttccctcagccagacaaagcagcctgttcataaatatacaacatgtccccttcaggcctgtttatccagcctgag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:50834 -> Molecular function: GO:0008527 [taste receptor activity] evidence: TAS GeneID:50834 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS GeneID:50834 -> Biological process: GO:0007635 [chemosensory behavior] evidence: TAS GeneID:50834 -> Biological process: GO:0050912 [detection of chemical stimulus involved in sensory perception of taste] evidence: TAS GeneID:50834 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:50834 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.