GGRNA Home | Help | Advanced search

2020-10-24 07:21:47, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018981               5921 bp    mRNA    linear   PRI 22-JUN-2013
DEFINITION  Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 10
            (DNAJC10), transcript variant 1, mRNA.
ACCESSION   NM_018981
VERSION     NM_018981.2  GI:409971395
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5921)
  AUTHORS   Velez Edwards,D.R., Naj,A.C., Monda,K., North,K.E., Neuhouser,M.,
            Magvanjav,O., Kusimo,I., Vitolins,M.Z., Manson,J.E.,
            O'Sullivan,M.J., Rampersaud,E. and Edwards,T.L.
  TITLE     Gene-environment interactions and obesity traits among
            postmenopausal African-American and Hispanic women in the Women's
            Health Initiative SHARe Study
  JOURNAL   Hum. Genet. 132 (3), 323-336 (2013)
   PUBMED   23192594
REFERENCE   2  (bases 1 to 5921)
  AUTHORS   Hagiwara,M. and Nagata,K.
  TITLE     Redox-dependent protein quality control in the endoplasmic
            reticulum: folding to degradation
  JOURNAL   Antioxid. Redox Signal. 16 (10), 1119-1128 (2012)
   PUBMED   22229892
  REMARK    Review article
REFERENCE   3  (bases 1 to 5921)
  AUTHORS   Tamura,T., Cormier,J.H. and Hebert,D.N.
  TITLE     Characterization of early EDEM1 protein maturation events and their
            functional implications
  JOURNAL   J. Biol. Chem. 286 (28), 24906-24915 (2011)
   PUBMED   21632540
REFERENCE   4  (bases 1 to 5921)
  AUTHORS   Hagiwara,M., Maegawa,K., Suzuki,M., Ushioda,R., Araki,K.,
            Matsumoto,Y., Hoseki,J., Nagata,K. and Inaba,K.
  TITLE     Structural basis of an ERAD pathway mediated by the ER-resident
            protein disulfide reductase ERdj5
  JOURNAL   Mol. Cell 41 (4), 432-444 (2011)
   PUBMED   21329881
REFERENCE   5  (bases 1 to 5921)
  AUTHORS   Ushioda,R. and Nagata,K.
  TITLE     The endoplasmic reticulum-associated degradation and disulfide
            reductase ERdj5
  JOURNAL   Meth. Enzymol. 490, 235-258 (2011)
   PUBMED   21266254
REFERENCE   6  (bases 1 to 5921)
  AUTHORS   Dong,M., Bridges,J.P., Apsley,K., Xu,Y. and Weaver,T.E.
  TITLE     ERdj4 and ERdj5 are required for endoplasmic reticulum-associated
            protein degradation of misfolded surfactant protein C
  JOURNAL   Mol. Biol. Cell 19 (6), 2620-2630 (2008)
   PUBMED   18400946
  REMARK    GeneRIF: ERdj4 and ERdj5 promote turnover of misfolded SP-C and
            this activity is dependent on their ability to stimulate BiP ATPase
            activity.
REFERENCE   7  (bases 1 to 5921)
  AUTHORS   Corazzari,M., Lovat,P.E., Armstrong,J.L., Fimia,G.M., Hill,D.S.,
            Birch-Machin,M., Redfern,C.P. and Piacentini,M.
  TITLE     Targeting homeostatic mechanisms of endoplasmic reticulum stress to
            increase susceptibility of cancer cells to fenretinide-induced
            apoptosis: the role of stress proteins ERdj5 and ERp57
  JOURNAL   Br. J. Cancer 96 (7), 1062-1071 (2007)
   PUBMED   17353921
REFERENCE   8  (bases 1 to 5921)
  AUTHORS   Gu,S.H., Chen,J.Z., Ying,K., Wang,S., Jin,W., Qian,J., Zhao,E.P.,
            Xie,Y. and Mao,Y.M.
  TITLE     Cloning and identification of a novel cDNA which encodes a putative
            protein with a DnaJ domain and a thioredoxin active motif, human
            macrothioredoxin
  JOURNAL   Biochem. Genet. 41 (7-8), 245-253 (2003)
   PUBMED   14587667
  REMARK    GeneRIF: The organization of the functional motifs of hMTHr
            suggests that the protein might be a member of a molecular
            chaperone family.
