Home |
Help |
Advanced search
2024-04-27 12:19:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018237 3858 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens cell division cycle and apoptosis regulator 1 (CCAR1),
mRNA.
ACCESSION NM_018237
VERSION NM_018237.2 GI:46852387
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3858)
AUTHORS Lu,C.K., Lai,Y.C., Lin,Y.F., Chen,H.R. and Chiang,M.K.
TITLE CCAR1 is required for Ngn3-mediated endocrine differentiation
JOURNAL Biochem. Biophys. Res. Commun. 418 (2), 307-312 (2012)
PUBMED 22266316
REMARK GeneRIF: CCAR1 is a novel partner of Ngn3 in mediating endocrine
differentiation.
REFERENCE 2 (bases 1 to 3858)
AUTHORS Francois,S., D'Orlando,C., Fatone,T., Touvier,T., Pessina,P.,
Meneveri,R. and Brunelli,S.
TITLE Necdin enhances myoblasts survival by facilitating the degradation
of the mediator of apoptosis CCAR1/CARP1
JOURNAL PLoS ONE 7 (8), E43335 (2012)
PUBMED 22905258
REMARK GeneRIF: necdin exerts its pro-survival activity by counteracting
the action of the pro-apoptotic protein Cell Cycle Apoptosis
Regulatory Protein (CCAR1/CARP1)
REFERENCE 3 (bases 1 to 3858)
AUTHORS Puliyappadamba,V.T., Wu,W., Bevis,D., Zhang,L., Polin,L.,
Kilkuskie,R., Finley,R.L. Jr., Larsen,S.D., Levi,E., Miller,F.R.,
Wali,A. and Rishi,A.K.
TITLE Antagonists of anaphase-promoting complex (APC)-2-cell cycle and
apoptosis regulatory protein (CARP)-1 interaction are novel
regulators of cell growth and apoptosis
JOURNAL J. Biol. Chem. 286 (44), 38000-38017 (2011)
PUBMED 21903591
REMARK GeneRIF: anaphase-promoting complex (APC)-2-cell cycle and
apoptosis regulatory protein (CARP)-1 interaction antagonists are
novel regulators of cell growth and apoptosis
REFERENCE 4 (bases 1 to 3858)
AUTHORS Ou,C.Y., Kim,J.H., Yang,C.K. and Stallcup,M.R.
TITLE Requirement of cell cycle and apoptosis regulator 1 for target gene
activation by Wnt and beta-catenin and for anchorage-independent
growth of human colon carcinoma cells
JOURNAL J. Biol. Chem. 284 (31), 20629-20637 (2009)
PUBMED 19520846
REMARK GeneRIF: CCAR1 is a novel component of Wnt/beta-catenin signaling
that plays an important role in transcriptional regulation by
beta-catenin.
REFERENCE 5 (bases 1 to 3858)
AUTHORS Kolobova,E., Efimov,A., Kaverina,I., Rishi,A.K., Schrader,J.W.,
Ham,A.J., Larocca,M.C. and Goldenring,J.R.
TITLE Microtubule-dependent association of AKAP350A and CCAR1 with RNA
stress granules
JOURNAL Exp. Cell Res. 315 (3), 542-555 (2009)
PUBMED 19073175
REMARK GeneRIF: These results provide the first evidence for the
microtubule dependent association of AKAP350A and CCAR1 with RNA
stress granules.
REFERENCE 6 (bases 1 to 3858)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
REFERENCE 7 (bases 1 to 3858)
AUTHORS McDonald,E.R. III and El-Deiry,W.S.
TITLE Suppression of caspase-8- and -10-associated RING proteins results
in sensitization to death ligands and inhibition of tumor cell
growth
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 101 (16), 6170-6175 (2004)
PUBMED 15069192
REFERENCE 8 (bases 1 to 3858)
AUTHORS Bouwmeester,T., Bauch,A., Ruffner,H., Angrand,P.O., Bergamini,G.,
Croughton,K., Cruciat,C., Eberhard,D., Gagneur,J., Ghidelli,S.,
Hopf,C., Huhse,B., Mangano,R., Michon,A.M., Schirle,M., Schlegl,J.,
Schwab,M., Stein,M.A., Bauer,A., Casari,G., Drewes,G., Gavin,A.C.,
Jackson,D.B., Joberty,G., Neubauer,G., Rick,J., Kuster,B. and
Superti-Furga,G.
