GGRNA Home | Help | Advanced search

2024-04-25 00:01:09, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018556               1720 bp    mRNA    linear   PRI 11-MAY-2013
DEFINITION  Homo sapiens signal-regulatory protein gamma (SIRPG), transcript
            variant 1, mRNA.
ACCESSION   NM_018556
VERSION     NM_018556.3  GI:94538334
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1720)
  AUTHORS   Barrett,J.C., Clayton,D.G., Concannon,P., Akolkar,B., Cooper,J.D.,
            Erlich,H.A., Julier,C., Morahan,G., Nerup,J., Nierras,C.,
            Plagnol,V., Pociot,F., Schuilenburg,H., Smyth,D.J., Stevens,H.,
            Todd,J.A., Walker,N.M. and Rich,S.S.
  CONSRTM   Type 1 Diabetes Genetics Consortium
  TITLE     Genome-wide association study and meta-analysis find that over 40
            loci affect risk of type 1 diabetes
  JOURNAL   Nat. Genet. 41 (6), 703-707 (2009)
   PUBMED   19430480
REFERENCE   2  (bases 1 to 1720)
  AUTHORS   Kawasaki,M., Sekigawa,I., Nozawa,K., Kaneko,H., Takasaki,Y.,
            Takamori,K. and Ogawa,H.
  TITLE     Changes in the gene expression of peripheral blood mononuclear
            cells during the menstrual cycle of females is associated with a
            gender bias in the incidence of systemic lupus erythematosus
  JOURNAL   Clin. Exp. Rheumatol. 27 (2), 260-266 (2009)
   PUBMED   19473566
  REMARK    GeneRIF: tumor necrosis factor receptor superfamily, member 14
            (TNFRSF14) and signal regulatory protein, gamma (SIRPG) appear to
            contribute to gender difference in incidence of systemic lupus
            erythematosus.
REFERENCE   3  (bases 1 to 1720)
  AUTHORS   Stefanidakis,M., Newton,G., Lee,W.Y., Parkos,C.A. and
            Luscinskas,F.W.
  TITLE     Endothelial CD47 interaction with SIRPgamma is required for human
            T-cell transendothelial migration under shear flow conditions in
            vitro
  JOURNAL   Blood 112 (4), 1280-1289 (2008)
   PUBMED   18524990
  REMARK    GeneRIF: CD47 is enriched at endothelial junctions, and its
            interaction with SIRPgamma is required for human T-cell
            transendothelial migration
REFERENCE   4  (bases 1 to 1720)
  AUTHORS   Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z.,
            Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S.,
            McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J.,
            Dunham,I., Hill,D.E. and Vidal,M.
  TITLE     hORFeome v3.1: a resource of human open reading frames representing
            over 10,000 human genes
  JOURNAL   Genomics 89 (3), 307-315 (2007)
   PUBMED   17207965
REFERENCE   5  (bases 1 to 1720)
  AUTHORS   Barclay,A.N. and Brown,M.H.
  TITLE     The SIRP family of receptors and immune regulation
  JOURNAL   Nat. Rev. Immunol. 6 (6), 457-464 (2006)
   PUBMED   16691243
  REMARK    Review article
REFERENCE   6  (bases 1 to 1720)
  AUTHORS   van den Berg,T.K., van Beek,E.M., Buhring,H.J., Colonna,M.,
            Hamaguchi,M., Howard,C.J., Kasuga,M., Liu,Y., Matozaki,T.,
            Neel,B.G., Parkos,C.A., Sano,S., Vignery,A., Vivier,E., Wright,M.,
            Zawatzky,R. and Barclay,A.N.
  TITLE     A nomenclature for signal regulatory protein family members
  JOURNAL   J. Immunol. 175 (12), 7788-7789 (2005)
   PUBMED   16339511
REFERENCE   7  (bases 1 to 1720)
  AUTHORS   Piccio,L., Vermi,W., Boles,K.S., Fuchs,A., Strader,C.A.,
            Facchetti,F., Cella,M. and Colonna,M.
  TITLE     Adhesion of human T cells to antigen-presenting cells through
            SIRPbeta2-CD47 interaction costimulates T-cell proliferation
  JOURNAL   Blood 105 (6), 2421-2427 (2005)
   PUBMED   15383453
REFERENCE   8  (bases 1 to 1720)
  AUTHORS   Brooke,G., Holbrook,J.D., Brown,M.H. and Barclay,A.N.
