2024-04-25 00:01:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018556 1720 bp mRNA linear PRI 11-MAY-2013 DEFINITION Homo sapiens signal-regulatory protein gamma (SIRPG), transcript variant 1, mRNA. ACCESSION NM_018556 VERSION NM_018556.3 GI:94538334 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1720) AUTHORS Barrett,J.C., Clayton,D.G., Concannon,P., Akolkar,B., Cooper,J.D., Erlich,H.A., Julier,C., Morahan,G., Nerup,J., Nierras,C., Plagnol,V., Pociot,F., Schuilenburg,H., Smyth,D.J., Stevens,H., Todd,J.A., Walker,N.M. and Rich,S.S. CONSRTM Type 1 Diabetes Genetics Consortium TITLE Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes JOURNAL Nat. Genet. 41 (6), 703-707 (2009) PUBMED 19430480 REFERENCE 2 (bases 1 to 1720) AUTHORS Kawasaki,M., Sekigawa,I., Nozawa,K., Kaneko,H., Takasaki,Y., Takamori,K. and Ogawa,H. TITLE Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus JOURNAL Clin. Exp. Rheumatol. 27 (2), 260-266 (2009) PUBMED 19473566 REMARK GeneRIF: tumor necrosis factor receptor superfamily, member 14 (TNFRSF14) and signal regulatory protein, gamma (SIRPG) appear to contribute to gender difference in incidence of systemic lupus erythematosus. REFERENCE 3 (bases 1 to 1720) AUTHORS Stefanidakis,M., Newton,G., Lee,W.Y., Parkos,C.A. and Luscinskas,F.W. TITLE Endothelial CD47 interaction with SIRPgamma is required for human T-cell transendothelial migration under shear flow conditions in vitro JOURNAL Blood 112 (4), 1280-1289 (2008) PUBMED 18524990 REMARK GeneRIF: CD47 is enriched at endothelial junctions, and its interaction with SIRPgamma is required for human T-cell transendothelial migration REFERENCE 4 (bases 1 to 1720) AUTHORS Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z., Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S., McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J., Dunham,I., Hill,D.E. and Vidal,M. TITLE hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes JOURNAL Genomics 89 (3), 307-315 (2007) PUBMED 17207965 REFERENCE 5 (bases 1 to 1720) AUTHORS Barclay,A.N. and Brown,M.H. TITLE The SIRP family of receptors and immune regulation JOURNAL Nat. Rev. Immunol. 6 (6), 457-464 (2006) PUBMED 16691243 REMARK Review article REFERENCE 6 (bases 1 to 1720) AUTHORS van den Berg,T.K., van Beek,E.M., Buhring,H.J., Colonna,M., Hamaguchi,M., Howard,C.J., Kasuga,M., Liu,Y., Matozaki,T., Neel,B.G., Parkos,C.A., Sano,S., Vignery,A., Vivier,E., Wright,M., Zawatzky,R. and Barclay,A.N. TITLE A nomenclature for signal regulatory protein family members JOURNAL J. Immunol. 175 (12), 7788-7789 (2005) PUBMED 16339511 REFERENCE 7 (bases 1 to 1720) AUTHORS Piccio,L., Vermi,W., Boles,K.S., Fuchs,A., Strader,C.A., Facchetti,F., Cella,M. and Colonna,M. TITLE Adhesion of human T cells to antigen-presenting cells through SIRPbeta2-CD47 interaction costimulates T-cell proliferation JOURNAL Blood 105 (6), 2421-2427 (2005) PUBMED 15383453 REFERENCE 8 (bases 1 to 1720) AUTHORS Brooke,G., Holbrook,J.D., Brown,M.H. and Barclay,A.N. TITLE Human lymphocytes interact directly with CD47 through a novel member of the signal regulatory protein (SIRP) family JOURNAL J. Immunol. 173 (4), 2562-2570 (2004) PUBMED 15294972 REMARK GeneRIF: a novel member of the signal regulatory protein (SIRP) family- with unique characteristics from both alpha and beta genes- termed SIRPgamma REFERENCE 9 (bases 1 to 1720) AUTHORS Ichigotani,Y., Matsuda,S., Machida,K., Oshima,K., Iwamoto,T., Yamaki,K., Hayakawa,T. and Hamaguchi,M. TITLE Molecular cloning of a novel human gene (SIRP-B2) which encodes a new member of the SIRP/SHPS-1 protein family JOURNAL J. Hum. Genet. 