TITLE A physical and functional map of the human TNF-alpha/NF-kappa B
signal transduction pathway
JOURNAL Nat. Cell Biol. 6 (2), 97-105 (2004)
PUBMED 14743216
REMARK Erratum:[Nat Cell Biol. 2004 May;6(5):465]
REFERENCE 9 (bases 1 to 3858)
AUTHORS Rishi,A.K., Zhang,L., Boyanapalli,M., Wali,A., Mohammad,R.M.,
Yu,Y., Fontana,J.A., Hatfield,J.S., Dawson,M.I., Majumdar,A.P. and
Reichert,U.
TITLE Identification and characterization of a cell cycle and apoptosis
regulatory protein-1 as a novel mediator of apoptosis signaling by
retinoid CD437
JOURNAL J. Biol. Chem. 278 (35), 33422-33435 (2003)
PUBMED 12816952
REMARK GeneRIF: cell cycle and apoptosis regulatory protein-1 is a novel
mediator of apoptosis signaling by retinoid CD437
REFERENCE 10 (bases 1 to 3858)
AUTHORS Zhou,Z., Licklider,L.J., Gygi,S.P. and Reed,R.
TITLE Comprehensive proteomic analysis of the human spliceosome
JOURNAL Nature 419 (6903), 182-185 (2002)
PUBMED 12226669
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK023438.1, BM786237.1, AY249140.1, BM905703.1, CB136079.1 and
BU181074.1.
On Apr 29, 2004 this sequence version replaced gi:29789087.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF465616.1, AY249140.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-598 AK023438.1 1-598
599-637 BM786237.1 582-620
638-2676 AY249140.1 616-2654
2677-3226 BM905703.1 124-673
3227-3591 CB136079.1 271-635
3592-3858 BU181074.1 322-588
FEATURES Location/Qualifiers
source 1..3858
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q21.3"
gene 1..3858
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="cell division cycle and apoptosis regulator 1"
/db_xref="GeneID:55749"
/db_xref="HGNC:24236"
/db_xref="HPRD:10811"
/db_xref="MIM:612569"
exon 1..69
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 29
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372480296"
misc_feature 51..53
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="upstream in-frame stop codon"
variation 53
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:190904870"
exon 70..192
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 85
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:375321669"
variation 89
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371263749"
variation 96
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113255973"
variation 116
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369109457"
CDS 120..3572
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="death inducer with SAP domain; cell cycle and
apoptosis regulatory protein 1"
/codon_start=1
/product="cell division cycle and apoptosis regulator
protein 1"
/protein_id="NP_060707.2"
/db_xref="GI:46852388"
/db_xref="CCDS:CCDS7282.1"
/db_xref="GeneID:55749"
/db_xref="HGNC:24236"
/db_xref="HPRD:10811"
/db_xref="MIM:612569"
/translation="
MAQFGGQKNPPWATQFTATAVSQPAALGVQQPSLLGASPTIYTQQTALAAAGLTTQTPANYQLTQTAALQQQAAAAAAALQQQYSQPQQALYSVQQQLQQPQQTLLTQPAVALPTSLSLSTPQPTAQITVSYPTPRSSQQQTQPQKQRVFTGVVTKLHDTFGFVDEDVFFQLSAVKGKTPQVGDRVLVEATYNPNMPFKWNAQRIQTLPNQNQSQTQPLLKTPPAVLQPIAPQTTFGVQTQPQPQSLLQAQISAASITPLLQTQPQPLLQQPQQKAGLLQPPVRIVSQPQPARRLDPPSRFSGRNDRGDQVPNRKDDRSRERERERRRSRERSPQRKRSRERSPRRERERSPRRVRRVVPRYTVQFSKFSLDCPSCDMMELRRRYQNLYIPSDFFDAQFTWVDAFPLSRPFQLGNYCNFYVMHREVESLEKNMAILDPPDADHLYSAKVMLMASPSMEDLYHKSCALAEDPQELRDGFQHPARLVKFLVGMKGKDEAMAIGGHWSPSLDGPDPEKDPSVLIKTAIRCCKALTGIDLSVCTQWYRFAEIRYHRPEETHKGRTVPAHVETVVLFFPDVWHCLPTRSEWETLSRGYKQQLVEKLQGERKEADGEQDEEEKDDGEAKEISTPTHWSKLDPKTMKVNDLRKELESRALSSKGLKSQLIARLTKQLKVEEQKEEQKELEKSEKEEDEDDDRKSEDDKEEEERKRQEEIERQRRERRYILPDEPAIIVHPNWAAKSGKFDCSIMSLSVLLDYRLEDNKEHSFEVSLFAELFNEMLQRDFGVRIYKSLLSLPEKEDKKEKDKKSKKDERKDKKEERDDETDEPKPKRRKSGDDKDKKEDRDERKKEDKRKDDSKDDDETEEDNNQDEYDPMEAEEAEDEEDDRDEEEMTKRDDKRDINRYCKERPSKDKEKEKTQMITINRDLLMAFVYFDQSHCGYLLEKDLEEILYTLGLHLSRAQVKKLLNKVVLRESCFYRKLTDTSKDEENHEESESLQEDMLGNRLLLPTPTVKQESKDVEENVGLIVYNGAMVDVGSLLQKLEKSEKVRAEVEQKLQLLEEKTDEDEKTILNLENSNKSLSGELREVKKDLSQLQENLKISENMNLQFENQMNKTIRNLSTVMDEIHTVLKKDNVKNEDKDQKSKENGASV
"
misc_feature 564..731
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="S1-like; Region: S1-like; pfam14444"
/db_xref="CDD:206610"
misc_feature 759..761
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1551..1928
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="DBC1; Region: DBC1; pfam14443"
/db_xref="CDD:206609"
misc_feature 2028..2120
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/note="SAP domain; Region: SAP; pfam02037"
/db_xref="CDD:202100"
misc_feature 2172..2174
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q8IX12.2); phosphorylation site"
misc_feature 2208..2210
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q8IX12.2); phosphorylation site"
misc_feature 2700..2702
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q8IX12.2); phosphorylation site"
misc_feature 3564..3566
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
variation 149
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373345073"
variation 157
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:61256329"
exon 193..365
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 209
