Home |
Help |
Advanced search
2024-04-16 23:25:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_019599 1355 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA.
ACCESSION NM_019599
VERSION NM_019599.2 GI:67782322
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1355)
AUTHORS An,S.S., Wang,W.C., Koziol-White,C.J., Ahn,K., Lee,D.Y.,
Kurten,R.C., Panettieri,R.A. Jr. and Liggett,S.B.
TITLE TAS2R activation promotes airway smooth muscle relaxation despite
beta(2)-adrenergic receptor tachyphylaxis
JOURNAL Am. J. Physiol. Lung Cell Mol. Physiol. 303 (4), L304-L311 (2012)
PUBMED 22683571
REMARK GeneRIF: Intracellular signaling and cell mechanics using isolated
human airway smooth muscle, mouse tracheal responses, and human
bronchial responses to characterize TAS2R relaxation in the context
of beta(2)AR desensitization.
REFERENCE 2 (bases 1 to 1355)
AUTHORS Singh,N., Pydi,S.P., Upadhyaya,J. and Chelikani,P.
TITLE Structural basis of activation of bitter taste receptor T2R1 and
comparison with Class A G-protein-coupled receptors (GPCRs)
JOURNAL J. Biol. Chem. 286 (41), 36032-36041 (2011)
PUBMED 21852241
REMARK GeneRIF: Structural basis of activation of bitter taste receptor
T2R1 and comparison with Class A G-protein-coupled receptors
(GPCRs).
REFERENCE 3 (bases 1 to 1355)
AUTHORS Dai,W., You,Z., Zhou,H., Zhang,J. and Hu,Y.
TITLE Structure-function relationships of the human bitter taste receptor
hTAS2R1: insights from molecular modeling studies
JOURNAL J. Recept. Signal Transduct. Res. 31 (3), 229-240 (2011)
PUBMED 21619450
REMARK GeneRIF: The formation of a short helical segment in intracellular
loop II may be necessary for the activation of hTAS2R1.
REFERENCE 4 (bases 1 to 1355)
AUTHORS Upadhyaya,J., Pydi,S.P., Singh,N., Aluko,R.E. and Chelikani,P.
TITLE Bitter taste receptor T2R1 is activated by dipeptides and
tripeptides
JOURNAL Biochem. Biophys. Res. Commun. 398 (2), 331-335 (2010)
PUBMED 20599705
REMARK GeneRIF: The ligand binding pocket in T2R1 is present on the
extracellular surface of the receptor, and is formed by the
transmembrane helices 1, 2, 3 and 7 and with extracellular loops 1
and 2 forming a cap like structure on the binding pocket.
REFERENCE 5 (bases 1 to 1355)
AUTHORS Weiss,L.A., Arking,D.E., Daly,M.J. and Chakravarti,A.
CONSRTM Gene Discovery Project of Johns Hopkins & the Autism Consortium
TITLE A genome-wide linkage and association scan reveals novel loci for
autism
JOURNAL Nature 461 (7265), 802-808 (2009)
PUBMED 19812673
REMARK GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
REFERENCE 6 (bases 1 to 1355)
AUTHORS Matsunami,H., Montmayeur,J.P. and Buck,L.B.
TITLE A family of candidate taste receptors in human and mouse
JOURNAL Nature 404 (6778), 601-604 (2000)
PUBMED 10766242
REFERENCE 7 (bases 1 to 1355)
AUTHORS Firestein,S.
TITLE The good taste of genomics
JOURNAL Nature 404 (6778), 552-553 (2000)
PUBMED 10766221
REFERENCE 8 (bases 1 to 1355)
AUTHORS Chandrashekar,J., Mueller,K.L., Hoon,M.A., Adler,E., Feng,L.,
Guo,W., Zuker,C.S. and Ryba,N.J.
TITLE T2Rs function as bitter taste receptors
JOURNAL Cell 100 (6), 703-711 (2000)
PUBMED 10761935
REFERENCE 9 (bases 1 to 1355)
AUTHORS Adler,E., Hoon,M.A., Mueller,K.L., Chandrashekar,J., Ryba,N.J. and
Zuker,C.S.
TITLE A novel family of mammalian taste receptors
JOURNAL Cell 100 (6), 693-702 (2000)
PUBMED 10761934
REFERENCE 10 (bases 1 to 1355)
AUTHORS Kinnamon,S.C.
TITLE A plethora of taste receptors
JOURNAL Neuron 25 (3), 507-510 (2000)
PUBMED 10774719
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC095521.1 and AC034214.5.
On Jun 15, 2005 this sequence version replaced gi:9625042.