REFERENCE   9  (bases 1 to 5921)
  AUTHORS   Hosoda,A., Kimata,Y., Tsuru,A. and Kohno,K.
  TITLE     JPDI, a novel endoplasmic reticulum-resident protein containing
            both a BiP-interacting J-domain and thioredoxin-like motifs
  JOURNAL   J. Biol. Chem. 278 (4), 2669-2676 (2003)
   PUBMED   12446677
  REMARK    GeneRIF: JPDI may have roles in folding of some proteins in the ER,
            chaperoning by BiP and formation of proper disulfide bonds
REFERENCE   10 (bases 1 to 5921)
  AUTHORS   Cunnea,P.M., Miranda-Vizuete,A., Bertoli,G., Simmen,T.,
            Damdimopoulos,A.E., Hermann,S., Leinonen,S., Huikko,M.P.,
            Gustafsson,J.A., Sitia,R. and Spyrou,G.
  TITLE     ERdj5, an endoplasmic reticulum (ER)-resident protein containing
            DnaJ and thioredoxin domains, is expressed in secretory cells or
            following ER stress
  JOURNAL   J. Biol. Chem. 278 (2), 1059-1066 (2003)
   PUBMED   12411443
  REMARK    GeneRIF: ERdj5 is a ubiquitous protein localized in the ER and is
            particularly abundant in secretory cells. Its transcription is
            induced during ER stress, suggesting potential roles for ERdj5 in
            protein folding and translocation across the ER membrane.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA106532.1, AK027647.1,
            AK027696.1, AC105396.2 and AA651917.1.
            On Oct 24, 2012 this sequence version replaced gi:24308126.
            
            Summary: This gene encodes an endoplasmic reticulum co-chaperone
            which is part of the endoplasmic reticulum-associated degradation
            complex involved in recognizing and degrading misfolded proteins.
            The encoded protein reduces incorrect disulfide bonds in misfolded
            glycoproteins. Alternatively spliced transcript variants encoding
            multiple isoforms have been observed for this gene. [provided by
            RefSeq, Oct 2012].
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (1).
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK027647.1, AF038503.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-231               DA106532.1         1-231
            232-1401            AK027647.1         1-1170
            1402-2221           AK027696.1         1150-1969
            2222-4424           AK027647.1         1991-4193
            4425-5464           AC105396.2         41627-42666
            5465-5921           AA651917.1         6-462               c
FEATURES             Location/Qualifiers
     source          1..5921
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q32.1"
     gene            1..5921
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ (Hsp40) homolog, subfamily C, member 10"
                     /db_xref="GeneID:54431"
                     /db_xref="HGNC:24637"
                     /db_xref="HPRD:09722"
                     /db_xref="MIM:607987"
     exon            1..443
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       51
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28384497"
     variation       59
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369230902"
     variation       85
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372516008"
     variation       101
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138490102"
     variation       115
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111936226"
     variation       145
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74340991"
     variation       151
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113735743"
     variation       158
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112287906"
     variation       353
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143023681"
     variation       358
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377576688"
     exon            444..500
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       469
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139649379"
     variation       484
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11547938"
     exon            501..850
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       558
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186958516"
     variation       607
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371727615"
     misc_feature    620..622
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="upstream in-frame stop codon"
     variation       637
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375953838"
     CDS             647..3028
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; J-domain-containing protein disulfide
                     isomerase-like protein; ER-resident protein ERdj5; dnaJ
                     homolog subfamily C member 10; macrothioredoxin; protein
                     disulfide isomerase family A, member 19"
                     /codon_start=1
                     /product="dnaJ homolog subfamily C member 10 isoform 1
                     precursor"
                     /protein_id="NP_061854.1"
                     /db_xref="GI:24308127"
                     /db_xref="CCDS:CCDS33345.1"
                     /db_xref="GeneID:54431"
                     /db_xref="HGNC:24637"
                     /db_xref="HPRD:09722"
                     /db_xref="MIM:607987"
                     /translation="
MGVWLNKDDYIRDLKRIILCFLIVYMAILVGTDQDFYSLLGVSKTASSREIRQAFKKLALKLHPDKNPNNPNAHGDFLKINRAYEVLKDEDLRKKYDKYGEKGLEDNQGGQYESWNYYRYDFGIYDDDPEIITLERREFDAAVNSGELWFVNFYSPGCSHCHDLAPTWRDFAKEVDGLLRIGAVNCGDDRMLCRMKGVNSYPSLFIFRSGMAPVKYHGDRSKESLVSFAMQHVRSTVTELWTGNFVNSIQTAFAAGIGWLITFCSKGGDCLTSQTRLRLSGMLDGLVNVGWMDCATQDNLCKSLDITTSTTAYFPPGATLNNKEKNSILFLNSLDAKEIYLEVIHNLPDFELLSANTLEDRLAHHRWLLFFHFGKNENSNDPELKKLKTLLKNDHIQVGRFDCSSAPDICSNLYVFQPSLAVFKGQGTKEYEIHHGKKILYDILAFAKESVNSHVTTLGPQNFPANDKEPWLVDFFAPWCPPCRALLPELRRASNLLYGQLKFGTLDCTVHEGLCNMYNIQAYPTTVVFNQSNIHEYEGHHSAEQILEFIEDLMNPSVVSLTPTTFNELVTQRKHNEVWMVDFYSPWCHPCQVLMPEWKRMARTLTGLINVGSIDCQQYHSFCAQENVQRYPEIRFFPPKSNKAYHYHSYNGWNRDAYSLRIWGLGFLPQVSTDLTPQTFSEKVLQGKNHWVIDFYAPWCGPCQNFAPEFELLARMIKGKVKAGKVDCQAYAQTCQKAGIRAYPTVKFYFYERAKRNFQEEQINTRDAKAIAALISEKLETLRNQGKRNKDEL
