GGRNA Home | Help | Advanced search

2019-03-22 05:11:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_019595               6031 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens intersectin 2 (ITSN2), transcript variant 3, mRNA.
ACCESSION   NM_019595
VERSION     NM_019595.3  GI:194294522
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6031)
  AUTHORS   McClay,J.L., Adkins,D.E., Aberg,K., Bukszar,J., Khachane,A.N.,
            Keefe,R.S., Perkins,D.O., McEvoy,J.P., Stroup,T.S., Vann,R.E.,
            Beardsley,P.M., Lieberman,J.A., Sullivan,P.F. and van den Oord,E.J.
  TITLE     Genome-wide pharmacogenomic study of neurocognition as an indicator
            of antipsychotic treatment response in schizophrenia
  JOURNAL   Neuropsychopharmacology 36 (3), 616-626 (2011)
   PUBMED   21107309
REFERENCE   2  (bases 1 to 6031)
  AUTHORS   Takefuji,M., Asano,H., Mori,K., Amano,M., Kato,K., Watanabe,T.,
            Morita,Y., Katsumi,A., Itoh,T., Takenawa,T., Hirashiki,A.,
            Izawa,H., Nagata,K., Hirayama,H., Takatsu,F., Naoe,T., Yokota,M.
            and Kaibuchi,K.
  TITLE     Mutation of ARHGAP9 in patients with coronary spastic angina
  JOURNAL   J. Hum. Genet. 55 (1), 42-49 (2010)
   PUBMED   19911011
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 6031)
  AUTHORS   Klein,I.K., Predescu,D.N., Sharma,T., Knezevic,I., Malik,A.B. and
            Predescu,S.
  TITLE     Intersectin-2L regulates caveola endocytosis secondary to
            Cdc42-mediated actin polymerization
  JOURNAL   J. Biol. Chem. 284 (38), 25953-25961 (2009)
   PUBMED   19622753
  REMARK    GeneRIF: ITSN-2L, a guanine nucleotide exchange factor for Cdc42,
            regulates different steps of caveola endocytosis in ECs by
            controlling the temporal and spatial actin polymerization and
            remodeling sub-adjacent to the plasma membrane.
REFERENCE   4  (bases 1 to 6031)
  AUTHORS   Voss,M., Lettau,M. and Janssen,O.
  TITLE     Identification of SH3 domain interaction partners of human FasL
            (CD178) by phage display screening
  JOURNAL   BMC Immunol. 10, 53 (2009)
   PUBMED   19807924
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 6031)
  AUTHORS   Lim,C.S., Seet,B.T., Ingham,R.J., Gish,G., Matskova,L., Winberg,G.,
            Ernberg,I. and Pawson,T.
  TITLE     The K15 protein of Kaposi's sarcoma-associated herpesvirus recruits
            the endocytic regulator intersectin 2 through a selective SH3
            domain interaction
  JOURNAL   Biochemistry 46 (35), 9874-9885 (2007)
   PUBMED   17696407
  REMARK    GeneRIF: We show that the PPLP motif of K15 protein selectively
            binds the SH3-C domain of an endocytic adaptor protein, Intersectin
            2 (ITSN2).
REFERENCE   6  (bases 1 to 6031)
  AUTHORS   Nakayama,M., Kikuno,R. and Ohara,O.
  TITLE     Protein-protein interactions between large proteins: two-hybrid
            screening using a functionally classified library composed of long
            cDNAs
  JOURNAL   Genome Res. 12 (11), 1773-1784 (2002)
   PUBMED   12421765
REFERENCE   7  (bases 1 to 6031)
  AUTHORS   McGavin,M.K., Badour,K., Hardy,L.A., Kubiseski,T.J., Zhang,J. and
            Siminovitch,K.A.
