GGRNA Home | Help | Advanced search

2024-03-29 13:51:59, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_019010               1805 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens keratin 20 (KRT20), mRNA.
ACCESSION   NM_019010
VERSION     NM_019010.2  GI:302191643
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1805)
  AUTHORS   Tunca,B., Tezcan,G., Cecener,G., Egeli,U., Zorluoglu,A.,
            Yilmazlar,T., Ak,S., Yerci,O., Ozturk,E., Umut,G. and Evrensel,T.
  TITLE     Overexpression of CK20, MAP3K8 and EIF5A correlates with poor
            prognosis in early-onset colorectal cancer patients
  JOURNAL   J. Cancer Res. Clin. Oncol. 139 (4), 691-702 (2013)
   PUBMED   23322277
  REMARK    GeneRIF: Overexpression of CK20 is associated with early-onset
            colorectal cancer.
REFERENCE   2  (bases 1 to 1805)
  AUTHORS   Liu,Y., Qian,J., Feng,J.G., Ju,H.X., Zhu,Y.P., Feng,H.Y. and
            Li,D.C.
  TITLE     Detection of circulating tumor cells in peripheral blood of
            colorectal cancer patients without distant organ metastases
  JOURNAL   Cell Oncol (Dordr) 36 (1), 43-53 (2013)
   PUBMED   23150200
  REMARK    GeneRIF: Data show that lower survival (OS) and disease-free
            survival (DFS) rates were significantly associated with guanylate
            cyclase C (GCC) and CK20 mRNA levels.
REFERENCE   3  (bases 1 to 1805)
  AUTHORS   Nordgard,O., Oltedal,S., Aasprong,O.G., Soreide,J.A., Soreide,K.,
            Tjensvoll,K., Gilje,B., Heikkila,R., Guriby,M., Lothe,R.A.,
            Smaaland,R. and Korner,H.
  TITLE     Prognostic relevance of occult metastases detected by cytokeratin
            20 and mucin 2 mRNA levels in sentinel lymph nodes from colon
            cancer patients
  JOURNAL   Ann. Surg. Oncol. 19 (12), 3719-3726 (2012)
   PUBMED   22752373
  REMARK    GeneRIF: High cytokeratin 20 mrna expression is associated with
            lymphatic metastasis in colon cancer.
REFERENCE   4  (bases 1 to 1805)
  AUTHORS   Jiang,W., Shadrach,B., Carver,P., Goldblum,J.R., Shen,B. and Liu,X.
  TITLE     Histomorphologic and molecular features of pouch and peripouch
            adenocarcinoma: a comparison with ulcerative colitis-associated
            adenocarcinoma
  JOURNAL   Am. J. Surg. Pathol. 36 (9), 1385-1394 (2012)
   PUBMED   22895272
  REMARK    GeneRIF: Pouch/peripouch and UC-associated adenocarcinoma had a
            comparable positive rate for CK7, CK20, and CDX2 by
            immunohistochemistry.
REFERENCE   5  (bases 1 to 1805)
  AUTHORS   Tunca,B., Egeli,U., Cecener,G., Tezcan,G., Gokgoz,S., Tasdelen,I.,
            Bayram,N., Tolunay,S., Umut,G., Demirdogen,E., Erturk,E., Ak,S.,
            Cetintas,S. and Evrensel,T.
  TITLE     CK19, CK20, EGFR and HER2 status of circulating tumor cells in
            patients with breast cancer
  JOURNAL   Tumori 98 (2), 243-251 (2012)
   PUBMED   22677992
  REMARK    GeneRIF: Results suggest that CK20 mRNA with other biomarkers in
            the peripheral blood of breast cancer patients may be useful to
            monitor the presence of disseminated tumor cells in the blood
            circulation and to predict the prognosis of breast cancer.
REFERENCE   6  (bases 1 to 1805)
  AUTHORS   Rogers,M.A., Langbein,L., Winter,H., Ehmann,C., Praetzel,S.,
            Korn,B. and Schweizer,J.
  TITLE     Characterization of a cluster of human high/ultrahigh sulfur
            keratin-associated protein genes embedded in the type I keratin
            gene domain on chromosome 17q12-21
  JOURNAL   J. Biol. Chem. 276 (22), 19440-19451 (2001)
   PUBMED   11279113
REFERENCE   7  (bases 1 to 1805)
  AUTHORS   Barrett,A.W., Cort,E.M., Patel,P. and Berkovitz,B.K.