"
     sig_peptide     647..742
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Potential; propagated from UniProtKB/Swiss-Prot
                     (Q8IXB1.2)"
     mat_peptide     743..3025
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /product="DnaJ homolog subfamily C member 10"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8IXB1.2)"
     misc_feature    746..>1027
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ-class molecular chaperone with C-terminal Zn
                     finger domain [Posttranslational modification, protein
                     turnover, chaperones]; Region: DnaJ; COG0484"
                     /db_xref="CDD:30832"
     misc_feature    749..913
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock
                     protein 40) proteins are highly conserved and play crucial
                     roles in protein translation, folding, unfolding,
                     translocation, and degradation. They act primarily by
                     stimulating the ATPase activity of Hsp70s; Region: DnaJ;
                     cd06257"
                     /db_xref="CDD:99751"
     misc_feature    order(833..841,866..868,875..880,887..892)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="HSP70 interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:99751"
     misc_feature    1031..1333
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, N-terminal ERdj5 subfamily; ERdj5,
                     also known as JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is comprised of the first TRX
                     domain of ERdj5 located after the...; Region:
                     PDI_a_ERdj5_N; cd03003"
                     /db_xref="CDD:48552"
     misc_feature    order(1118..1120,1127..1129,1304..1306)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48552"
     misc_feature    1775..2302
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="Thioredoxin-like domain; Region: Thioredoxin_6;
                     pfam13848"
                     /db_xref="CDD:206019"
     misc_feature    <1790..1987
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="Protein Disulfide Isomerase (PDIa) family, redox
                     active TRX domains; composed of eukaryotic proteins
                     involved in oxidative protein folding in the endoplasmic
                     reticulum (ER) by acting as catalysts and folding
                     assistants. Members of this family include PDI...; Region:
                     PDI_a_family; cd02961"
                     /db_xref="CDD:48510"
     misc_feature    2003..2296
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(2084..2086,2093..2095)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     misc_feature    2312..2635
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(2408..2410,2417..2419)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     misc_feature    2654..2971
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="PDIa family, C-terminal ERdj5 subfamily; ERdj5,
                     also known as  JPDI and macrothioredoxin, is a protein
                     containing an N-terminal DnaJ domain and four redox active
                     TRX domains. This subfamily is composed of the three TRX
                     domains located at the C-terminal...; Region:
                     PDI_a_ERdj5_C; cd03004"
                     /db_xref="CDD:48553"
     misc_feature    order(2744..2746,2753..2755)
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:48553"
     misc_feature    3014..3025
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8IXB1.2);
                     Region: Prevents secretion from ER (Potential)"
     variation       676
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191725153"
     variation       701
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140037014"
     variation       738
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369988252"
     variation       746
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373204672"
     variation       766
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373542036"
     variation       768
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151277356"
     variation       780
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373934752"
     exon            851..1013
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       857
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200695145"
     variation       871
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150009047"
     variation       872
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6729801"
     variation       951
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199619368"
     variation       954
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377549612"
     variation       962
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141135661"
     variation       971
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201955943"
     variation       991
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201607521"
     exon            1014..1064
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     exon            1065..1147
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1073
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375772609"
     variation       1092
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373693809"