  TITLE     The intersectin 2 adaptor links Wiskott Aldrich Syndrome protein
            (WASp)-mediated actin polymerization to T cell antigen receptor
            endocytosis
  JOURNAL   J. Exp. Med. 194 (12), 1777-1787 (2001)
   PUBMED   11748279
REFERENCE   8  (bases 1 to 6031)
  AUTHORS   Pucharcos,C., Casas,C., Nadal,M., Estivill,X. and de la Luna,S.
  TITLE     The human intersectin genes and their spliced variants are
            differentially expressed
  JOURNAL   Biochim. Biophys. Acta 1521 (1-3), 1-11 (2001)
   PUBMED   11690630
REFERENCE   9  (bases 1 to 6031)
  AUTHORS   Pucharcos,C., Estivill,X. and de la Luna,S.
  TITLE     Intersectin 2, a new multimodular protein involved in
            clathrin-mediated endocytosis
  JOURNAL   FEBS Lett. 478 (1-2), 43-51 (2000)
   PUBMED   10922467
REFERENCE   10 (bases 1 to 6031)
  AUTHORS   Sparks,A.B., Hoffman,N.G., McConnell,S.J., Fowlkes,D.M. and
            Kay,B.K.
  TITLE     Cloning of ligand targets: systematic isolation of SH3
            domain-containing proteins
  JOURNAL   Nat. Biotechnol. 14 (6), 741-744 (1996)
   PUBMED   9630982
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA382952.1, AF182199.1,
            BC146779.1 and AF182198.1.
            On Jul 17, 2008 this sequence version replaced gi:22325380.
            
            Summary: This gene encodes a cytoplasmic protein which contains SH3
            domains. This protein is a member of a family of proteins involved
            in clathrin-mediated endocytosis. Intersectin 2 is thought to
            regulate the formation of clathrin-coated vesicles and also may
            function in the induction of T cell antigen receptor (TCR)
            endocytosis. Alternatively spliced transcript variants have been
            found for this gene that encode three distinct isoforms. Additional
            variants have been found but their full length nature has not been
            determined. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (3) lacks an alternate in-frame
            exon, compared to variant 1. This results in a shorter protein
            (isoform 3) that lacks an internal segment, compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB033082.1, BC146779.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-199               DA382952.1         251-449
            200-224             AF182199.1         179-203
            225-4833            BC146779.1         132-4740
            4834-6031           AF182198.1         4894-6091
FEATURES             Location/Qualifiers
     source          1..6031
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2pter-p25.1"
     gene            1..6031
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="intersectin 2"
                     /db_xref="GeneID:50618"
                     /db_xref="HGNC:6184"
                     /db_xref="MIM:604464"
     exon            1..225
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            226..289
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    238..240
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="upstream in-frame stop codon"
     CDS             259..5271
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="isoform 3 is encoded by transcript variant 3; SH3
                     domain-containing protein 1B; SH3P18-like WASP-associated
                     protein"
                     /codon_start=1
                     /product="intersectin-2 isoform 3"
                     /protein_id="NP_062541.3"
                     /db_xref="GI:194294523"
                     /db_xref="CCDS:CCDS1711.2"
                     /db_xref="GeneID:50618"
                     /db_xref="HGNC:6184"