  TITLE     Human lymphocytes interact directly with CD47 through a novel
            member of the signal regulatory protein (SIRP) family
  JOURNAL   J. Immunol. 173 (4), 2562-2570 (2004)
   PUBMED   15294972
  REMARK    GeneRIF: a novel member of the signal regulatory protein (SIRP)
            family- with unique characteristics from both alpha and beta genes-
            termed SIRPgamma
REFERENCE   9  (bases 1 to 1720)
  AUTHORS   Ichigotani,Y., Matsuda,S., Machida,K., Oshima,K., Iwamoto,T.,
            Yamaki,K., Hayakawa,T. and Hamaguchi,M.
  TITLE     Molecular cloning of a novel human gene (SIRP-B2) which encodes a
            new member of the SIRP/SHPS-1 protein family
  JOURNAL   J. Hum. Genet. 45 (6), 378-382 (2000)
   PUBMED   11185750
REFERENCE   10 (bases 1 to 1720)
  AUTHORS   Kharitonenkov,A., Chen,Z., Sures,I., Wang,H., Schilling,J. and
            Ullrich,A.
  TITLE     A family of proteins that inhibit signalling through tyrosine
            kinase receptors
  JOURNAL   Nature 386 (6621), 181-186 (1997)
   PUBMED   9062191
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA008008.1, BC064532.1,
            AY748247.1, DB046293.1 and AA446468.1.
            On May 4, 2006 this sequence version replaced gi:18426907.
            
            Summary: The protein encoded by this gene is a member of the
            signal-regulatory protein (SIRP) family, and also belongs to the
            immunoglobulin superfamily. SIRP family members are receptor-type
            transmembrane glycoproteins known to be involved in the negative
            regulation of receptor tyrosine kinase-coupled signaling processes.
            Alternatively spliced transcript variants encoding different
            isoforms have been described. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK292745.1, BC064532.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025089 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-39                DA008008.1         4-42
            40-1159             BC064532.1         1-1120
            1160-1229           AY748247.1         762-831
            1230-1423           DB046293.1         263-456
            1424-1720           AA446468.1         1-297               c
FEATURES             Location/Qualifiers
     source          1..1720
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20p13"
     gene            1..1720
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="signal-regulatory protein gamma"
                     /db_xref="GeneID:55423"
                     /db_xref="HGNC:15757"
                     /db_xref="MIM:605466"
     exon            1..138
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    36..38
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="upstream in-frame stop codon"
     CDS             66..1229
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; signal-regulatory protein beta 2; CD172g
                     antigen; SIRP beta 2; SIRP-gamma; SIRP-beta-2;
                     signal-regulatory protein beta-2; CD172 antigen-like
                     family member B"
                     /codon_start=1
                     /product="signal-regulatory protein gamma isoform 1
                     precursor"
                     /protein_id="NP_061026.2"
                     /db_xref="GI:94538335"
                     /db_xref="CCDS:CCDS13020.2"
                     /db_xref="GeneID:55423"
                     /db_xref="HGNC:15757"
                     /db_xref="MIM:605466"
                     /translation="
MPVPASWPHPPGPFLLLTLLLGLTEVAGEEELQMIQPEKLLLVTVGKTATLHCTVTSLLPVGPVLWFRGVGPGRELIYNQKEGHFPRVTTVSDLTKRNNMDFSIRISSITPADVGTYYCVKFRKGSPENVEFKSGPGTEMALGAKPSAPVVLGPAARTTPEHTVSFTCESHGFSPRDITLKWFKNGNELSDFQTNVDPTGQSVAYSIRSTARVVLDPWDVRSQVICEVAHVTLQGDPLRGTANLSEAIRVPPTLEVTQQPMRVGNQVNVTCQVRKFYPQSLQLTWSENGNVCQRETASTLTENKDGTYNWTSWFLVNISDQRDDVVLTCQVKHDGQLAVSKRLALEVTVHQKDQSSDATPGPASSLTALLLIAVLLGPIYVPWKQKT
"
     sig_peptide     66..149
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     150..1226
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /product="signal-regulatory protein gamma isoform 1"
     misc_feature    162..482
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="Immunoglobulin V-set domain; Region: V-set;
                     pfam07686"
                     /db_xref="CDD:203725"
     misc_feature    186..479
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="Immunoglobulin variable domain (IgV); Region: IgV;
                     cd00099"
                     /db_xref="CDD:143167"
     misc_feature    order(228..230,249..251)
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="L1 hypervariable region; other site"
                     /db_xref="CDD:143167"
     misc_feature    order(249..254,258..260,429..431)
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="antigen binding site; other site"
                     /db_xref="CDD:143167"
     misc_feature    order(252..254,258..260,264..266,270..272,285..287,
                     291..293,411..413,417..419,423..425,459..461,468..473)