     variation       1110
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201353295"
     variation       1112
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368656790"
     variation       1125
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78227790"
     variation       1126
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76313543"
     exon            1148..1279
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1163
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200031184"
     variation       1173
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141717303"
     variation       1177
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184116987"
     variation       1196
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141962408"
     variation       1255
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:288280"
     variation       1262
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376885680"
     variation       1268
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372451587"
     exon            1280..1373
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1289
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936889"
     variation       1295
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374998022"
     variation       1311..1312
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11460187"
     variation       1326
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61748252"
     variation       1334
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369375869"
     variation       1341
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372625469"
     variation       1352
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141906022"
     variation       1371
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191829754"
     exon            1374..1451
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1410
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372447298"
     exon            1452..1495
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1494..1495
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34783249"
     exon            1496..1633
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1497
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201346173"
     variation       1519
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374592751"
     variation       1546
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4666864"
     exon            1634..1723
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1648
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202044858"
     variation       1683
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144910042"
     variation       1685
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13414223"
     variation       1707
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201843743"
     variation       1708
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200295491"
     variation       1712
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200062649"
     exon            1724..1837
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1728
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201121755"
     variation       1736
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138024183"
     variation       1760
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77732049"
     variation       1804
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372562169"
     variation       1820
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199498703"
     exon            1838..1952
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1838
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201689661"
     variation       1864
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142705407"
     variation       1887
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11681366"
     exon            1953..2080
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       1966
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61748253"
     variation       2006
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199796017"
     variation       2016
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377272109"
     variation       2017
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376426410"
     variation       2027
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75109237"
     variation       2029
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2304603"
     variation       2043
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144717687"
     variation       2063
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370356949"
     exon            2081..2197
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2088
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376095496"
     variation       2089
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142988259"
     variation       2094
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151108303"
     variation       2097
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149656732"
     variation       2108
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190143789"
     variation       2120
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368684952"
     variation       2129
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935982"
     variation       2161
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376254344"
     variation       2172
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369183539"
     variation       2195
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61748254"
     exon            2198..2299
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2243
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369866299"