                     /db_xref="MIM:604464"
                     /translation="
MMAQFPTAMNGGPNMWAITSEERTKHDRQFDNLKPSGGYITGDQARNFFLQSGLPAPVLAEIWALSDLNKDGKMDQQEFSIAMKLIKLKLQGQQLPVVLPPIMKQPPMFSPLISARFGMGSMPNLSIPQPLPPAAPITSLSSATSGTNLPPLMMPTPLVPSVSTSSLPNGTASLIQPLPIPYSSSTLPHGSSYSLMMGGFGGASIQKAQSLIDLGSSSSTSSTASLSGNSPKTGTSEWAVPQPTRLKYRQKFNTLDKSMSGYLSGFQARNALLQSNLSQTQLATIWTLADVDGDGQLKAEEFILAMHLTDMAKAGQPLPLTLPPELVPPSFRGGKQIDSINGTLPSYQKMQEEEPQKKLPVTFEDKRKANYERGNMELEKRRQALMEQQQREAERKAQKEKEEWERKQRELQEQEWKKQLELEKRLEKQRELERQREEERRKDIERREAAKQELERQRRLEWERIRRQELLNQKNREQEEIVRLNSKKKNLHLELEALNGKHQQISGRLQDVRLKKQTQKTELEVLDKQCDLEIMEIKQLQQELQEYQNKLIYLVPEKQLLNERIKNMQFSNTPDSGVSLLHKKSLEKEELCQRLKEQLDALEKETASKLSEMDSFNNQLKELRETYNTQQLALEQLYKIKRDKLKEIERKRLELMQKKKLEDEAARKAKQGKENLWKENLRKEEEEKQKRLQEEKTQEKIQEEERKAEEKQRKDKDTLKAEEKKRETASVLVNYRALYPFEARNHDEMSFNSGDIIQVDEKTVGEPGWLYGSFQGNFGWFPCNYVEKMPSSENEKAVSPKKALLPPTVSLSATSTSSEPLSSNQPASVTDYQNVSFSNLTVNTSWQKKSAFTRTVSPGSVSPIHGQGQVVENLKAQALCSWTAKKDNHLNFSKHDIITVLEQQENWWFGEVHGGRGWFPKSYVKIIPGSEVKREEPEALYAAVNKKPTSAAYSVGEEYIALYPYSSVEPGDLTFTEGEEILVTQKDGEWWTGSIGDRSGIFPSNYVKPKDQESFGSASKSGASNKKPEIAQVTSAYVASGSEQLSLAPGQLILILKKNTSGWWQGELQARGKKRQKGWFPASHVKLLGPSSERATPAFHPVCQVIAMYDYAANNEDELSFSKGQLINVMNKDDPDWWQGEINGVTGLFPSNYVKMTTDSDPSQQWCADLQTLDTMQPIERKRQGYIHELIQTEERYMADLQLVVEVFQKRMAESGFLTEGEMALIFVNWKELIMSNTKLLKALRVRKKTGGEKMPVQMIGDILAAELSHMQAYIRFCSCQLNGAALLQQKTDEDTDFKEFLKKLASDPRCKGMPLSSFLLKPMQRITRYPLLIRSILENTPESHADHSSLKLALERAEELCSQVNEGVREKENSDRLEWIQAHVQCEGLAEQLIFNSLTNCLGPRKLLHSGKLYKTKSNKELHGFLFNDFLLLTYMVKQFAVSSGSEKLFSSKSNAQFKMYKTPIFLNEVLVKLPTDPSSDEPVFHISHIDRVYTLRTDNINERTAWVQKIKAASEQYIDTEKKKREKAYQARSQKTSGIGRLMVHVIEATELKACKPNGKSNPYCEISMGSQSYTTRTIQDTLNPKWNFNCQFFIKDLYQDVLCLTLFDRDQFSPDDFLGRTEIPVAKIRTEQESKGPMTRRLLLHEVPTGEVWVRFDLQLFEQKTLL
"
     misc_feature    301..579
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Eps15 homology domain; Region: EH; smart00027"
                     /db_xref="CDD:197477"
     misc_feature    334..507
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Eps15 homology domain; found in proteins implicated
                     in endocytosis, vesicle transport, and signal
                     transduction. The alignment contains a pair of EF-hand
                     motifs, typically one of them is canonical and binds to
                     Ca2+, while the other may not bind to Ca2+. A...; Region:
                     EH; cd00052"
                     /db_xref="CDD:28934"
     misc_feature    order(352..360,376..390)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="pseudo EF-hand loop; other site"
                     /db_xref="CDD:28934"
     misc_feature    order(403..405,433..435,445..447)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide binding pocket; other site"
                     /db_xref="CDD:28934"
     misc_feature    order(457..459,463..465,469..471,490..492)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28934"
     misc_feature    886..888
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NZM3.3); phosphorylation site"
     misc_feature    946..948
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NZM3.3); phosphorylation site"
     misc_feature    967..1206
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Eps15 homology domain; Region: EH; smart00027"
                     /db_xref="CDD:197477"
     misc_feature    1000..1200
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Eps15 homology domain; found in proteins implicated
                     in endocytosis, vesicle transport, and signal
                     transduction. The alignment contains a pair of EF-hand
                     motifs, typically one of them is canonical and binds to
                     Ca2+, while the other may not bind to Ca2+. A...; Region:
