GGRNA Home | Help | Advanced search

2024-04-25 14:51:52, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_019599               1355 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA.
ACCESSION   NM_019599
VERSION     NM_019599.2  GI:67782322
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1355)
  AUTHORS   An,S.S., Wang,W.C., Koziol-White,C.J., Ahn,K., Lee,D.Y.,
            Kurten,R.C., Panettieri,R.A. Jr. and Liggett,S.B.
  TITLE     TAS2R activation promotes airway smooth muscle relaxation despite
            beta(2)-adrenergic receptor tachyphylaxis
  JOURNAL   Am. J. Physiol. Lung Cell Mol. Physiol. 303 (4), L304-L311 (2012)
   PUBMED   22683571
  REMARK    GeneRIF: Intracellular signaling and cell mechanics using isolated
            human airway smooth muscle, mouse tracheal responses, and human
            bronchial responses to characterize TAS2R relaxation in the context
            of beta(2)AR desensitization.
REFERENCE   2  (bases 1 to 1355)
  AUTHORS   Singh,N., Pydi,S.P., Upadhyaya,J. and Chelikani,P.
  TITLE     Structural basis of activation of bitter taste receptor T2R1 and
            comparison with Class A G-protein-coupled receptors (GPCRs)
  JOURNAL   J. Biol. Chem. 286 (41), 36032-36041 (2011)
   PUBMED   21852241
  REMARK    GeneRIF: Structural basis of activation of bitter taste receptor
            T2R1 and comparison with Class A G-protein-coupled receptors
            (GPCRs).
REFERENCE   3  (bases 1 to 1355)
  AUTHORS   Dai,W., You,Z., Zhou,H., Zhang,J. and Hu,Y.
  TITLE     Structure-function relationships of the human bitter taste receptor
            hTAS2R1: insights from molecular modeling studies
  JOURNAL   J. Recept. Signal Transduct. Res. 31 (3), 229-240 (2011)
   PUBMED   21619450
  REMARK    GeneRIF: The formation of a short helical segment in intracellular
            loop II may be necessary for the activation of hTAS2R1.
REFERENCE   4  (bases 1 to 1355)
  AUTHORS   Upadhyaya,J., Pydi,S.P., Singh,N., Aluko,R.E. and Chelikani,P.
  TITLE     Bitter taste receptor T2R1 is activated by dipeptides and
            tripeptides
  JOURNAL   Biochem. Biophys. Res. Commun. 398 (2), 331-335 (2010)
   PUBMED   20599705
  REMARK    GeneRIF: The ligand binding pocket in T2R1 is present on the
            extracellular surface of the receptor, and is formed by the
            transmembrane helices 1, 2, 3 and 7 and with extracellular loops 1
            and 2 forming a cap like structure on the binding pocket.
REFERENCE   5  (bases 1 to 1355)
  AUTHORS   Weiss,L.A., Arking,D.E., Daly,M.J. and Chakravarti,A.
  CONSRTM   Gene Discovery Project of Johns Hopkins & the Autism Consortium
  TITLE     A genome-wide linkage and association scan reveals novel loci for
            autism
  JOURNAL   Nature 461 (7265), 802-808 (2009)
   PUBMED   19812673
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   6  (bases 1 to 1355)
  AUTHORS   Matsunami,H., Montmayeur,J.P. and Buck,L.B.
  TITLE     A family of candidate taste receptors in human and mouse
  JOURNAL   Nature 404 (6778), 601-604 (2000)
   PUBMED   10766242
REFERENCE   7  (bases 1 to 1355)
  AUTHORS   Firestein,S.
  TITLE     The good taste of genomics
  JOURNAL   Nature 404 (6778), 552-553 (2000)
   PUBMED   10766221
REFERENCE   8  (bases 1 to 1355)
  AUTHORS   Chandrashekar,J., Mueller,K.L., Hoon,M.A., Adler,E., Feng,L.,
            Guo,W., Zuker,C.S. and Ryba,N.J.
  TITLE     T2Rs function as bitter taste receptors
  JOURNAL   Cell 100 (6), 703-711 (2000)
   PUBMED   10761935
REFERENCE   9  (bases 1 to 1355)
  AUTHORS   Adler,E., Hoon,M.A., Mueller,K.L., Chandrashekar,J., Ryba,N.J. and
            Zuker,C.S.
  TITLE     A novel family of mammalian taste receptors
  JOURNAL   Cell 100 (6), 693-702 (2000)
   PUBMED   10761934
REFERENCE   10 (bases 1 to 1355)
  AUTHORS   Kinnamon,S.C.
  TITLE     A plethora of taste receptors
  JOURNAL   Neuron 25 (3), 507-510 (2000)
   PUBMED   10774719
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC095521.1 and AC034214.5.
            On Jun 15, 2005 this sequence version replaced gi:9625042.