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="heterodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:143167"
     misc_feature    366..368
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="L2 hypervariable region; other site"
                     /db_xref="CDD:143167"
     misc_feature    order(429..431,456..458)
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="L3 hypervariable region; other site"
                     /db_xref="CDD:143167"
     misc_feature    495..821
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    855..1070
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="Immunoglobulin Constant domain; Region: IgC;
                     cd00098"
                     /db_xref="CDD:143166"
     misc_feature    order(867..869,873..875,879..881,885..887,987..998,
                     1002..1004,1008..1013)
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143166"
     misc_feature    1146..1214
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P1W8.3);
                     transmembrane region"
     exon            139..495
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     exon            496..813
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     exon            814..1146
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     exon            1147..1231
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     variation       1168
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35062363"
     variation       1181
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:34442420"
     exon            1232..1716
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /inference="alignment:Splign:1.39.8"
     STS             1352..1495
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /standard_name="SHGC-56794"
                     /db_xref="UniSTS:53846"
     STS             1391..1547
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /standard_name="RH94120"
                     /db_xref="UniSTS:87507"
     variation       1452
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048055"
     polyA_signal    1697..1703
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
     polyA_site      1716
                     /gene="SIRPG"
                     /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2;
                     SIRPgamma"
ORIGIN      
agagcagggcctgacatctccccagaacagacgtttgaacagagcaggcttctgaggtctccaaaatgcctgtcccagcctcctggccccatcctcctggtcctttcctgcttctgactctactgctgggacttacagaagtggcaggtgaggaggagctacagatgattcagcctgagaagctcctgttggtcacagttggaaagacagccactctgcactgcactgtgacctccctgcttcccgtgggacccgtcctgtggttcagaggagttggaccaggccgggaattaatctacaatcaaaaagaaggccacttccccagggtaacaacagtttcagacctcacaaagagaaacaacatggacttttccatccgcatcagtagcatcaccccagcagatgtcggcacatactactgtgtgaagtttcgaaaagggagccctgagaacgtggagtttaagtctggaccaggcactgagatggctttgggtgccaaaccctctgcccccgtggtattgggccctgcggcgaggaccacacctgagcatacagtgagtttcacctgtgagtcccatggcttctctcccagagacatcaccctgaaatggttcaaaaatgggaatgagctctcagacttccagaccaacgtggaccccacaggacagagtgtggcctacagcatccgcagcacagccagggtggtactggacccctgggacgttcgctctcaggtcatctgcgaggtggcccatgtcaccttgcagggggaccctcttcgtgggactgccaacttgtctgaggccatccgagttccacccaccttggaggttactcaacagcccatgagggtggggaaccaggtaaacgtcacctgccaggtgaggaagttctacccccagagcctacagctgacctggtcggagaatggaaacgtgtgccagagagaaacagcctcgacccttacagagaacaaggatggtacctacaactggacaagctggttcctggtgaacatatctgaccaaagggatgatgtggtcctcacctgccaggtgaagcatgatgggcagctggcggtcagcaaacgccttgccctagaggtcacagtccaccagaaggaccagagctcagatgctacccctggcccggcatcatcccttactgcgctgctcctcatagctgtcctcctgggccccatctacgtcccctggaagcagaagacctgactctccttccttcctcccctgccacgtgggaccctcatctctgctgcctccttcctttcctgagaggctcagcttgagagaatgagccagtgagaagcttctctagacttggctccaaacatctcccctcccaagacatctgcctgcccacaggctcctgttgctccttcacacagacctggatgccccagagcaaggtcttcattcatggtcctgagcaggtgccatgggattgggctctgggcactgacttaacggcacctccctagaaggcgagaaacatgccaaatctaaacacaccaggactcccatccatcgccttgagactgaccgtaaaccacagacgctctccaggttctcaagagttatcctgccttccagattcctgcctatcccaactccccagccttgttgaggttctctattgcctcttgaatacaaatgcactcccaaagtggttttaagaaaataaaaagattatccttccaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:55423 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:55423 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
            GeneID:55423 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
            GeneID:55423 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:55423 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IDA
            GeneID:55423 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS
            GeneID:55423 -> Biological process: GO:0022409 [positive regulation of cell-cell adhesion] evidence: IDA
            GeneID:55423 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: TAS
            GeneID:55423 -> Biological process: GO:0050870 [positive regulation of T cell activation] evidence: IDA
            GeneID:55423 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
            GeneID:55423 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:55423 -> Cellular component: GO:0016020 [membrane] evidence: IDA
            GeneID:55423 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.