GGRNA Home | Help | Advanced search

2019-03-22 05:53:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018647               1625 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens tumor necrosis factor receptor superfamily, member 19
            (TNFRSF19), transcript variant 1, mRNA.
ACCESSION   NM_018647
VERSION     NM_018647.3  GI:325120956
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1625)
  AUTHORS   Fox,C.S., Liu,Y., White,C.C., Feitosa,M., Smith,A.V.,
            Heard-Costa,N., Lohman,K., Johnson,A.D., Foster,M.C.,
            Greenawalt,D.M., Griffin,P., Ding,J., Newman,A.B., Tylavsky,F.,
            Miljkovic,I., Kritchevsky,S.B., Launer,L., Garcia,M.,
            Eiriksdottir,G., Carr,J.J., Gudnason,V., Harris,T.B., Cupples,L.A.
            and Borecki,I.B.
  CONSRTM   GIANT Consortium; MAGIC Consortium; GLGC Consortium
  TITLE     Genome-wide association for abdominal subcutaneous and visceral
            adipose reveals a novel locus for visceral fat in women
  JOURNAL   PLoS Genet. 8 (5), E1002695 (2012)
   PUBMED   22589738
REFERENCE   2  (bases 1 to 1625)
  AUTHORS   Eriksson,N., Tung,J.Y., Kiefer,A.K., Hinds,D.A., Francke,U.,
            Mountain,J.L. and Do,C.B.
  TITLE     Novel associations for hypothyroidism include known autoimmune risk
            loci
  JOURNAL   PLoS ONE 7 (4), E34442 (2012)
   PUBMED   22493691
REFERENCE   3  (bases 1 to 1625)
  AUTHORS   Zidi,I.T., M'farrej,S.M., Bergaoui,S.D., Ghariani,N.Z.,
            Bartegi,A.B., Ben Amor,N.N. and Nouira,R.B.
  TITLE     Tumor necrosis factor-receptor 2 and TROY gene expression patterns
            in cutaneous squamous cell carcinoma in a Tunisian population
  JOURNAL   Saudi Med J 32 (11), 1202-1203 (2011)
   PUBMED   22057614
  REMARK    GeneRIF: study demonstrated that TNFR2 and TROY mRNA levels are
            enhanced in cutaneous squamous cell carcinoma cells compared to
            healthy ones in a Tunisian population
REFERENCE   4  (bases 1 to 1625)
  AUTHORS   Kong,M., Kim,Y. and Lee,C.
  TITLE     A strong synergistic epistasis between FAM134B and TNFRSF19 on the
            susceptibility to vascular dementia
  JOURNAL   Psychiatr. Genet. 21 (1), 37-41 (2011)
   PUBMED   21127458
  REMARK    GeneRIF: The FAM134B and TNFRSF19 showed a dramatically strong
            synergistic epistasis in explaining the genetic dissection of the
            susceptibility to complex vascular dementia.
REFERENCE   5  (bases 1 to 1625)
  AUTHORS   Paulino,V.M., Yang,Z., Kloss,J., Ennis,M.J., Armstrong,B.A.,
            Loftus,J.C. and Tran,N.L.
  TITLE     TROY (TNFRSF19) is overexpressed in advanced glial tumors and
            promotes glioblastoma cell invasion via Pyk2-Rac1 signaling
  JOURNAL   Mol. Cancer Res. 8 (11), 1558-1567 (2010)
   PUBMED   20881009
  REMARK    GeneRIF: TNFRSF19 overexpression in glioma cells activates Rac1
            signaling in a Pyk2-dependent manner to drive glioma cell invasion
            and migration
REFERENCE   6  (bases 1 to 1625)
  AUTHORS   Clark,H.F., Gurney,A.L., Abaya,E., Baker,K., Baldwin,D., Brush,J.,
            Chen,J., Chow,B., Chui,C., Crowley,C., Currell,B., Deuel,B.,
            Dowd,P., Eaton,D., Foster,J., Grimaldi,C., Gu,Q., Hass,P.E.,
            Heldens,S., Huang,A., Kim,H.S., Klimowski,L., Jin,Y., Johnson,S.,
            Lee,J., Lewis,L., Liao,D., Mark,M., Robbie,E., Sanchez,C.,
            Schoenfeld,J., Seshagiri,S., Simmons,L., Singh,J., Smith,V.,
            Stinson,J., Vagts,A., Vandlen,R., Watanabe,C., Wieand,D., Woods,K.,
            Xie,M.H., Yansura,D., Yi,S., Yu,G., Yuan,J., Zhang,M., Zhang,Z.,
            Goddard,A., Wood,W.I., Godowski,P. and Gray,A.
