GGRNA Home | Help | Advanced search

2019-03-26 15:04:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_019066               4298 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens MAGE-like 2 (MAGEL2), mRNA.
ACCESSION   NM_019066
VERSION     NM_019066.4  GI:257900507
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4298)
  AUTHORS   Hao,Y.H., Doyle,J.M., Ramanathan,S., Gomez,T.S., Jia,D., Xu,M.,
            Chen,Z.J., Billadeau,D.D., Rosen,M.K. and Potts,P.R.
  TITLE     Regulation of WASH-dependent actin polymerization and protein
            trafficking by ubiquitination
  JOURNAL   Cell 152 (5), 1051-1064 (2013)
   PUBMED   23452853
  REMARK    GeneRIF: These findings provide a cellular and molecular function
            for MAGE-L2-TRIM27 in retrograde transport, including an
            unappreciated role of K63-linked ubiquitination and identification
            of an activating signal of the WASH regulatory complex.
REFERENCE   2  (bases 1 to 4298)
  AUTHORS   Fukuo,Y., Kishi,T., Okochi,T., Kitajima,T., Tsunoka,T.,
            Okumukura,T., Kinoshita,Y., Kawashima,K., Yamanouchi,Y.,
            Umene-Nakano,W., Naitoh,H., Inada,T., Yoshimura,R., Nakamura,J.,
            Ozaki,N. and Iwata,N.
  TITLE     Lack of association between MAGEL2 and schizophrenia and mood
            disorders in the Japanese population
  JOURNAL   Neuromolecular Med. 12 (3), 285-291 (2010)
   PUBMED   20467835
  REMARK    GeneRIF: Results suggest that MAGEL2 may not play a role in the
            pathophysiology of schizophrenia and mood disorders in the Japanese
            population.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 4298)
  AUTHORS   Lee,S., Kozlov,S., Hernandez,L., Chamberlain,S.J., Brannan,C.I.,
            Stewart,C.L. and Wevrick,R.
  TITLE     Expression and imprinting of MAGEL2 suggest a role in Prader-willi
            syndrome and the homologous murine imprinting phenotype
  JOURNAL   Hum. Mol. Genet. 9 (12), 1813-1819 (2000)
   PUBMED   10915770
REFERENCE   4  (bases 1 to 4298)
  AUTHORS   Boccaccio,I., Glatt-Deeley,H., Watrin,F., Roeckel,N., Lalande,M.
            and Muscatelli,F.
  TITLE     The human MAGEL2 gene and its mouse homologue are paternally
            expressed and mapped to the Prader-Willi region
  JOURNAL   Hum. Mol. Genet. 8 (13), 2497-2505 (1999)
   PUBMED   10556298
  REMARK    GeneRIF: MAGEL2 gene is imprinted, with preferential expression
            from the paternal allele.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC124309.7.
            This sequence is a reference standard in the RefSeqGene project.
            On Sep 12, 2009 this sequence version replaced gi:148746205.
            
            Summary: Prader-Willi syndrome (PWS) is caused by the loss of
            expression of imprinted genes in chromosome 15q11-q13 region.
            Affected individuals exhibit neonatal hypotonia, developmental
            delay, and childhood-onset obesity. Necdin (NDN), a gene involved
            in the terminal differentiation of neurons, localizes to this
            region of the genome and has been implicated as one of the genes
            responsible for the etiology of PWS. This gene is structurally
            similar to NDN, is also localized to the PWS chromosomal region,
            and is paternally imprinted, suggesting a possible role for it in
            PWS. [provided by RefSeq, Oct 2010].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##RefSeq-Attributes-START##
            imprinted gene :: PMID: 10556298, 10915770
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-4298              AC124309.7         95423-99720
FEATURES             Location/Qualifiers
     source          1..4298
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q11-q12"
     gene            1..4298
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /note="MAGE-like 2"
                     /db_xref="GeneID:54551"
                     /db_xref="HGNC:6814"
                     /db_xref="MIM:605283"
     exon            1..4298
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    27..29
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /note="upstream in-frame stop codon"
     CDS             105..3854
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /note="protein nM15; necdin-like protein 1"
                     /codon_start=1
                     /product="MAGE-like protein 2"
                     /protein_id="NP_061939.3"
                     /db_xref="GI:257900508"
                     /db_xref="GeneID:54551"
                     /db_xref="HGNC:6814"
                     /db_xref="MIM:605283"
                     /translation="
MSQLSKNLGDSSPPAEAPKPPVYSRPTVLMRAPPASSRAPPVPWDPPPIDLQASLAAWQAPQPAWEAPQGQLPAPVVPMTQPPALGGPIVPAPPLGGPMGKPPTPGVLMVHPPPPGAPMAQPPTPGVLMVHPSAPGAPMAHPPPPGTPMSHPPPPGTPMAHPPPPGTPMAHPPPPGTPMVHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAQPPAPGVLMAQPLTPGVLMVQPAAPGAPMVQPPPAAMMTQPQPSGAPMAKPPGPGVLMIHPPGARAPMTQPPASGAPMAQPAAPPAQPMAPPAQPMASWAPQAQPLILQIQSQVIRAPPQVPQGPQAPPAQLATPPGWQATSPGWQATQQGWQATPLTWQTTQVTWQAPAVTWQVPPPMRQGPPPIRPGPPPIRPGPPPVRQAPPLIRQAPPVIRQAPPVIRQAPPVIRQAPAVIRQAPPVIRQAPPVIRQAPPVIRQAPPLIRQAPPPIRPAPQVLATQPPLWQALPPPPPLRQAPQARLPAPQVQAAPQVPTAPPATQVPAAPPAGPQVPQPVLPAPLSAPLSAPQAVHCPSIIWQAPKGQPPVPHEIPTSMEFQEVQQTQALAWQAQKAPTHIWQPLPAQEAQRQAPPLVQLEQPFQGAPPSQKAVQIQLPPQQAQASGPQAEVPTLPLQPSWQAPPAVLQAQPGPPVAAANFPLGSAKSLMTPSGECRASSIDRRGSSKERRTSSKERRAPSKDRMIFAATFCAPKAVSAARAHLPAAWKNLPATPETFAPSSSVFPATSQFQPASLNAFKGPSAASETPKSLPYALQDPFACVEALPAVPWVPQPNMNASKASQAVPTFLMATAAAPQATATTQEASKTSVEPPRRSGKATRKKKHLEAQEDSRGHTLAFHDWQGPRPWENLNLSDWEVQSPIQVSGDWEHPNTPRGLSGWEGPSTSRILSGWEGPSASWALSAWEGPSTSRALGLSESPGSSLPVVVSEVASVSPGSSATQDNSKVEAQPLSPLDERANALVQFLLVKDQAKVPVQRSEMVKVILREYKDECLDIINRANNKLECAFGYQLKEIDTKNHAYIIINKLGYHTGNLVASYLDRPKFGLLMVVLSLIFMKGNCVREDLIFNFLFKLGLDVRETNGLFGNTKKLITEVFVRQKYLEYRRIPYTEPAEYEFLWGPRAFLETSKMLVLRFLAKLHKKDPQSWPFHYLEALAECEWEDTDEDEPDTGDSAHGPTSRPPPR
"
     misc_feature    3183..3695
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /note="MAGE family; Region: MAGE; pfam01454"
                     /db_xref="CDD:201804"
     variation       1390
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233061"
     variation       1408
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233062"
     variation       1491
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2233063"
     variation       1508
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2233064"
     variation       1550
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233065"
     variation       2715
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2233066"
     variation       2737
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233067"
     variation       2990
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233068"
     variation       3150
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233069"
     variation       3255
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2233070"
     variation       3333
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233071"
     variation       3961
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:9785"
     variation       4103
                     /gene="MAGEL2"
                     /gene_synonym="NDNL1; nM15"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:8920"
ORIGIN      
agggagggagcctctgaacagccacgtaggcattctcttctctctggaggaaaaggcccagcagctgtccgaggaaaagacccaccagctgtcagcaaagggacatgtcgcagctaagtaagaatctgggtgactcgagtcctccggcggaggccccgaagccgcctgtctatagccgccctacggttctgatgcgggccccgcccgcttcctcccgggctccgccagtcccttgggatccacctccaattgacttgcaggcttcattggccgcttggcaggcacctcagcctgcctgggaggccccacagggccagctgcccgccccggtggttccgatgacccagcctcctgccctagggggcccgatagtcccggctcccccgctggggggcccgatgggtaagcctccgactcccggggtcctgatggtgcatcctccacctccgggagccccgatggcccagcctccgaccccgggagtcctgatggtgcatccttcagctcccggagctcccatggcccatcctcctcctccggggaccccaatgtcccaccctccccctccggggaccccaatggcccatcctcctcctccggggaccccgatggcccatcctcctcctccggggaccccgatggtgcatcctcctcctccggggaccccgatggctcatcctccccctccggggacaccgatggctcatcctccccctccggggacaccgatggctcatcctccacctccggggacaccgatggctcatcctccccctccgggtacaccgatggcccagcctccagctccgggagtcctgatggcccagcctctgactccgggagtcctgatggtccagcctgctgctccgggagcaccgatggtccagccgcctccagcagccatgatgacccagcctcagccttcaggagcaccgatggccaagcctccaggtccaggagtcctgatgattcatcctccaggtgcgagagctccgatgacccagcctccagcttcaggagcaccgatggcacagccggcggccccacctgcacagccgatggccccacctgcacagccgatggcttcttgggccccgcaggctcagcctctgatcctgcaaatccagtctcaagttataagggctcctccgcaggttccccagggcccgcaggcacccccagcgcagctagccacacccccgggctggcaggcgacctcgccaggatggcaggccacgcagcaaggctggcaggccactcccctgacttggcagaccacgcaggtcacctggcaggcaccagccgttacctggcaggtgccgccgcccatgcgccaggggcccccgcccatccgccctggcccaccacccatccgccctggcccaccaccggtgcgacaggccccaccgctgatccgccaggccccaccggtgatccgccaggccccacccgtgatccgccaggccccacccgtgatccgccaggcccccgctgtgatccgccaggccccacctgtgatccgccaggccccacctgtgatccgccaggctccacctgtgatccgccaggccccgccgctgatccgccaggcgccgccgcccatccgacctgccccacaggtcctggccacccagccaccgctctggcaggccctgccacccccacctccactgcggcaggccccgcaggctaggctgccggccccgcaggtgcaggcggcgccgcaggtgcctacggccccacctgctacgcaggtacccgcggcgccgcccgctggcccgcaggtgccccagcctgtgctgccggccccgctgtctgccccactgtctgccccgcaggctgtgcactgcccttccatcatctggcaggcccccaaaggtcagcccccggtgccacacgagattccaacgtcaatggaattccaggaggtgcagcagacacaggcgctggcctggcaggcccagaaggcccccactcacatctggcagcccctgcctgcccaggaggcccagaggcaggctccccccttggtccagctggagcagccctttcagggagccccgccctcccaaaaagccgtgcaaatccagctacccccccagcaggcccaggcatcgggtccgcaagcggaggtgcccacactgccgctccagccttcctggcaggcaccgcctgcagtcttgcaggcccagcccggacccccggtagcagcggcaaattttcccctgggctccgctaaatcattgatgactccatcaggagaatgcagggcctcttctatagaccgcaggggctcctctaaagagcgcaggacctcctcgaaggagcgcagggccccttcaaaagaccgcatgatctttgctgccaccttctgtgctcccaaggcagtgtcagctgcgcgagcacacctgccagctgcctggaaaaacctgcctgccacaccggagacctttgctccctcctcaagtgtcttcccagctacctcccagtttcagcctgcctctctgaatgcctttaaaggcccctctgctgcctcagagaccccaaagtcactgccatatgctctgcaggatccctttgcctgtgtagaggccctgcctgcagttccatgggtcccacagcccaatatgaatgcctcaaaggcatcgcaggcagtgcccaccttcctgatggctacagcagctgccccccaggcaactgccaccactcaagaggcctccaagacctccgtcgagccgccacgccgctccggcaaggccacccggaagaagaagcatctggaagcccaagaggacagccgtggccacacgctagcctttcatgactggcagggcccaaggccctgggagaatctaaatctgagtgactgggaggtccaaagccctatccaggtctcgggtgactgggagcacccaaacaccccccgtggcctgagtggttgggagggccctagcacctccaggatcctgagtggctgggaagggcccagcgcatcctgggccctgagtgcctgggagggcccgagcacctccagggccctgggtctctctgaaagcccagggagctctctgcccgtagttgtgtctgaggtcgcaagtgtctctccgggatccagtgccacccaggataattccaaggtggaggcacagcccttgtctcccttggatgagagggcaaatgcgttggtgcagttcctcttagtcaaggaccaagccaaggtgcctgtccagcgctcggagatggtgaaagtcatcctccgagagtataaagatgagtgcttagatatcatcaaccgtgccaacaataagctggagtgtgcctttggttatcaattgaaagaaattgataccaaaaaccacgcctatattatcatcaacaagctgggctaccatacagggaatttggtggcatcctatttagacaggcccaagtttggccttctgatggtggtcttgagcctcatctttatgaaaggcaactgtgtcagggaggatctgatctttaattttctgttcaagttagggttggatgtccgggagacaaacggtctctttggaaatactaagaagctcatcaccgaagtgtttgtcaggcagaagtacctagagtacaggcgaatcccttacactgagcccgcagagtatgagttcctctggggccctcgagcattcctggaaaccagcaagatgcttgtcctgaggtttttggccaagctccataagaaagatccacagagctggccattccattaccttgaagcgctcgcagagtgtgagtgggaagacacagatgaggatgaacctgacaccggtgacagtgcccacggccccaccagcaggccccctccccgctaataggtgtagcagagatctcgctcctgtgtttccctggccagaggccactgacagggtggggggacatttttgttcctggtgtttgtgttccagttccacgagtgtacgtttggattttcaacttggtttcgtatctgccaaagctttgtacattttttatgtggtgttgatttcaatcggctactgttctgttctgtattttggcatctgtgtttttaagtgagatctgtggttctctgttttgtgttttaattgttatgttttggtatcagctttgtgctggctttgtgaaatgaattgagaagctatccatctcatttctggtatagttcatgtagcattgtaatcggttgttctttgaacgttcaaatgactcatcagtaaaaactgtctacagagaagtaaatatctatatctatatatataaatatactttcagcataa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:54551 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:54551 -> Biological process: GO:0008150 [biological_process] evidence: ND
            GeneID:54551 -> Cellular component: GO:0005575 [cellular_component] evidence: ND

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.