  TITLE     An immunohistological study of cytokeratin 20 in human and
            mammalian oral epithelium
  JOURNAL   Arch. Oral Biol. 45 (10), 879-887 (2000)
   PUBMED   10973561
REFERENCE   8  (bases 1 to 1805)
  AUTHORS   Moll,R., Zimbelmann,R., Goldschmidt,M.D., Keith,M., Laufer,J.,
            Kasper,M., Koch,P.J. and Franke,W.W.
  TITLE     The human gene encoding cytokeratin 20 and its expression during
            fetal development and in gastrointestinal carcinomas
  JOURNAL   Differentiation 53 (2), 75-93 (1993)
   PUBMED   8359595
REFERENCE   9  (bases 1 to 1805)
  AUTHORS   Calnek,D. and Quaroni,A.
  TITLE     Differential localization by in situ hybridization of distinct
            keratin mRNA species during intestinal epithelial cell development
            and differentiation
  JOURNAL   Differentiation 53 (2), 95-104 (1993)
   PUBMED   7689500
REFERENCE   10 (bases 1 to 1805)
  AUTHORS   Moll,R., Schiller,D.L. and Franke,W.W.
  TITLE     Identification of protein IT of the intestinal cytoskeleton as a
            novel type I cytokeratin with unusual properties and expression
            patterns
  JOURNAL   J. Cell Biol. 111 (2), 567-580 (1990)
   PUBMED   1696264
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff in
            collaboration with Michael Rogers. The reference sequence was
            derived from DA426874.1, BC031559.1 and DB242980.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Aug 5, 2010 this sequence version replaced gi:27894336.
            
            Summary: The protein encoded by this gene is a member of the
            keratin family. The keratins are intermediate filament proteins
            responsible for the structural integrity of epithelial cells and
            are subdivided into cytokeratins and hair keratins. The type I
            cytokeratins consist of acidic proteins which are arranged in pairs
            of heterotypic keratin chains. This cytokeratin is a major cellular
            protein of mature enterocytes and goblet cells and is specifically
            expressed in the gastric and intestinal mucosa. The type I
            cytokeratin genes are clustered in a region of chromosome
            17q12-q21. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC031559.1, X73502.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-16                DA426874.1         1-16
            17-1753             BC031559.1         1-1737
            1754-1805           DB242980.1         518-569
FEATURES             Location/Qualifiers
     source          1..1805
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q21.2"
     gene            1..1805
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /note="keratin 20"
                     /db_xref="GeneID:54474"
                     /db_xref="HGNC:20412"
                     /db_xref="HPRD:12193"
                     /db_xref="MIM:608218"
     exon            1..448
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    26..28
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /note="upstream in-frame stop codon"
     CDS             59..1333
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /note="cytokeratin 20; keratin-20; protein IT;
                     cytokeratin-20"
                     /codon_start=1
                     /product="keratin, type I cytoskeletal 20"
                     /protein_id="NP_061883.1"
                     /db_xref="GI:27894337"
                     /db_xref="CCDS:CCDS11379.1"
                     /db_xref="GeneID:54474"
                     /db_xref="HGNC:20412"
                     /db_xref="HPRD:12193"
                     /db_xref="MIM:608218"
                     /translation="
MDFSRRSFHRSLSSSLQAPVVSTVGMQRLGTTPSVYGGAGGRGIRISNSRHTVNYGSDLTGGGDLFVGNEKMAMQNLNDRLASYLEKVRTLEQSNSKLEVQIKQWYETNAPRAGRDYSAYYRQIEELRSQIKDAQLQNARCVLQIDNAKLAAEDFRLKYETERGIRLTVEADLQGLNKVFDDLTLHKTDLEIQIEELNKDLALLKKEHQEEVDGLHKHLGNTVNVEVDAAPGLNLGVIMNEMRQKYEVMAQKNLQEAKEQFERQTAVLQQQVTVNTEELKGTEVQLTELRRTSQSLEIELQSHLSMKESLEHTLEETKARYSSQLANLQSLLSSLEAQLMQIRSNMERQNNEYHILLDIKTRLEQEIATYRRLLEGEDVKTTEYQLSTLEERDIKKTRKIKTVVQEVVDGKVVSSEVKEVEENI
"
     misc_feature    59..265
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Head"
     misc_feature    95..97
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by MAPKAPK2, MAPKAPK3 and PKC;
                     propagated from UniProtKB/Swiss-Prot (P35900.1);
                     phosphorylation site"
     misc_feature    158..160
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    263..1198
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:200948"
     misc_feature    266..1189
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Rod"
     misc_feature    266..373