Summary: This gene encodes a member of a family of candidate taste
receptors that are members of the G protein-coupled receptor
superfamily and that are specifically expressed by taste receptor
cells of the tongue and palate epithelia. This intronless taste
receptor gene encodes a 7-transmembrane receptor protein,
functioning as a bitter taste receptor. This gene is mapped to
chromosome 5p15, the location of a genetic locus (PROP) that
controls the detection of the bitter compound
6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: BC095521.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-779 BC095521.1 1-779
780-1355 AC034214.5 5214-5789
FEATURES Location/Qualifiers
source 1..1355
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5p15"
gene 1..1355
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/note="taste receptor, type 2, member 1"
/db_xref="GeneID:50834"
/db_xref="HGNC:14909"
/db_xref="HPRD:07267"
/db_xref="MIM:604796"
exon 1..1355
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="alignment:Splign:1.39.8"
STS 247..1288
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/db_xref="UniSTS:485625"
variation 248
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="c"
/replace="t"
/db_xref="dbSNP:2234229"
variation 257
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="a"
/replace="c"
/db_xref="dbSNP:2234230"
variation 277
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="a"
/replace="g"
/db_xref="dbSNP:41470"
misc_feature 302..304
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/note="upstream in-frame stop codon"
CDS 320..1219
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/note="taste receptor, family B, member 7; taste receptor
family B member 7"
/codon_start=1
/product="taste receptor type 2 member 1"
/protein_id="NP_062545.1"
/db_xref="GI:9625043"
/db_xref="CCDS:CCDS3876.1"
/db_xref="GeneID:50834"
/db_xref="HGNC:14909"
/db_xref="HPRD:07267"
/db_xref="MIM:604796"
/translation="
MLESHLIIYFLLAVIQFLLGIFTNGIIVVVNGIDLIKHRKMAPLDLLLSCLAVSRIFLQLFIFYVNVIVIFFIEFIMCSANCAILLFINELELWLATWLGVFYCAKVASVRHPLFIWLKMRISKLVPWMILGSLLYVSMICVFHSKYAGFMVPYFLRKFFSQNATIQKEDTLAIQIFSFVAEFSVPLLIFLFAVLLLIFSLGRHTRQMRNTVAGSRVPGRGAPISALLSILSFLILYFSHCMIKVFLSSLKFHIRRFIFLFFILVIGIYPSGHSLILILGNPKLKQNAKKFLLHSKCCQ
"
misc_feature 320..1207
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/note="Mammalian taste receptor protein (TAS2R); Region:
TAS2R; pfam05296"
/db_xref="CDD:203230"
misc_feature 347..409
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 485..547
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 563..625
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 692..754
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 854..916
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 986..1048
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
misc_feature 1091..1153
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9NYW7.1);
transmembrane region"
STS 320..1219
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/db_xref="UniSTS:480624"
variation 447
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="c"
/replace="t"
/db_xref="dbSNP:2234231"
variation 651
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="a"
/replace="g"
/db_xref="dbSNP:41469"
variation 741
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="a"
/replace="g"
/db_xref="dbSNP:2234232"
variation 935
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="c"
/replace="t"
/db_xref="dbSNP:2234233"
variation 994
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="c"
/replace="t"
/db_xref="dbSNP:2234234"
variation 1169
/gene="TAS2R1"
/gene_synonym="T2R1; TRB7"
/replace="c"
/replace="t"
/db_xref="dbSNP:2234235"
ORIGIN
ttctcccagctgtctgaaggtgtctgattccattatttgcctgtgatgactttgaaagctaggtaaacctgtaaaatgcaaaagccatcaataagaagcaaattgatgctagagtatctcctccttatttgactgtctcagaactaaatagagaaagcagtgacataaacaaatgtacaccaccttcctgccccatgcctttattgttagtcttcttccccagaggagtcctgatctaattgaagagcgtgaacaacccaacctgtccaaaactttataacttcattattttttaagtaaataattttttattcctaaaatgctagagtctcacctcattatctattttcttcttgcagtgatacaatttcttcttgggattttcacaaatggcatcattgtggtggtgaatggcattgacttgatcaagcacagaaaaatggctccgctggatctccttctttcttgtctggcagtttctagaatttttctgcagttgttcatcttctacgttaatgtgattgttatcttcttcatagaattcatcatgtgttctgcgaattgtgcaattctcttatttataaatgaattggaactttggcttgccacatggctcggcgttttctattgtgccaaggttgccagcgtccgtcacccactcttcatctggttgaagatgaggatatccaagctggtcccatggatgatcctggggtctctgctatatgtatctatgatttgtgttttccatagcaaatatgcagggtttatggtcccatacttcctaaggaaatttttctcccaaaatgccacaattcaaaaagaagatacactggctatacagattttctcttttgttgctgagttctcagtgccattgcttatcttcctttttgctgttttgctcttgattttctctctggggaggcacacccggcaaatgagaaacacagtggccggcagcagggttcctggcaggggtgcacccatcagcgcgttgctgtctatcctgtccttcctgatcctctacttctcccactgcatgataaaagtttttctctcttctctaaagtttcacatcagaaggttcatctttctgttcttcatccttgtgattggtatatacccttctggacactctctcatcttaattttaggaaatcctaaattgaaacaaaatgcaaaaaagttcctcctccacagtaagtgctgtcagtgagagagaagttggatcagttcaaagaacccatgattcaatgatttacccatgcctgccacacttccctcagccagacaaagcagcctgttcataaatatacaacatgtccccttcaggcctgtttatccagcctgag
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:50834 -> Molecular function: GO:0008527 [taste receptor activity] evidence: TAS
GeneID:50834 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS
GeneID:50834 -> Biological process: GO:0007635 [chemosensory behavior] evidence: TAS
GeneID:50834 -> Biological process: GO:0050912 [detection of chemical stimulus involved in sensory perception of taste] evidence: TAS
GeneID:50834 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:50834 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.