                     EH; cd00052"
                     /db_xref="CDD:28934"
     misc_feature    order(1018..1026,1045..1059)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="pseudo EF-hand loop; other site"
                     /db_xref="CDD:28934"
     misc_feature    order(1072..1074,1102..1104,1114..1116)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide binding pocket; other site"
                     /db_xref="CDD:28934"
     misc_feature    order(1126..1128,1132..1134,1138..1140,1159..1161)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28934"
     misc_feature    1975..1977
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q9NZM3.3); phosphorylation site"
     misc_feature    2452..2622
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="First Src homology 3 domain (or SH3A) of
                     Intersectin-2; Region: SH3_Intersectin2_1; cd11988"
                     /db_xref="CDD:212921"
     misc_feature    order(2473..2475,2479..2481,2488..2490,2500..2502,
                     2560..2565,2602..2604,2608..2613)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212921"
     misc_feature    2842..2844
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NZM3.3); phosphorylation site"
     misc_feature    2881..3036
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Second Src homology 3 domain (or SH3B) of
                     Intersectin-2; Region: SH3_Intersectin2_2; cd11990"
                     /db_xref="CDD:212923"
     misc_feature    order(2896..2898,2902..2904,2911..2913,2923..2925,
                     2974..2979,3016..3018,3022..3027)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212923"
     misc_feature    3079..3081
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (Q9NZM3.3); phosphorylation site"
     misc_feature    3130..3285
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Third Src homology 3 domain (or SH3C) of
                     Intersectin-2; Region: SH3_Intersectin2_3; cd11992"
                     /db_xref="CDD:212925"
     misc_feature    order(3145..3147,3151..3153,3160..3162,3172..3174,
                     3223..3228,3265..3267,3271..3276)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212925"
     misc_feature    3346..3522
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Fourth Src homology 3 domain (or SH3D) of
                     Intersectin-2; Region: SH3_Intersectin2_4; cd11994"
                     /db_xref="CDD:212927"
     misc_feature    order(3361..3363,3367..3369,3376..3378,3388..3390,
                     3442..3447,3499..3501,3505..3510)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212927"
     misc_feature    3565..3726
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Fifth Src homology 3 domain (or SH3E) of
                     Intersectin-2; Region: SH3_Intersectin2_5; cd11996"
                     /db_xref="CDD:212929"
     misc_feature    order(3583..3585,3589..3591,3598..3600,3610..3612,
                     3664..3669,3706..3708,3712..3717)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212929"
     misc_feature    3805..4356
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cd00160"
                     /db_xref="CDD:29100"
     misc_feature    order(3823..3825,3835..3837,4123..4125,4207..4212,
                     4219..4224,4228..4233,4240..4245,4252..4257,4264..4266,
                     4342..4344,4354..4356)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:29100"
     misc_feature    4486..4803
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="Pleckstrin homology (PH) domain; Region: PH;
                     cd00821"
                     /db_xref="CDD:176270"