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:75794590"
variation 228
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182939954"
variation 267
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139946431"
variation 333
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:79020072"
variation 338
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376968846"
variation 339
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace=""
/replace="g"
/db_xref="dbSNP:34601178"
variation 345
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141356962"
exon 366..410
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 368
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370283803"
exon 411..443
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 431
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370670271"
variation 440
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:374302557"
exon 444..637
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 503
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:200363269"
variation 520
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:139158551"
variation 528
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371513606"
variation 576
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149791976"
variation 590
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144648961"
variation 599
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1300253"
variation 632
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139860659"
exon 638..752
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 654
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369204748"
variation 691
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:374007238"
variation 695
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:5030885"
exon 753..945
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 807
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199831400"
variation 853
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:145396018"
variation 884
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:373840226"
variation 920
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:35776267"
exon 946..1075
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 980..981
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace=""
/replace="cccccc"
/db_xref="dbSNP:144158389"
variation 984
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200058441"
variation 992
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:115969702"
variation 1011
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:375839952"
variation 1043
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139728464"
exon 1076..1237
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1080..1081
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace=""
/replace="ga"
/db_xref="dbSNP:147413396"
variation 1176
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143403057"
exon 1238..1463
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1243
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:368721550"
variation 1252
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371450806"
variation 1313
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:5030887"
variation 1378
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:186324342"
variation 1442
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:374529988"
exon 1464..1577
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1480
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:370448387"
variation 1481
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35889265"
variation 1539
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140565825"
variation 1546
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113916300"
exon 1578..1744
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1640
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369724620"
variation 1696
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:376666033"
variation 1730
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200097148"
exon 1745..1955
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1820
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150319796"
variation 1840
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:137961156"
variation 1860
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376603370"
variation 1867
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142459122"
variation 1882
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1782338"
exon 1956..2039
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 1969
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:374279098"
variation 1970
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144569762"
exon 2040..2225
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2123
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200975108"
variation 2161
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1060145"
variation 2168
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377429137"