45 (6), 378-382 (2000) PUBMED 11185750 REFERENCE 10 (bases 1 to 1720) AUTHORS Kharitonenkov,A., Chen,Z., Sures,I., Wang,H., Schilling,J. and Ullrich,A. TITLE A family of proteins that inhibit signalling through tyrosine kinase receptors JOURNAL Nature 386 (6621), 181-186 (1997) PUBMED 9062191 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA008008.1, BC064532.1, AY748247.1, DB046293.1 and AA446468.1. On May 4, 2006 this sequence version replaced gi:18426907. Summary: The protein encoded by this gene is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). ##Evidence-Data-START## Transcript exon combination :: AK292745.1, BC064532.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025089 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-39 DA008008.1 4-42 40-1159 BC064532.1 1-1120 1160-1229 AY748247.1 762-831 1230-1423 DB046293.1 263-456 1424-1720 AA446468.1 1-297 c FEATURES Location/Qualifiers source 1..1720 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="20" /map="20p13" gene 1..1720 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="signal-regulatory protein gamma" /db_xref="GeneID:55423" /db_xref="HGNC:15757" /db_xref="MIM:605466" exon 1..138 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" misc_feature 36..38 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="upstream in-frame stop codon" CDS 66..1229 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="isoform 1 precursor is encoded by transcript variant 1; signal-regulatory protein beta 2; CD172g antigen; SIRP beta 2; SIRP-gamma; SIRP-beta-2; signal-regulatory protein beta-2; CD172 antigen-like family member B" /codon_start=1 /product="signal-regulatory protein gamma isoform 1 precursor" /protein_id="NP_061026.2" /db_xref="GI:94538335" /db_xref="CCDS:CCDS13020.2" /db_xref="GeneID:55423" /db_xref="HGNC:15757" /db_xref="MIM:605466" /translation="
MPVPASWPHPPGPFLLLTLLLGLTEVAGEEELQMIQPEKLLLVTVGKTATLHCTVTSLLPVGPVLWFRGVGPGRELIYNQKEGHFPRVTTVSDLTKRNNMDFSIRISSITPADVGTYYCVKFRKGSPENVEFKSGPGTEMALGAKPSAPVVLGPAARTTPEHTVSFTCESHGFSPRDITLKWFKNGNELSDFQTNVDPTGQSVAYSIRSTARVVLDPWDVRSQVICEVAHVTLQGDPLRGTANLSEAIRVPPTLEVTQQPMRVGNQVNVTCQVRKFYPQSLQLTWSENGNVCQRETASTLTENKDGTYNWTSWFLVNISDQRDDVVLTCQVKHDGQLAVSKRLALEVTVHQKDQSSDATPGPASSLTALLLIAVLLGPIYVPWKQKT
" sig_peptide 66..149 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 150..1226 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /product="signal-regulatory protein gamma isoform 1" misc_feature 162..482 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="Immunoglobulin V-set domain; Region: V-set; pfam07686" /db_xref="CDD:203725" misc_feature 186..479 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="Immunoglobulin variable domain (IgV); Region: IgV; cd00099" /db_xref="CDD:143167" misc_feature order(228..230,249..251) /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="L1 hypervariable region; other site" /db_xref="CDD:143167" misc_feature order(249..254,258..260,429..431) /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="antigen binding site; other site" /db_xref="CDD:143167" misc_feature order(252..254,258..260,264..266,270..272,285..287, 291..293,411..413,417..419,423..425,459..461,468..473) /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="heterodimer interface [polypeptide binding]; other site" /db_xref="CDD:143167" misc_feature 366..368 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="L2 hypervariable region; other site" /db_xref="CDD:143167" misc_feature order(429..431,456..458) /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="L3 hypervariable region; other site" /db_xref="CDD:143167" misc_feature 495..821 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" misc_feature 855..1070 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="Immunoglobulin Constant domain; Region: IgC; cd00098" /db_xref="CDD:143166" misc_feature order(867..869,873..875,879..881,885..887,987..998, 1002..1004,1008..1013) /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:143166" misc_feature 1146..1214 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9P1W8.3); transmembrane region" exon 