  TITLE     The secreted protein discovery initiative (SPDI), a large-scale
            effort to identify novel human secreted and transmembrane proteins:
            a bioinformatics assessment
  JOURNAL   Genome Res. 13 (10), 2265-2270 (2003)
   PUBMED   12975309
  REMARK    Erratum:[Genome Res. 2003 Dec;13(12):2759]
REFERENCE   7  (bases 1 to 1625)
  AUTHORS   Naito,A., Yoshida,H., Nishioka,E., Satoh,M., Azuma,S., Yamamoto,T.,
            Nishikawa,S. and Inoue,J.
  TITLE     TRAF6-deficient mice display hypohidrotic ectodermal dysplasia
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (13), 8766-8771 (2002)
   PUBMED   12060722
REFERENCE   8  (bases 1 to 1625)
  AUTHORS   Kojima,T., Morikawa,Y., Copeland,N.G., Gilbert,D.J., Jenkins,N.A.,
            Senba,E. and Kitamura,T.
  TITLE     TROY, a newly identified member of the tumor necrosis factor
            receptor superfamily, exhibits a homology with Edar and is
            expressed in embryonic skin and hair follicles
  JOURNAL   J. Biol. Chem. 275 (27), 20742-20747 (2000)
   PUBMED   10764796
REFERENCE   9  (bases 1 to 1625)
  AUTHORS   Eby,M.T., Jasmin,A., Kumar,A., Sharma,K. and Chaudhary,P.M.
  TITLE     TAJ, a novel member of the tumor necrosis factor receptor family,
            activates the c-Jun N-terminal kinase pathway and mediates
            caspase-independent cell death
  JOURNAL   J. Biol. Chem. 275 (20), 15336-15342 (2000)
   PUBMED   10809768
REFERENCE   10 (bases 1 to 1625)
  AUTHORS   Robertson,N.G., Khetarpal,U., Gutierrez-Espeleta,G.A., Bieber,F.R.
            and Morton,C.C.
  TITLE     Isolation of novel and known genes from a human fetal cochlear cDNA
            library using subtractive hybridization and differential screening
  JOURNAL   Genomics 23 (1), 42-50 (1994)
   PUBMED   7829101
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB223760.1, AF167555.1,
            BC047321.1 and AL161422.14.
            On Mar 3, 2011 this sequence version replaced gi:23238201.
            
            Summary: The protein encoded by this gene is a member of the
            TNF-receptor superfamily. This receptor is highly expressed during
            embryonic development. It has been shown to interact with TRAF
            family members, and to activate JNK signaling pathway when
            overexpressed in cells. This receptor is capable of inducing
            apoptosis by a caspase-independent mechanism, and it is thought to
            play an essential role in embryonic development. Alternatively
            spliced transcript variants encoding distinct isoforms have been
            described. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) is also called TRADEbeta. It
            encodes the longest isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF167555.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025086 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-494               DB223760.1         1-494
            495-800             AF167555.1         355-660
            801-1449            BC047321.1         896-1544
            1450-1625           AL161422.14        85150-85325
FEATURES             Location/Qualifiers
     source          1..1625
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q12.11-q12.3"
     gene            1..1625
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="tumor necrosis factor receptor superfamily, member
                     19"
                     /db_xref="GeneID:55504"
                     /db_xref="HGNC:11915"
                     /db_xref="HPRD:05838"
                     /db_xref="MIM:606122"
     exon            1..170
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       67..69
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:11451799"
     variation       86
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370317324"
     exon            171..273
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    184..186
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="upstream in-frame stop codon"
     CDS             205..1476
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; toxicity and JNK inducer"
                     /codon_start=1
                     /product="tumor necrosis factor receptor superfamily
                     member 19 isoform 1 precursor"
                     /protein_id="NP_061117.2"
                     /db_xref="GI:23238202"
                     /db_xref="CCDS:CCDS9302.1"
                     /db_xref="GeneID:55504"
                     /db_xref="HGNC:11915"
                     /db_xref="HPRD:05838"
                     /db_xref="MIM:606122"
                     /translation="
MALKVLLEQEKTFFTLLVLLGYLSCKVTCESGDCRQQEFRDRSGNCVPCNQCGPGMELSKECGFGYGEDAQCVTCRLHRFKEDWGFQKCKPCLDCAVVNRFQKANCSATSDAICGDCLPGFYRKTKLVGFQDMECVPCGDPPPPYEPHCASKVNLVKIASTASSPRDTALAAVICSALATVLLALLILCVIYCKRQFMEKKPSWSLRSQDIQYNGSELSCFDRPQLHEYAHRACCQCRRDSVQTCGPVRLLPSMCCEEACSPNPATLGCGVHSAASLQARNAGPAGEMVPTFFGSLTQSICGEFSDAWPLMQNPMGGDNISFCDSYPELTGEDIHSLNPELESSTSLDSNSSQDLVGGAVPVQSHSENFTAATDLSRYNNTLVESASTQDALTMRSQLDQESGAVIHPATQTSLQVRQRLGSL
"
     sig_peptide     205..291
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     292..1473
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /product="Tumor necrosis factor receptor superfamily
                     member 19"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NS68.1)"
     misc_feature    301..420
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NS68.1);
                     Region: TNFR-Cys 1"
     misc_feature    304..618
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="Tumor necrosis factor receptor (TNFR) domain;
                     superfamily of TNF-like receptor domains. When bound to
                     TNF-like cytokines, TNFRs trigger multiple signal
                     transduction pathways, they are involved in inflammation
                     response, apoptosis, autoimmunity and...; Region: TNFR;
                     cd00185"
                     /db_xref="CDD:29147"
     misc_feature    order(304..309,442..444,472..474,502..504,571..573,
                     607..609)
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="antiparallel homodimerization interface
                     [polypeptide binding]; other site"
                     /db_xref="CDD:29147"
     misc_feature    order(316..318,352..354,364..366,370..372,415..417,
                     424..426,454..456)