variation 2183
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:61734872"
variation 2206
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:15341"
variation 2213
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11542600"
variation 2221
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:369000905"
variation 2222
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11542601"
exon 2226..2417
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2256
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:374593914"
variation 2300
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149316365"
variation 2315
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:368126227"
variation 2325
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:200295441"
variation 2358
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11542602"
exon 2418..2657
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2433
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:144635849"
variation 2498
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45543532"
variation 2520
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1137221"
variation 2525
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141945"
variation 2526
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141946"
variation 2528
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:3205757"
variation 2536
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3208119"
variation 2550
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147482092"
variation 2604
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139929482"
variation 2619
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:367944680"
variation 2656
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:190265284"
exon 2658..2769
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2706
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372573164"
variation 2736
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373237686"
variation 2749
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:145459086"
exon 2770..2852
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2791
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:193120401"
variation 2806
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147237161"
variation 2810
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:139705190"
exon 2853..2999
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 2916
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:77019883"
variation 2950
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371050608"
variation 2964
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374402888"
variation 2981
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377739082"
exon 3000..3120
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 3001
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:367879843"
variation 3007
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149846066"
variation 3008
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140825306"
variation 3021
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141395925"
variation 3030
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370481782"
variation 3031
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374978103"
variation 3076..3078
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace=""
/replace="aga"
/db_xref="dbSNP:75943986"
variation 3084
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:150830336"
variation 3105
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:144452523"
exon 3121..3306
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 3137
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:184417073"
variation 3161
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146609391"
variation 3171
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372036224"
variation 3191
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140866671"
variation 3252
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144696799"
exon 3307..3512
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 3317
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35305147"
variation 3324
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:376412284"
variation 3329
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:35241751"
variation 3330
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:199941308"
variation 3334
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:201664147"
variation 3361
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:201766936"
variation 3418
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199712155"
variation 3419
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11594683"
variation 3434
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140125584"
exon 3513..3858
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/inference="alignment:Splign:1.39.8"
variation 3519
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369294276"
variation 3540
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:201223388"