     misc_feature    order(4486..4506,4519..4539,4546..4566,4648..4662,
                     4672..4686,4711..4731,4738..4755,4768..4803)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="core domain; other site"
                     /db_xref="CDD:176270"
     misc_feature    order(4504..4506,4519..4521,4525..4533)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="putative lipid binding motif; other site"
                     /db_xref="CDD:176270"
     misc_feature    4840..5244
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="C2 domain present in Intersectin; Region:
                     C2_Intersectin; cd08375"
                     /db_xref="CDD:176021"
     misc_feature    order(4948..4950,5089..5091,5095..5097,5113..5115)
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /note="putative Ca2+ binding site [ion binding]; other
                     site"
                     /db_xref="CDD:176021"
     exon            290..382
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            383..446
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            447..610
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            611..814
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            815..911
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            912..1051
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1052..1115
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1116..1253
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1254..1339
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1340..1602
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1603..1752
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1753..1893
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1894..1981
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            1982..2121
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2122..2258
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2259..2434
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2435..2532
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2533..2714
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2715..2859
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            2860..3065
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3066..3130
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3131..3297
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3298..3343
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3344..3465
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3466..3562
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3563..3754
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3755..3876
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3877..3983
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            3984..4167
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     variation       4037
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731625"
     exon            4168..4266
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            4267..4434
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            4435..4650
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            4651..4772
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     STS             4654..4772
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /standard_name="A004Q30"
                     /db_xref="UniSTS:21780"
     exon            4773..4855
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     variation       4834
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3208747"
     exon            4856..4939
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            4940..5113