     variation       2255
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200304373"
     variation       2290
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375589522"
     exon            2300..2455
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2302
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111236031"
     variation       2306
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200740800"
     variation       2317
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189379421"
     variation       2318
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199500215"
     variation       2331
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065612"
     variation       2332
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148262147"
     variation       2337
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368012044"
     variation       2347
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150626904"
     variation       2355
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112380483"
     variation       2375
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371494397"
     variation       2380
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143144951"
     variation       2397
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376768488"
     variation       2403
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367849311"
     exon            2456..2589
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2527
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201677957"
     variation       2542
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140104007"
     variation       2543
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139539130"
     variation       2584
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:288334"
     exon            2590..2643
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2608
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187476677"
     variation       2643
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373979148"
     exon            2644..2791
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2660
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148785458"
     variation       2673
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372508150"
     variation       2712
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200891337"
     variation       2716
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140227116"
     variation       2735
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61738722"
     exon            2792..2911
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2824
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144060054"
     variation       2887
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192618"
     exon            2912..3016
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       2961
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202022153"
     variation       2981
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112232193"
     variation       2990
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199932502"
     variation       2992
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200259717"
     variation       2994
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375455316"
     exon            3017..5921
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /inference="alignment:Splign:1.39.8"
     variation       3175
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151315452"
     variation       3214
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371237109"
     variation       3280
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115063714"
     variation       3377
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141961638"
     variation       3415
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369480504"
     variation       3425
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13011976"
     variation       3440
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145736834"
     variation       3553
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188389581"
     variation       3596
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191694878"
     variation       3639
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184332767"
     variation       3726
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141262861"
     variation       3743
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114629112"
     variation       3747..3748
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369565323"
     variation       3797
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:288283"
     variation       3846
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112473306"
     variation       3886
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190160806"
     variation       3894
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182329645"
     variation       3938
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187328259"
     variation       3986
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190691010"
     variation       4043
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146950872"
     variation       4047
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13509"
     variation       4164
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:180696166"
     variation       4246
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138060233"
     STS             4271..4401
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="WI-13407"
                     /db_xref="UniSTS:1749"
     variation       4297..4298
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35638870"
     variation       4300