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="parallel homodimerization interface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:29147"
     misc_feature    order(352..381,412..426,523..531)
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:29147"
     misc_feature    424..546
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NS68.1);
                     Region: TNFR-Cys 2"
     misc_feature    order(451..456,469..477)
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="50's loop TNF binding site; other site"
                     /db_xref="CDD:29147"
     misc_feature    550..651
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NS68.1);
                     Region: TNFR-Cys 3"
     misc_feature    order(571..573,607..618)
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /note="90's loop TNF binding site; other site"
                     /db_xref="CDD:29147"
     misc_feature    715..777
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NS68.1);
                     transmembrane region"
     variation       239
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370996963"
     variation       248
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369820179"
     variation       265
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149183306"
     exon            274..384
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       289
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149976451"
     variation       290
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145209736"
     variation       291
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149214359"
     variation       292
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143949723"
     variation       295
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:9550987"
     variation       328
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141570513"
     variation       329
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200993556"
     variation       346
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181343678"
     variation       366
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376690464"
     exon            385..563
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       396
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145815290"
     variation       406
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138634567"
     variation       411
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373247986"
     variation       433
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142769629"
     variation       438
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147369656"
     variation       464
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372392866"
     variation       494
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374008761"
     variation       502
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149498209"
     variation       546
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375719826"
     exon            564..649
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       578
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373411330"
     variation       579
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145592847"
     variation       589
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144154174"
     variation       606
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199955294"
     variation       623
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371112090"
     variation       626
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373486475"
     variation       630
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148702020"
     variation       644
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368876279"
     variation       645
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143483716"
     variation       647
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200629776"
     exon            650..814
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       670
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116629724"
     variation       680
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61756242"
     variation       686
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139502219"
     variation       701
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373490793"
     variation       705
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741509"
     variation       729
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114811052"
     variation       762
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185953608"
     variation       763
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202190525"
     exon            815..940
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       823
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115048916"
     variation       824
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372905269"
     variation       825
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114789019"
     variation       827
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141048197"
     variation       828
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3751364"
     variation       847
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377622468"
     variation       860
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145810971"
     variation       861
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369538551"
     variation       863
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149014293"
     variation       892
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374264420"
     variation       902
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200301452"
     variation       911
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115547743"
     variation       917
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377726164"
     variation       935
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376817601"
     variation       936
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147110068"
     variation       939
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138676880"
     exon            941..1043
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       941
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373980471"
     variation       946
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202087628"