139..495 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" exon 496..813 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" exon 814..1146 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" exon 1147..1231 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" variation 1168 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /replace="c" /replace="t" /db_xref="dbSNP:35062363" variation 1181 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /replace="a" /replace="t" /db_xref="dbSNP:34442420" exon 1232..1716 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /inference="alignment:Splign:1.39.8" STS 1352..1495 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /standard_name="SHGC-56794" /db_xref="UniSTS:53846" STS 1391..1547 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /standard_name="RH94120" /db_xref="UniSTS:87507" variation 1452 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" /replace="g" /replace="t" /db_xref="dbSNP:1048055" polyA_signal 1697..1703 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" polyA_site 1716 /gene="SIRPG" /gene_synonym="bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma" ORIGIN
agagcagggcctgacatctccccagaacagacgtttgaacagagcaggcttctgaggtctccaaaatgcctgtcccagcctcctggccccatcctcctggtcctttcctgcttctgactctactgctgggacttacagaagtggcaggtgaggaggagctacagatgattcagcctgagaagctcctgttggtcacagttggaaagacagccactctgcactgcactgtgacctccctgcttcccgtgggacccgtcctgtggttcagaggagttggaccaggccgggaattaatctacaatcaaaaagaaggccacttccccagggtaacaacagtttcagacctcacaaagagaaacaacatggacttttccatccgcatcagtagcatcaccccagcagatgtcggcacatactactgtgtgaagtttcgaaaagggagccctgagaacgtggagtttaagtctggaccaggcactgagatggctttgggtgccaaaccctctgcccccgtggtattgggccctgcggcgaggaccacacctgagcatacagtgagtttcacctgtgagtcccatggcttctctcccagagacatcaccctgaaatggttcaaaaatgggaatgagctctcagacttccagaccaacgtggaccccacaggacagagtgtggcctacagcatccgcagcacagccagggtggtactggacccctgggacgttcgctctcaggtcatctgcgaggtggcccatgtcaccttgcagggggaccctcttcgtgggactgccaacttgtctgaggccatccgagttccacccaccttggaggttactcaacagcccatgagggtggggaaccaggtaaacgtcacctgccaggtgaggaagttctacccccagagcctacagctgacctggtcggagaatggaaacgtgtgccagagagaaacagcctcgacccttacagagaacaaggatggtacctacaactggacaagctggttcctggtgaacatatctgaccaaagggatgatgtggtcctcacctgccaggtgaagcatgatgggcagctggcggtcagcaaacgccttgccctagaggtcacagtccaccagaaggaccagagctcagatgctacccctggcccggcatcatcccttactgcgctgctcctcatagctgtcctcctgggccccatctacgtcccctggaagcagaagacctgactctccttccttcctcccctgccacgtgggaccctcatctctgctgcctccttcctttcctgagaggctcagcttgagagaatgagccagtgagaagcttctctagacttggctccaaacatctcccctcccaagacatctgcctgcccacaggctcctgttgctccttcacacagacctggatgccccagagcaaggtcttcattcatggtcctgagcaggtgccatgggattgggctctgggcactgacttaacggcacctccctagaaggcgagaaacatgccaaatctaaacacaccaggactcccatccatcgccttgagactgaccgtaaaccacagacgctctccaggttctcaagagttatcctgccttccagattcctgcctatcccaactccccagccttgttgaggttctctattgcctcttgaatacaaatgcactcccaaagtggttttaagaaaataaaaagattatccttccaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:55423 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:55423 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA GeneID:55423 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:55423 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS GeneID:55423 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IDA GeneID:55423 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS GeneID:55423 -> Biological process: GO:0022409 [positive regulation of cell-cell adhesion] evidence: IDA GeneID:55423 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: TAS GeneID:55423 -> Biological process: GO:0050870 [positive regulation of T cell activation] evidence: IDA GeneID:55423 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS GeneID:55423 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:55423 -> Cellular component: GO:0016020 [membrane] evidence: IDA GeneID:55423 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.