2024-03-29 13:51:59, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_019010 1805 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens keratin 20 (KRT20), mRNA. ACCESSION NM_019010 VERSION NM_019010.2 GI:302191643 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1805) AUTHORS Tunca,B., Tezcan,G., Cecener,G., Egeli,U., Zorluoglu,A., Yilmazlar,T., Ak,S., Yerci,O., Ozturk,E., Umut,G. and Evrensel,T. TITLE Overexpression of CK20, MAP3K8 and EIF5A correlates with poor prognosis in early-onset colorectal cancer patients JOURNAL J. Cancer Res. Clin. Oncol. 139 (4), 691-702 (2013) PUBMED 23322277 REMARK GeneRIF: Overexpression of CK20 is associated with early-onset colorectal cancer. REFERENCE 2 (bases 1 to 1805) AUTHORS Liu,Y., Qian,J., Feng,J.G., Ju,H.X., Zhu,Y.P., Feng,H.Y. and Li,D.C. TITLE Detection of circulating tumor cells in peripheral blood of colorectal cancer patients without distant organ metastases JOURNAL Cell Oncol (Dordr) 36 (1), 43-53 (2013) PUBMED 23150200 REMARK GeneRIF: Data show that lower survival (OS) and disease-free survival (DFS) rates were significantly associated with guanylate cyclase C (GCC) and CK20 mRNA levels. REFERENCE 3 (bases 1 to 1805) AUTHORS Nordgard,O., Oltedal,S., Aasprong,O.G., Soreide,J.A., Soreide,K., Tjensvoll,K., Gilje,B., Heikkila,R., Guriby,M., Lothe,R.A., Smaaland,R. and Korner,H. TITLE Prognostic relevance of occult metastases detected by cytokeratin 20 and mucin 2 mRNA levels in sentinel lymph nodes from colon cancer patients JOURNAL Ann. Surg. Oncol. 19 (12), 3719-3726 (2012) PUBMED 22752373 REMARK GeneRIF: High cytokeratin 20 mrna expression is associated with lymphatic metastasis in colon cancer. REFERENCE 4 (bases 1 to 1805) AUTHORS Jiang,W., Shadrach,B., Carver,P., Goldblum,J.R., Shen,B. and Liu,X. TITLE Histomorphologic and molecular features of pouch and peripouch adenocarcinoma: a comparison with ulcerative colitis-associated adenocarcinoma JOURNAL Am. J. Surg. Pathol. 36 (9), 1385-1394 (2012) PUBMED 22895272 REMARK GeneRIF: Pouch/peripouch and UC-associated adenocarcinoma had a comparable positive rate for CK7, CK20, and CDX2 by immunohistochemistry. REFERENCE 5 (bases 1 to 1805) AUTHORS Tunca,B., Egeli,U., Cecener,G., Tezcan,G., Gokgoz,S., Tasdelen,I., Bayram,N., Tolunay,S., Umut,G., Demirdogen,E., Erturk,E., Ak,S., Cetintas,S. and Evrensel,T. TITLE CK19, CK20, EGFR and HER2 status of circulating tumor cells in patients with breast cancer JOURNAL Tumori 98 (2), 243-251 (2012) PUBMED 22677992 REMARK GeneRIF: Results suggest that CK20 mRNA with other biomarkers in the peripheral blood of breast cancer patients may be useful to monitor the presence of disseminated tumor cells in the blood circulation and to predict the prognosis of breast cancer. REFERENCE 6 (bases 1 to 1805) AUTHORS Rogers,M.A., Langbein,L., Winter,H., Ehmann,C., Praetzel,S., Korn,B. and Schweizer,J. TITLE Characterization of a cluster of human high/ultrahigh sulfur keratin-associated protein genes embedded in the type I keratin gene domain on chromosome 17q12-21 JOURNAL J. Biol. Chem. 276 (22), 19440-19451 (2001) PUBMED 11279113 REFERENCE 7 (bases 1 to 1805) AUTHORS Barrett,A.W., Cort,E.M., Patel,P. and Berkovitz,B.K. TITLE An immunohistological study of cytokeratin 20 in human and mammalian oral epithelium JOURNAL Arch. Oral Biol. 45 (10), 879-887 (2000) PUBMED 10973561 REFERENCE 8 (bases 1 to 1805) AUTHORS Moll,R., Zimbelmann,R., Goldschmidt,M.D., Keith,M., Laufer,J., Kasper,M., Koch,P.J. and Franke,W.W. TITLE The human gene encoding cytokeratin 20 and its expression during fetal development and in gastrointestinal carcinomas JOURNAL Differentiation 53 (2), 75-93 (1993) PUBMED 8359595 REFERENCE 9 (bases 1 to 1805) AUTHORS Calnek,D. and Quaroni,A. TITLE Differential