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113561329"
     variation       4348
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185315237"
     polyA_signal    4382..4387
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      4409
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     variation       4474
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:367839634"
     variation       4477..4478
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="gctca"
                     /db_xref="dbSNP:142218995"
     variation       4479
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113727757"
     variation       4479
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="gctca"
                     /db_xref="dbSNP:11278039"
     variation       4480
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113744659"
     variation       4483
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:111394482"
     variation       4563
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190221532"
     variation       4820
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11547935"
     variation       4831
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72898754"
     STS             4852..4974
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH104078"
                     /db_xref="UniSTS:98403"
     variation       4898
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182817109"
     variation       4914..4915
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:112963526"
     variation       4998
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186900818"
     variation       5058
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3738945"
     variation       5065
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117734438"
     variation       5074
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:288241"
     variation       5125
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191698826"
     STS             5212..5333
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH92924"
                     /db_xref="UniSTS:87599"
     variation       5213
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77789280"
     variation       5360
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:288240"
     variation       5382
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183754646"
     polyA_signal    5480..5485
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      5503
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     variation       5544
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6705867"
     variation       5612
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373525159"
     variation       5699
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188642906"
     variation       5704..5705
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:139499424"
     STS             5711..5846
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /standard_name="RH48757"
                     /db_xref="UniSTS:89848"
     variation       5723
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190929452"
     variation       5758
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144154457"
     variation       5759
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148261139"
     variation       5763
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141980780"
     variation       5775
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377450245"
     polyA_signal    5899..5904
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
     polyA_site      5921
                     /gene="DNAJC10"
                     /gene_synonym="ERdj5; JPDI; MTHr; PDIA19"
ORIGIN      
gcattggtgagggggcgcgggctgcttggccagggcagttccctcagctccgggttggagccggagccggagccggatcccgcgcacaccgccacgtcaacctaaacctacaccgccctctccaccccaccgccgcagcgcccgctgggcccgcagcgggtctccccaggcagcgtcctccacgcctttcccacaatgctccgcgccaggccccgccccggctcgccgtggagaccggcgcgtgaggaacctaccggtaccggccgcgcgctggtagtcgccggtgtggctgcacctcaccaatcccgtgcgccgcggctgggccgtcggagagtgcgtgtgcttctctcctgcacgcggtgcttgggctcggccaggcggggtccgccgccagggtttgaggatgggggagtagctacaggaagcgaccccgcgatggcaaggtatatttttgtggaatgaaaaggaagtattagaaatgagctgaagaccattcacagattaatatttttggggacagatttgtgatgcttgattcacccttgaagtaatgtagacagaagttctcaaatttgcatattacatcaactggaaccagcagtgaatcttaatgttcacttaaatcagaacttgcataagaaagagaatgggagtctggttaaataaagatgactatatcagagacttgaaaaggatcattctctgttttctgatagtgtatatggccattttagtgggcacagatcaggatttttacagtttacttggagtgtccaaaactgcaagcagtagagaaataagacaagctttcaagaaattggcattgaagttacatcctgataaaaacccgaataacccaaatgcacatggcgattttttaaaaataaatagagcatatgaagtactcaaagatgaagatctacggaaaaagtatgacaaatatggagaaaagggacttgaggataatcaaggtggccagtatgaaagctggaactattatcgttatgattttggtatttatgatgatgatcctgaaatcataacattggaaagaagagaatttgatgctgctgttaattctggagaactgtggtttgtaaatttttactccccaggctgttcacactgccatgatttagctcccacatggagagactttgctaaagaagtggatgggttacttcgaattggagctgttaactgtggtgatgatagaatgctttgccgaatgaaaggagtcaacagctatcccagcctcttcatttttcggtctggaatggccccagtgaaatatcatggagacagatcaaaggagagtttagtgagttttgcaatgcagcatgttagaagtacagtgacagaactttggacaggaaattttgtcaactccatacaaactgcttttgctgctggtattggctggctgatcactttttgttcaaaaggaggagattgtttgacttcacagacacgactcaggcttagtggcatgttggatggtcttgttaatgtaggatggatggactgtgccacccaggataacctttgtaaaagcttagatattacaacaagtactactgcttattttcctcctggagccactttaaataacaaagagaaaaacagtattttgtttctcaactcattggatgctaaagaaatatatttggaagtaatacataatcttccagattttgaactactttcggcaaacacactagaggatcgtttggctcatcatcggtggctgttattttttcattttggaaaaaatgaaaattcaaatgatcctgagctgaaaaaactaaaaactctacttaaaaatgatcatattcaagttggcaggtttgactgttcctctgcaccagacatctgtagtaatctgtatgtttttcagccgtctctagcagtatttaaaggacaaggaaccaaagaatatgaaattcatcatggaaagaagattctatatgatatacttgcctttgccaaagaaagtgtgaattctcatgttaccacgcttggacctcaaaattttcctgccaatgacaaagaaccatggcttgttgatttctttgccccctggtgtccaccatgtcgagctttactaccagagttacgaagagcatcaaatcttctttatggtcagcttaagtttggtacactagattgtacagttcatgagggactctgtaacatgtataacattcaggcttatccaacaacagtggtattcaaccagtccaacattcatgagtatgaaggacatcactctgctgaacaaatcttggagttcatagaggatcttatgaatccttcagtggtctcccttacacccaccaccttcaacgaactagttacacaaagaaaacacaacgaagtctggatggttgatttctattctccgtggtgtcatccttgccaagtcttaatgccagaatggaaaagaatggcccggacattaactggactgatcaacgtgggcagtatagattgccaacagtatcattctttttgtgcccaggaaaacgttcaaagataccctgagataagattttttcccccaaaatcaaataaagcttatcattatcacagttacaatggttggaatagggatgcttattccctgagaatctggggtctaggatttttacctcaagtatccacagatctaacacctcagactttcagtgaaaaagttctacaagggaaaaatcattgggtgattgatttctatgctccttggtgtggaccttgccagaattttgctccagaatttgagctcttggctaggatgattaaaggaaaagtgaaagctggaaaagtagactgtcaggcttatgctcagacatgccagaaagctgggatcagggcctatccaactgttaaattttatttctacgaaagagcaaagagaaattttcaagaagagcagataaataccagagatgcaaaagcaatcgctgccttaataagtgaaaaattggaaactctccgaaatcaaggcaagaggaataaggatgaactttgataatgttgaagatgaagaaaaagtttaaaagaaattctgacagatgacatcagaagacacctatttagaatgttacatttatgatgggaatgaatgaacattatcttagacttgcagttgtactgccagaattatctacagcactggtgtaaaagaagggtctgcaaactttttctgtaaagggccggtttataaatattttagactttgcaggctataatatatggttcacacatgagaacaagaatagagtcatcatgtattctttgttatttgcttttaacaacctttaaaaaatattaaaacgattcttagctcagagccatacaaaagtaggctggattcagtccatggaccatagattgctgtccccctcgacggacttataatgtttcaggtggctggcttgaacatgagtctgctgtgctatctacataaatgtctaagttgtataaagtccactttcccttcacgttttttggctgacctgaaaagaggtaacttagtttttggtcacttgttctcctaaaaatgctatccctaaccatatatttatatttcgttttaaaaacacccatgatgtggcacagtaaacaaaccctgttatgctgtattattatgaggagattcttcattgttttctttccttctcaaaggttgaaaaaatgcttttaatttttcacagccgagaaacagtgcagcagtatatgtgcacacagtaagtacacaaatttgagcaacagtaagtgcacaaattctgtagtttgccgtatcatccaggaaaacctgagggaaaaaaattatagcaattaactgggcattgtagagtatcctaaatatgttatcaagtatttagagttctatattttaaagatatatgtgttcatgtattttctgaaattgctttcatagaaattttcccactgatagttgatttttgaggcatctaatatttacatatttgccttctgaactttgttttgacctgtatcctttatttacattgggtttttctttcgtagttttggtttttcactcctgtccagtctatttattattcaaataggaaaaattactttacaggttgttttactgtagcttataatgatactgtagttattccagttactagtttactgtcagagggctgcctttttcagataaatattgacataataactgaagttatttttataagaaaatcaagtatataaatctaggaaagggatcttctagtttctgtgttgtttagactcaaagaatcacaaatttgtcagtaacatgtagttgtttagttataattcagagtgtacagaatggtaaaaattccaatcagtcaaaagaggtcaatgaattaaaaggcttgcaactttttcaaaaacctgttagaatatgctttattgtgttttgaggagttttcctttttttcttttcaatatcactttatcctgctcaccagtatttcctcataagggttattatagccataattaatgttaaaatagactttgttcttcatattctcccatctttttcgctactatatactctgtctggattctgctgtatgcctgttggcatatatggaacagtcaccacttgtcacacttaacaccagctttttgaattatgatcagtaatggcaagagcctttcattctcgaatgtttaaagcctaggagttctacaaaattggcttctttctacaagaatcccaaaatggaatgcctaaagaagtcttacttgggtaaatacttactaaaatatactggttatgtgcatatcaccacactggacactgaggagtgttcaaaaggaatctaagacatggtccccatcttccaactgtctgtaattcactgttttgtcattgagctcataaggtacttacattactacctataaatgtttcctgtacttgttagttgttgagaaacattttaggcagtaaataaaatagtaaatattatgtgtcctataatttgacctaagctgtgtgcctttggaatcagctctaagccagggccccctgggagtcatgttaagaaacacgtatcataaagtgacatacatcaaggttatcttatatagtcataacagtattattgggtctttcaaaaacagctggcagattgagcttttaatggctatattgatacagtagatagagcacctctaaggagtaccaggtataatgtgccatttctctcagcaacaccatttttgtgtgcagctgaccctctaacatggtatcaattctagctgaccaaagcacattctatcaggcagccaggcttggaaattaggtccatttaaagtatgtggcttacagtcaggtatggtggtgtgcgcctattgtcccatctacttgagaggctgaggcaggagggattgcttgggctcaggattttgaatccagcctgggcaacatagcaagaccccatctctaataaataaattatgttttgggcattaatgatgtttgtctattctgatttctcaaattttatttaggtctttcatagcttttttatttaaaggtatatgattaagataaaggaaaagtaaaatgaaatgtttatgtaattttatattctcaaaattttctttaaatttgctctgttttctgacagtgctcaaagtgggaatttttttagaagtacggttatcaaaaaaacacatttcctatgggacacacatttcaaagatgtttagtacgataaaatttttagtaaaagggtagcacttttaagtcatttgaatagaatatttgtgtaatatttagtctagtgttagtccttaaatctgccaacaaaaccagatagatgtcttaaagtaggcacatttattccattgtgactgttaagaaataataaaagattaaattaacaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:54431 -> Molecular function: GO:0001671 [ATPase activator activity] evidence: ISS
            GeneID:54431 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:54431 -> Molecular function: GO:0009055 [electron carrier activity] evidence: IEA
            GeneID:54431 -> Molecular function: GO:0015035 [protein disulfide oxidoreductase activity] evidence: IEA
            GeneID:54431 -> Molecular function: GO:0015036 [disulfide oxidoreductase activity] evidence: ISS
            GeneID:54431 -> Molecular function: GO:0051087 [chaperone binding] evidence: IDA
            GeneID:54431 -> Molecular function: GO:0051117 [ATPase binding] evidence: IPI
            GeneID:54431 -> Molecular function: GO:0051787 [misfolded protein binding] evidence: IDA
            GeneID:54431 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
            GeneID:54431 -> Biological process: GO:0006662 [glycerol ether metabolic process] evidence: IEA
            GeneID:54431 -> Biological process: GO:0030433 [ER-associated protein catabolic process] evidence: IMP
            GeneID:54431 -> Biological process: GO:0032781 [positive regulation of ATPase activity] evidence: ISS
            GeneID:54431 -> Biological process: GO:0034976 [response to endoplasmic reticulum stress] evidence: IDA
            GeneID:54431 -> Biological process: GO:0045454 [cell redox homeostasis] evidence: IEA
            GeneID:54431 -> Biological process: GO:0070059 [intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress] evidence: IDA
            GeneID:54431 -> Cellular component: GO:0005576 [extracellular region] evidence: IEA
            GeneID:54431 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
            GeneID:54431 -> Cellular component: GO:0005788 [endoplasmic reticulum lumen] evidence: IEA
            GeneID:54431 -> Cellular component: GO:0034663 [endoplasmic reticulum chaperone complex] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.