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     exon            5114..6031
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /inference="alignment:Splign:1.39.8"
     STS             5688..5759
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /standard_name="STS-Z40060"
                     /db_xref="UniSTS:47191"
     STS             5832..5968
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
                     /standard_name="RH12863"
                     /db_xref="UniSTS:71667"
     polyA_signal    6007..6012
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
     polyA_site      6030
                     /gene="ITSN2"
                     /gene_synonym="PRO2015; SH3D1B; SH3P18; SWA; SWAP"
ORIGIN      
cggccgccatgttgttgtggggctgaggcggcgccggcggagccctgagcggctgtgacaggctacgcaacaggttcgcgggcggcggcctgacgaccaagccagctgcagtggcggcgacggcggcagagcagggtctccccgcgcctgcccgcgcccaggctgccggtgctgagggacgcggagtcgcgctgtgacgagcgggaggcgcggcgagggcgccagatggctgagagctagcaaggaaaactcaggaccatgatggctcagtttcccacagctatgaatggagggccaaacatgtgggctattacctctgaagaacgtactaagcatgacaggcagtttgataacctcaaaccttcaggaggttacataacaggtgatcaagcacgtaattttttcctacaatcaggtctgccggcccctgttttagctgaaatatgggctttatcagacctaaacaaggatgggaagatggatcagcaagagttctccatagctatgaaactcatcaaactgaagcttcaaggccaacagttgcctgtggttctccctcctattatgaagcaaccccctatgttttctccattaatttctgctcgttttggaatgggaagcatgcccaatctgtccattcctcagccattgcctccagctgcacctataacatcattgtcttctgcgacttcagggaccaaccttcctcccttaatgatgcccactcccctagtgccttctgttagcacatcatcattaccaaatggaaccgccagtctcattcagcctttacccattccttattcttcttcaacattgcctcatgggtcatcttatagtctgatgatgggaggatttggaggtgctagtatacagaaagcgcagtctctgattgatttaggatctagtagctcaacttcctcgactgcttcactctcagggaactcacccaagactgggacctcagagtgggcagttcctcagcctacaagattaaaatatcggcaaaaatttaatactcttgacaaaagtatgagtggatatctctcaggttttcaagctagaaatgcccttcttcagtcaaatctttctcaaactcagctggctactatttggactctggctgacgttgatggtgatggacagctaaaagcagaagagtttattcttgcaatgcaccttactgacatggccaaagctggacagccattaccactgactttacctcctgagcttgttcctccatctttcagaggaggaaagcaaattgattccattaatggaactctgccttcatatcagaaaatgcaagaagaggagcctcagaagaaattaccagttacttttgaggacaaacggaaagccaactatgagcgagggaacatggagctggaaaagcgacgccaagccttgatggagcagcaacaaagggaggcagaacgtaaagcccagaaagaaaaggaagagtgggaacgaaaacagagagaattacaagaacaagaatggaagaaacaacttgaattagaaaaacgcttagagaagcaacgggaattggagagacaacgagaggaagaaaggagaaaagacatagaaagacgagaggcagcaaaacaggaacttgaacgacaacgtcgcttagaatgggagagaattcggcgacaggagcttctcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaagaatcttcatcttgagttggaagcactgaatggcaaacatcagcagatctcaggcagacttcaggatgtccgactcaaaaagcaaactcaaaagactgagctggaagttctggataagcagtgtgacttggaaattatggaaatcaagcaacttcaacaggaacttcaggaatatcagaataagcttatctatctggtacctgagaagcaattattaaatgaaagaattaaaaacatgcagttcagtaacacacctgattcaggggtcagtttacttcataaaaaatcattagaaaaggaagaattatgccaaagacttaaagaacagttagatgctcttgaaaaagaaactgcatctaagctgtcagaaatggattcttttaacaatcaactaaaggaactgagagaaacctacaacacacagcagttagcccttgaacagctttataagatcaaacgtgacaagttgaaggaaattgaaaggaaaagattagaactaatgcagaaaaagaaactagaagatgaggctgcaaggaaagcaaagcaaggaaaagaaaacttatggaaagaaaatcttagaaaggaggaagaagaaaaacaaaagcgactccaggaagaaaaaacacaagaaaaaattcaagaagaggaacggaaagctgaggagaaacaacgtaaggataaggatactttgaaagctgaggagaaaaaacgtgagacagctagtgttttggtgaattatagagcattatacccctttgaagcaaggaaccatgatgagatgagttttaattctggagatataattcaggttgatgaaaaaaccgtaggagaacctggttggctttatggtagttttcaaggaaattttggctggtttccatgcaattatgtagaaaaaatgccatcaagtgaaaatgaaaaagctgtatctccaaagaaggccttacttcctcctacagtttctttatctgctacctcaacttcctctgaaccactttcttcaaatcaaccagcatcagtgactgattatcaaaatgtatctttttcaaacctaactgtaaatacatcatggcagaaaaaatcagccttcactcgaactgtgtcccctggatctgtatcacctattcatggacagggacaagtggtagaaaacttaaaagcacaggccctttgttcctggactgcaaagaaagataaccacttgaacttctcaaaacatgacattattactgtcttggagcagcaagaaaattggtggtttggggaggtgcatggaggaagaggatggtttcccaaatcttatgtcaagatcattcctgggagtgaagtaaaacgggaagaaccagaagctttgtatgcagctgtaaataagaaacctacctcggcagcctattcagttggagaagaatatattgcactttatccatattcaagtgtggaacctggagatttgactttcacagaaggtgaagaaatattggtgacccagaaagatggagagtggtggacaggaagtattggagatagaagtggaatttttccatcaaactatgtcaaaccaaaggatcaagagagttttgggagtgctagcaagtctggagcatcaaataaaaaacctgagattgctcaggtaacttcagcatatgttgcttctggttctgaacaacttagccttgcaccaggacagttaatattaattctaaagaaaaatacaagtgggtggtggcaaggagagttacaggccagaggaaaaaagcgacagaaaggatggtttcctgccagtcatgttaaacttttgggtccaagtagtgaaagagccacacctgcctttcatcctgtatgtcaggtgattgctatgtatgactatgcagcaaataatgaagatgagctcagtttctccaagggacaactcattaatgttatgaacaaagatgatcctgattggtggcaaggagagatcaacggggtgactggtctctttccttcaaactacgttaagatgacgacagactcagatccaagtcaacagtggtgtgctgatctgcaaaccctggacacaatgcagccaattgagaggaaaagacagggctatattcatgagctgattcagaccgaagagcggtacatggctgaccttcagctcgtcgtcgaggtttttcagaaacgcatggcagagtcaggctttctcactgaaggggagatggccctgatttttgttaactggaaggagctcatcatgtccaacacaaagctgctgaaggctttgcgggtgcggaagaagaccgggggcgagaagatgccggtgcagatgattggggacatcctggccgctgagctgtcccacatgcaggcttacatcaggttctgcagctgccagcttaatggagcagctctgttacagcagaagacagatgaagacacagatttcaaagaatttttaaagaagctggcatctgacccgcggtgtaaaggaatgcccctctccagcttcctgctgaaacccatgcagaggatcacccgctacccactgctcatcagaagtattctggagaacaccccggagagccatgcagaccattcctccctaaagctggccctcgagcgggcagaggagctgtgctctcaagtgaatgagggagttcgggagaaggaaaactcggaccgactggagtggatccaggcgcacgtgcagtgtgaaggcctcgcggagcaacttattttcaactctctcaccaactgcctggggccccggaagctcttacacagtgggaaattatacaagaccaagagcaacaaggaactgcacggattcctcttcaatgacttcctgcttcttacctacatggtcaagcagtttgctgtttcctctggctctgagaaacttttcagctcgaagtccaatgctcaattcaaaatgtataaaacgcccattttcctgaatgaagtcttggtgaaactgcccacagacccttccagcgatgagcctgtcttccacatttcccacattgatcgggtctacaccctccgaacagacaacattaatgagaggaccgcctgggtgcagaagatcaaggcggcgtctgagcagtacatcgacaccgagaagaagaagcgtgagaaagcttaccaagcccgctcccaaaagacttcaggcattgggcgcctgatggtgcatgtcattgaagctacagaattaaaagcctgcaaaccaaatggaaagagcaacccatactgtgaaatcagcatgggctcccagagctacaccaccaggaccatccaggacacactcaatcccaagtggaattttaactgccagttctttattaaggatctctaccaagacgtgctgtgtctcaccctgtttgacagagaccagttttcaccagatgatttcctgggtcgtactgaaattccagtggcaaaaattcgaacagaacaggaaagcaaaggccctatgacccgccgactgctgctgcatgaggtccccaccggggaggtctgggtccgttttgacctgcagctttttgagcaaaaaactctcctgtaggggttctaaaggacagcaccagcgggacagcccacaaggctggggctggagaatgagagactgcgctctcttggggctgagggagcaccatgcagcttcacccctcacaaagccatgcacgctgggggctctgttttcctgcacactaaatagctagcaatctatgcaaacacctttcccataaagaaaccaaaccccatagtacagtgccttgtcctagtgttcacatgttcagctctgtttgtttagatgccaaggtttccattttcagggctataaaaagtattacttggaaatgaggcatcagaccaccagatgttaccgctcggttgaatgtgtccaccgtggagtggtttggtgacgctgtaaccattccacgccagtgacctctgctgggtcacagccactcaggaggggaagggtcaggatgagaggctgcagcctcgacacttggcgcggcctgatactgaaatagcgtctactcgtgcactgaataaaaacagaaacttgatcattttattcctgattagattttatcactctctgctaagacaatatagtctggagtataagtgggaaagcttgatttaaatactgtgaactctaataatgtggaaaatatttttcaactttaattttctgaagtataaattatttatgtaaattcattgtttttgcatatttcttaggacatgcatctttaagctttatcattgcccatatgtacagaaagagaataaagacatatgtttatggatgg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:50618 -> Molecular function: GO:0005070 [SH3/SH2 adaptor activity] evidence: TAS
            GeneID:50618 -> Molecular function: GO:0005089 [Rho guanyl-nucleotide exchange factor activity] evidence: IEA
            GeneID:50618 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:50618 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
            GeneID:50618 -> Biological process: GO:0006897 [endocytosis] evidence: IEA
            GeneID:50618 -> Biological process: GO:0035023 [regulation of Rho protein signal transduction] evidence: IEA
            GeneID:50618 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.