localization by in situ hybridization of distinct keratin mRNA species during intestinal epithelial cell development and differentiation JOURNAL Differentiation 53 (2), 95-104 (1993) PUBMED 7689500 REFERENCE 10 (bases 1 to 1805) AUTHORS Moll,R., Schiller,D.L. and Franke,W.W. TITLE Identification of protein IT of the intestinal cytoskeleton as a novel type I cytokeratin with unusual properties and expression patterns JOURNAL J. Cell Biol. 111 (2), 567-580 (1990) PUBMED 1696264 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff in collaboration with Michael Rogers. The reference sequence was derived from DA426874.1, BC031559.1 and DB242980.1. This sequence is a reference standard in the RefSeqGene project. On Aug 5, 2010 this sequence version replaced gi:27894336. Summary: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This cytokeratin is a major cellular protein of mature enterocytes and goblet cells and is specifically expressed in the gastric and intestinal mucosa. The type I cytokeratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC031559.1, X73502.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-16 DA426874.1 1-16 17-1753 BC031559.1 1-1737 1754-1805 DB242980.1 518-569 FEATURES Location/Qualifiers source 1..1805 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="17" /map="17q21.2" gene 1..1805 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /note="keratin 20" /db_xref="GeneID:54474" /db_xref="HGNC:20412" /db_xref="HPRD:12193" /db_xref="MIM:608218" exon 1..448 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" misc_feature 26..28 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /note="upstream in-frame stop codon" CDS 59..1333 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /note="cytokeratin 20; keratin-20; protein IT; cytokeratin-20" /codon_start=1 /product="keratin, type I cytoskeletal 20" /protein_id="NP_061883.1" /db_xref="GI:27894337" /db_xref="CCDS:CCDS11379.1" /db_xref="GeneID:54474" /db_xref="HGNC:20412" /db_xref="HPRD:12193" /db_xref="MIM:608218" /translation="
MDFSRRSFHRSLSSSLQAPVVSTVGMQRLGTTPSVYGGAGGRGIRISNSRHTVNYGSDLTGGGDLFVGNEKMAMQNLNDRLASYLEKVRTLEQSNSKLEVQIKQWYETNAPRAGRDYSAYYRQIEELRSQIKDAQLQNARCVLQIDNAKLAAEDFRLKYETERGIRLTVEADLQGLNKVFDDLTLHKTDLEIQIEELNKDLALLKKEHQEEVDGLHKHLGNTVNVEVDAAPGLNLGVIMNEMRQKYEVMAQKNLQEAKEQFERQTAVLQQQVTVNTEELKGTEVQLTELRRTSQSLEIELQSHLSMKESLEHTLEETKARYSSQLANLQSLLSSLEAQLMQIRSNMERQNNEYHILLDIKTRLEQEIATYRRLLEGEDVKTTEYQLSTLEERDIKKTRKIKTVVQEVVDGKVVSSEVKEVEENI
" misc_feature 59..265 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Head" misc_feature 95..97 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine, by MAPKAPK2, MAPKAPK3 and PKC; propagated from UniProtKB/Swiss-Prot (P35900.1); phosphorylation site" misc_feature 158..160 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 263..1198 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:200948" misc_feature 266..1189 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Rod" misc_feature 266..373 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Coil 1A" misc_feature 374..427 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Linker 1" misc_feature 428..703 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Coil 1B" misc_feature 704..772 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Linker 12" misc_feature 740..745 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="Cleavage, by caspases; propagated from UniProtKB/Swiss-Prot (P35900.1); cleavage site" misc_feature 773..1189 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Coil 2" misc_feature 1190..1330 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35900.1); Region: Tail" exon 449..531 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 532..688 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 