variation 3565
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150373089"
STS 3578..3759
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/standard_name="RH98330"
/db_xref="UniSTS:91327"
variation 3597
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:7898773"
variation 3700
/gene="CCAR1"
/gene_synonym="RP11-437A18.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11591527"
ORIGIN
gaagttggcgcatgcgcctaaagctgacgggtttgaaatggcttcgatgttagccgggacccgactcagatcgatgctatagaagacaaacaagggaaggttttttttccttttgcatcatggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccagcaaactatcagttaacacaaactgctgcattgcagcaacaagccgcagctgcagcagctgcattacaacagcaatattcacaacctcagcaggccctgtatagtgtgcaacaacagttacagcaaccccagcaaaccctcttaacacagccagctgttgcactgcctacaagccttagcctgtctactcctcagccaacagcacaaataactgtatcatatccaacaccaaggtccagtcaacagcaaacccagcctcagaagcagcgtgttttcacaggggtggttacaaaactacatgatacgtttggatttgtggatgaagatgtattctttcagcttagtgctgtcaaagggaaaaccccccaagtaggtgacagagtattggttgaagctacttataatcctaatatgccttttaaatggaatgcacagagaattcaaacactaccaaatcagaatcagtcgcaaacccagccattactgaagactcctcctgctgtacttcagccaattgcaccacagacaacatttggtgttcagactcagccccagccccagtcactgctgcaggcacagatttcagcagcttctattacaccactattgcagactcaaccacagcccttattacagcagcctcagcaaaaagctggtttattgcagcctcctgttcgtatagtttcacagccacaaccggcacgacgattagatcccccatcccgattttcaggaagaaatgacagaggggatcaagtgcctaacagaaaagatgatcgaagtcgtgagagagagagagaaagacgtagatcgagagaaagatcacctcagaggaaacgttcccgggaaagatctccacgaagagagcgagagcgatcacctcggagagttcgacgtgttgttccacgttacacagttcagttttcaaagttttctttagattgtcccagttgtgacatgatggaactaaggcgccgttatcaaaatttgtatatacctagtgacttttttgatgctcaatttacatgggtggatgctttccctttgtcaagaccatttcagctgggaaattactgcaatttttatgtaatgcacagagaagtagagtccttagaaaaaaatatggccattcttgatccaccagatgctgaccacttatacagtgcaaaggtaatgctgatggctagccctagtatggaagatttatatcataagtcatgtgctcttgctgaggacccacaagaacttcgagatggattccaacatcctgctagacttgttaagtttttagtgggcatgaaaggcaaggatgaagctatggccattggaggccactggtctccttcgttggatggaccagacccagaaaaagatccctctgtgttgattaagactgctattcgttgttgtaaggctctgacaggcattgatctaagtgtgtgcacacaatggtaccgttttgcagagattcgctaccatcgccctgaggagacccacaaggggcgtacagttccagctcatgtggagacagtggttttatttttcccggatgtttggcattgccttcccacccgctcagagtgggaaaccctctcccgaggatacaagcagcagctggtcgagaagcttcagggtgaacgcaaggaggctgatggagaacaggatgaagaagagaaggatgatggtgaagctaaagaaatttctacacctacccattggtctaaacttgatccaaagacaatgaaggtaaatgacctccgaaaagaattagaaagtcgagctcttagttccaaaggattaaaatcccagttaatagcccgattgacaaaacagcttaaagtagaggaacaaaaagaagaacagaaggagttagagaaatctgaaaaagaagaggatgaggatgatgataggaaatctgaagacgataaagaggaagaagaaaggaaacgtcaagaggaaatagaacgccagcgtcgagaaagaagatatattttgcctgatgaaccggccatcattgtacatccaaattgggctgcaaaaagtggcaagtttgattgtagcatcatgtctttgagtgtcctattggactacagattagaggataataaagaacattcatttgaggtttcattgtttgcggaacttttcaacgaaatgcttcaaagagattttggtgtccgtatatacaaatcattactgtctcttcctgagaaagaggacaaaaaagaaaaggataaaaaaagcaaaaaagatgagagaaaagataaaaaagaagaaagagatgatgaaactgatgaaccaaaacccaaacggagaaaatcaggcgatgataaagataaaaaagaagatagagatgaaaggaagaaagaagataaaagaaaagatgattctaaagatgatgatgaaactgaagaagataacaatcaagatgaatatgaccctatggaagcagaagaagctgaggatgaagaagatgatagggatgaggaagaaatgaccaaacgagatgacaaaagagatatcaacagatactgcaaggagaggccctctaaagataaggaaaaagaaaagactcaaatgatcacaattaacagagatctgttaatggcttttgtttattttgatcaaagtcattgtggttaccttcttgaaaaggatttggaagaaatactttatactcttggactacatctttctcgggctcaggtaaagaagcttcttaataaagtagtgctccgtgaatcttgcttttaccggaaattaacagacacctcaaaagatgaagagaaccatgaagagtctgagtcattgcaggaagatatgctaggaaacagattattacttccaacaccaacagtaaagcaggaatcaaaggatgtggaagaaaatgttggcctcattgtgtacaatggtgcaatggtagatgtaggaagcctcttgcaaaaattggaaaagagcgaaaaagtaagagctgaggtagaacagaagctgcagttactagaagaaaaaacagatgaagatgaaaaaaccatattaaatttggagaattccaacaaaagcctctctggtgaactcagagaagttaaaaaggaccttagtcagttacaagaaaacttaaagatttcggaaaacatgaatttacaatttgaaaaccaaatgaataagacaatcagaaacttatctacggtaatggatgaaatccacactgttctcaagaaggataatgtaaagaatgaagacaaagatcaaaaatccaaggagaatggtgccagtgtatgataaaatccatgtagtgatgaggaatggtgttaaataatgtaatatataaaaatcatgatataagaatgtttgaaggtgatgcatgtttgattttagtagtataaatgtattttagttcaaatgatgtataaagttttatgaatgtgagtttctgcttttgaaaattgcttgtaattcctagccttcaaattattaaacactccttgagtgaaataattttgcattgcaaagtgttttaggatgaactttgttatagttttaactccaataaagttcatcagtttaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:55749 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
GeneID:55749 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:55749 -> Molecular function: GO:0030374 [ligand-dependent nuclear receptor transcription coactivator activity] evidence: IGI
GeneID:55749 -> Biological process: GO:0000398 [mRNA splicing, via spliceosome] evidence: TAS
GeneID:55749 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:55749 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:55749 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:55749 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:55749 -> Biological process: GO:0008380 [RNA splicing] evidence: TAS
GeneID:55749 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:55749 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:55749 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.