            
            Summary: This gene encodes a member of a family of candidate taste
            receptors that are members of the G protein-coupled receptor
            superfamily and that are specifically expressed by taste receptor
            cells of the tongue and palate epithelia. This intronless taste
            receptor gene encodes a 7-transmembrane receptor protein,
            functioning as a bitter taste receptor. This gene is mapped to
            chromosome 5p15, the location of a genetic locus (PROP) that
            controls the detection of the bitter compound
            6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: BC095521.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-779               BC095521.1         1-779
            780-1355            AC034214.5         5214-5789
FEATURES             Location/Qualifiers
     source          1..1355
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5p15"
     gene            1..1355
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /note="taste receptor, type 2, member 1"
                     /db_xref="GeneID:50834"
                     /db_xref="HGNC:14909"
                     /db_xref="HPRD:07267"
                     /db_xref="MIM:604796"
     exon            1..1355
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="alignment:Splign:1.39.8"
     STS             247..1288
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /db_xref="UniSTS:485625"
     variation       248
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2234229"
     variation       257
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2234230"
     variation       277
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41470"
     misc_feature    302..304
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /note="upstream in-frame stop codon"
     CDS             320..1219
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /note="taste receptor, family B, member 7; taste receptor
                     family B member 7"
                     /codon_start=1
                     /product="taste receptor type 2 member 1"
                     /protein_id="NP_062545.1"
                     /db_xref="GI:9625043"
                     /db_xref="CCDS:CCDS3876.1"
                     /db_xref="GeneID:50834"
                     /db_xref="HGNC:14909"
                     /db_xref="HPRD:07267"
                     /db_xref="MIM:604796"
                     /translation="
MLESHLIIYFLLAVIQFLLGIFTNGIIVVVNGIDLIKHRKMAPLDLLLSCLAVSRIFLQLFIFYVNVIVIFFIEFIMCSANCAILLFINELELWLATWLGVFYCAKVASVRHPLFIWLKMRISKLVPWMILGSLLYVSMICVFHSKYAGFMVPYFLRKFFSQNATIQKEDTLAIQIFSFVAEFSVPLLIFLFAVLLLIFSLGRHTRQMRNTVAGSRVPGRGAPISALLSILSFLILYFSHCMIKVFLSSLKFHIRRFIFLFFILVIGIYPSGHSLILILGNPKLKQNAKKFLLHSKCCQ
"
     misc_feature    320..1207
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /note="Mammalian taste receptor protein (TAS2R); Region:
                     TAS2R; pfam05296"
                     /db_xref="CDD:203230"
     misc_feature    347..409
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    485..547
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    563..625
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    692..754
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    854..916
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    986..1048
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     misc_feature    1091..1153
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
                     transmembrane region"
     STS             320..1219
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /db_xref="UniSTS:480624"
     variation       447
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2234231"
     variation       651
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41469"
     variation       741
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2234232"
     variation       935
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2234233"
     variation       994
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2234234"
     variation       1169
                     /gene="TAS2R1"
                     /gene_synonym="T2R1; TRB7"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2234235"
ORIGIN      
ttctcccagctgtctgaaggtgtctgattccattatttgcctgtgatgactttgaaagctaggtaaacctgtaaaatgcaaaagccatcaataagaagcaaattgatgctagagtatctcctccttatttgactgtctcagaactaaatagagaaagcagtgacataaacaaatgtacaccaccttcctgccccatgcctttattgttagtcttcttccccagaggagtcctgatctaattgaagagcgtgaacaacccaacctgtccaaaactttataacttcattattttttaagtaaataattttttattcctaaaatgctagagtctcacctcattatctattttcttcttgcagtgatacaatttcttcttgggattttcacaaatggcatcattgtggtggtgaatggcattgacttgatcaagcacagaaaaatggctccgctggatctccttctttcttgtctggcagtttctagaatttttctgcagttgttcatcttctacgttaatgtgattgttatcttcttcatagaattcatcatgtgttctgcgaattgtgcaattctcttatttataaatgaattggaactttggcttgccacatggctcggcgttttctattgtgccaaggttgccagcgtccgtcacccactcttcatctggttgaagatgaggatatccaagctggtcccatggatgatcctggggtctctgctatatgtatctatgatttgtgttttccatagcaaatatgcagggtttatggtcccatacttcctaaggaaatttttctcccaaaatgccacaattcaaaaagaagatacactggctatacagattttctcttttgttgctgagttctcagtgccattgcttatcttcctttttgctgttttgctcttgattttctctctggggaggcacacccggcaaatgagaaacacagtggccggcagcagggttcctggcaggggtgcacccatcagcgcgttgctgtctatcctgtccttcctgatcctctacttctcccactgcatgataaaagtttttctctcttctctaaagtttcacatcagaaggttcatctttctgttcttcatccttgtgattggtatatacccttctggacactctctcatcttaattttaggaaatcctaaattgaaacaaaatgcaaaaaagttcctcctccacagtaagtgctgtcagtgagagagaagttggatcagttcaaagaacccatgattcaatgatttacccatgcctgccacacttccctcagccagacaaagcagcctgttcataaatatacaacatgtccccttcaggcctgtttatccagcctgag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:50834 -> Molecular function: GO:0008527 [taste receptor activity] evidence: TAS
            GeneID:50834 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS
            GeneID:50834 -> Biological process: GO:0007635 [chemosensory behavior] evidence: TAS
            GeneID:50834 -> Biological process: GO:0050912 [detection of chemical stimulus involved in sensory perception of taste] evidence: TAS
            GeneID:50834 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:50834 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.