689..850 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 851..976 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 977..1197 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 1198..1235 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" exon 1236..1805 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /inference="alignment:Splign:1.39.8" STS 1286..1526 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /standard_name="RH18130" /db_xref="UniSTS:52532" STS 1390..1728 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /standard_name="D17S1996" /db_xref="UniSTS:19032" variation 1466 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /replace="c" /replace="t" /db_xref="dbSNP:1051" variation 1475 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /replace="c" /replace="t" /db_xref="dbSNP:926" variation 1551 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /replace="a" /replace="g" /db_xref="dbSNP:3169914" variation 1688 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" /replace="a" /replace="t" /db_xref="dbSNP:1051337" polyA_signal 1719..1724 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" polyA_site 1740 /gene="KRT20" /gene_synonym="CD20; CK-20; CK20; K20; KRT21" ORIGIN
gagacacactctgccccaaccatcctgaagctacaggtgctccctcctggaatctccaatggatttcagtcgcagaagcttccacagaagcctgagctcctccttgcaggcccctgtagtcagtacagtgggcatgcagcgcctcgggacgacacccagcgtttatgggggtgctggaggccggggcatccgcatctccaactccagacacacggtgaactatgggagcgatctcacaggcggcggggacctgtttgttggcaatgagaaaatggccatgcagaacctaaatgaccgtctagcgagctacctagaaaaggtgcggaccctggagcagtccaactccaaacttgaagtgcaaatcaagcagtggtacgaaaccaacgccccgagggctggtcgcgactacagtgcatattacagacaaattgaagagctgcgaagtcagattaaggatgctcaactgcaaaatgctcggtgtgtcctgcaaattgataatgctaaactggctgctgaggacttcagactgaagtatgagactgagagaggaatacgtctaacagtggaagctgatctccaaggcctgaataaggtctttgatgacctaaccctacataaaacagatttggagattcaaattgaagaactgaataaagacctagctctcctcaaaaaggagcatcaggaggaagtcgatggcctacacaagcatctgggcaacactgtcaatgtggaggttgatgctgctccaggcctgaaccttggcgtcatcatgaatgaaatgaggcagaagtatgaagtcatggcccagaagaaccttcaagaggccaaagaacagtttgagagacagactgcagttctgcagcaacaggtcacagtgaatactgaagaattaaaaggaactgaggttcaactaacggagctgagacgcacctcccagagccttgagatagaactccagtcccatctcagcatgaaagagtctttggagcacactctagaggagaccaaggcccgttacagcagccagttagccaacctccagtcgctgttgagctctctggaggcccaactgatgcagattcggagtaacatggaacgccagaacaacgaataccatatccttcttgacataaagactcgacttgaacaggaaattgctacttaccgccgccttctggaaggagaagacgtaaaaactacagaatatcagttaagcaccctggaagagagagatataaagaaaaccaggaagattaagacagtcgtgcaagaagtagtggatggcaaggtcgtgtcatctgaagtcaaagaggtggaagaaaatatctaaatagctaccagaaggagatgctgctgaggttttgaaagaaatttggctataatcttatctttgctccctgcaagaaatcagccataagaaagcactattaatactctgcagtgattagaaggggtggggtggcgggaatcctatttatcagactctgtaattgaatataaatgttttactcagaggagctgcaaattgcctgcaaaaatgaaatccagtgagcactagaatatttaaaacatcattactgccatctttatcatgaagcacatcaattacaagctgtagaccacctaatatcaatttgtaggtaatgttcctgaaaattgcaatacatttcaattatactaaacctcacaaagtagaggaatccatgtaaattgcaaataaaccactttctaattttttcctgtttctgaattgtaaaaccccctttgggagtccctggtttcttattgagccaatttctggg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:54474 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: NAS GeneID:54474 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:54474 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:54474 -> Biological process: GO:0033554 [cellular response to stress] evidence: IEA GeneID:54474 -> Biological process: GO:0045109 [intermediate filament organization] evidence: IMP GeneID:54474 -> Biological process: GO:0050708 [regulation of protein secretion] evidence: IEA GeneID:54474 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:54474 -> Cellular component: GO:0005882 [intermediate filament] evidence: NAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.