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Coil 1A"
     misc_feature    374..427
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Linker 1"
     misc_feature    428..703
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Coil 1B"
     misc_feature    704..772
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Linker 12"
     misc_feature    740..745
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Cleavage, by caspases; propagated from
                     UniProtKB/Swiss-Prot (P35900.1); cleavage site"
     misc_feature    773..1189
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Coil 2"
     misc_feature    1190..1330
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35900.1);
                     Region: Tail"
     exon            449..531
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            532..688
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            689..850
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            851..976
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            977..1197
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            1198..1235
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     exon            1236..1805
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /inference="alignment:Splign:1.39.8"
     STS             1286..1526
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /standard_name="RH18130"
                     /db_xref="UniSTS:52532"
     STS             1390..1728
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /standard_name="D17S1996"
                     /db_xref="UniSTS:19032"
     variation       1466
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051"
     variation       1475
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926"
     variation       1551
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3169914"
     variation       1688
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1051337"
     polyA_signal    1719..1724
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
     polyA_site      1740
                     /gene="KRT20"
                     /gene_synonym="CD20; CK-20; CK20; K20; KRT21"
ORIGIN      
gagacacactctgccccaaccatcctgaagctacaggtgctccctcctggaatctccaatggatttcagtcgcagaagcttccacagaagcctgagctcctccttgcaggcccctgtagtcagtacagtgggcatgcagcgcctcgggacgacacccagcgtttatgggggtgctggaggccggggcatccgcatctccaactccagacacacggtgaactatgggagcgatctcacaggcggcggggacctgtttgttggcaatgagaaaatggccatgcagaacctaaatgaccgtctagcgagctacctagaaaaggtgcggaccctggagcagtccaactccaaacttgaagtgcaaatcaagcagtggtacgaaaccaacgccccgagggctggtcgcgactacagtgcatattacagacaaattgaagagctgcgaagtcagattaaggatgctcaactgcaaaatgctcggtgtgtcctgcaaattgataatgctaaactggctgctgaggacttcagactgaagtatgagactgagagaggaatacgtctaacagtggaagctgatctccaaggcctgaataaggtctttgatgacctaaccctacataaaacagatttggagattcaaattgaagaactgaataaagacctagctctcctcaaaaaggagcatcaggaggaagtcgatggcctacacaagcatctgggcaacactgtcaatgtggaggttgatgctgctccaggcctgaaccttggcgtcatcatgaatgaaatgaggcagaagtatgaagtcatggcccagaagaaccttcaagaggccaaagaacagtttgagagacagactgcagttctgcagcaacaggtcacagtgaatactgaagaattaaaaggaactgaggttcaactaacggagctgagacgcacctcccagagccttgagatagaactccagtcccatctcagcatgaaagagtctttggagcacactctagaggagaccaaggcccgttacagcagccagttagccaacctccagtcgctgttgagctctctggaggcccaactgatgcagattcggagtaacatggaacgccagaacaacgaataccatatccttcttgacataaagactcgacttgaacaggaaattgctacttaccgccgccttctggaaggagaagacgtaaaaactacagaatatcagttaagcaccctggaagagagagatataaagaaaaccaggaagattaagacagtcgtgcaagaagtagtggatggcaaggtcgtgtcatctgaagtcaaagaggtggaagaaaatatctaaatagctaccagaaggagatgctgctgaggttttgaaagaaatttggctataatcttatctttgctccctgcaagaaatcagccataagaaagcactattaatactctgcagtgattagaaggggtggggtggcgggaatcctatttatcagactctgtaattgaatataaatgttttactcagaggagctgcaaattgcctgcaaaaatgaaatccagtgagcactagaatatttaaaacatcattactgccatctttatcatgaagcacatcaattacaagctgtagaccacctaatatcaatttgtaggtaatgttcctgaaaattgcaatacatttcaattatactaaacctcacaaagtagaggaatccatgtaaattgcaaataaaccactttctaattttttcctgtttctgaattgtaaaaccccctttgggagtccctggtttcttattgagccaatttctggg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:54474 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: NAS
            GeneID:54474 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:54474 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:54474 -> Biological process: GO:0033554 [cellular response to stress] evidence: IEA
            GeneID:54474 -> Biological process: GO:0045109 [intermediate filament organization] evidence: IMP
            GeneID:54474 -> Biological process: GO:0050708 [regulation of protein secretion] evidence: IEA
            GeneID:54474 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:54474 -> Cellular component: GO:0005882 [intermediate filament] evidence: NAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.