     variation       949
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370337019"
     variation       964
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34983774"
     variation       987
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745191"
     variation       988
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35041805"
     variation       995
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368392120"
     exon            1044..1625
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /inference="alignment:Splign:1.39.8"
     variation       1055
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201152842"
     variation       1059
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141678624"
     variation       1061
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115141233"
     variation       1073
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200602341"
     variation       1074
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368402583"
     variation       1083
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201218290"
     variation       1094
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112056395"
     variation       1097
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200218483"
     variation       1210
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367870672"
     variation       1217
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58111610"
     variation       1219
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145301348"
     variation       1238
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115520634"
     variation       1239
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141890871"
     variation       1264
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146263697"
     variation       1294
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115260428"
     variation       1298
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377014124"
     variation       1303
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146078649"
     variation       1326
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144179899"
     variation       1346
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369698575"
     variation       1373
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144227429"
     variation       1376
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373236855"
     variation       1378
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199672653"
     variation       1411
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148756021"
     variation       1413
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3751363"
     variation       1417
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3751362"
     variation       1424
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199606342"
     variation       1427
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141714394"
     variation       1459
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201826458"
     variation       1460
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145685720"
     variation       1493
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370032629"
     variation       1510
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372358582"
     variation       1515
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370467190"
     variation       1543..1544
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:11383459"
     variation       1544
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185330768"
     variation       1573
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3751361"
     variation       1610..1611
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:200628302"
     variation       1618
                     /gene="TNFRSF19"
                     /gene_synonym="TAJ; TAJ-alpha; TRADE; TROY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3751360"
ORIGIN      
gttgccgggctacgggagagcgcggagccctgcgctgggaggtgcacggtgtgcacgctggactggacccccatgcaaccccgcgccctgcgccttaaccaggactgctccgcgcgcccctgagcctcgggctccggcccggacctgcagcctcccaggtggctgggaagaactctccaacaataaatacatttgataagaaagatggctttaaaagtgctactagaacaagagaaaacgtttttcactcttttagtattactaggctatttgtcatgtaaagtgacttgtgaatcaggagactgtagacagcaagaattcagggatcggtctggaaactgtgttccctgcaaccagtgtgggccaggcatggagttgtctaaggaatgtggcttcggctatggggaggatgcacagtgtgtgacgtgccggctgcacaggttcaaggaggactggggcttccagaaatgcaagccctgtctggactgcgcagtggtgaaccgctttcagaaggcaaattgttcagccaccagtgatgccatctgcggggactgcttgccaggattttataggaagacgaaacttgtcggctttcaagacatggagtgtgtgccttgtggagaccctcctcctccttacgaaccgcactgtgccagcaaggtcaacctcgtgaagatcgcgtccacggcctccagcccacgggacacggcgctggctgccgttatctgcagcgctctggccaccgtcctgctggccctgctcatcctctgtgtcatctattgtaagagacagtttatggagaagaaacccagctggtctctgcggtcacaggacattcagtacaacggctctgagctgtcgtgttttgacagacctcagctccacgaatatgcccacagagcctgctgccagtgccgccgtgactcagtgcagacctgcgggccggtgcgcttgctcccatccatgtgctgtgaggaggcctgcagccccaacccggcgactcttggttgtggggtgcattctgcagccagtcttcaggcaagaaacgcaggcccagccggggagatggtgccgactttcttcggatccctcacgcagtccatctgtggcgagttttcagatgcctggcctctgatgcagaatcccatgggtggtgacaacatctctttttgtgactcttatcctgaactcactggagaagacattcattctctcaatccagaacttgaaagctcaacgtctttggattcaaatagcagtcaagatttggttggtggggctgttccagtccagtctcattctgaaaactttacagcagctactgatttatctagatataacaacacactggtagaatcagcatcaactcaggatgcactaactatgagaagccagctagatcaggagagtggtgctgtcatccacccagccactcagacgtccctccaggtaaggcagcgactgggttccctgtgaacacagcactgacttacagtagatcagaactctgttcccagcataagatttgggggaacctgatgagttttttttttgcatctttaataatttcttgtatgttgtagagtatgttttaaaataaatttcaagtatttttttaaaaaact
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:55504 -> Molecular function: GO:0005031 [tumor necrosis factor-activated receptor activity] evidence: NAS
            GeneID:55504 -> Biological process: GO:0001942 [hair follicle development] evidence: IEA
            GeneID:55504 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:55504 -> Biological process: GO:0006917 [induction of apoptosis] evidence: NAS
            GeneID:55504 -> Biological process: GO:0007254 [JNK cascade] evidence: NAS
            GeneID:55504 -> Biological process: GO:0033209 [tumor necrosis factor-mediated signaling pathway] evidence: NAS
            GeneID:55504 -> Biological process: GO:0043123 [positive regulation of I-kappaB kinase/NF-kappaB cascade] evidence: RCA
            GeneID:55504 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.