2024-03-29 07:56:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018218 5623 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens ubiquitin specific peptidase 40 (USP40), mRNA. ACCESSION NM_018218 XM_291008 VERSION NM_018218.2 GI:116063563 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 5623) AUTHORS Zhao,B., Song,W., Chen,Y.P., Huang,R., Chen,K., Cao,B., Yang,Y. and Shang,H.F. TITLE Association analysis of single-nucleotide polymorphisms of USP24 and USP40 with Parkinson's disease in the Han Chinese population JOURNAL Eur. Neurol. 68 (3), 181-184 (2012) PUBMED 22923019 REMARK GeneRIF: present study is the first to report a lack of association between SNPs of USP40 and parkinson disease in Han Chinese patients. Other REFERENCE 2 (bases 1 to 5623) AUTHORS Kenny,E.E., Pe'er,I., Karban,A., Ozelius,L., Mitchell,A.A., Ng,S.M., Erazo,M., Ostrer,H., Abraham,C., Abreu,M.T., Atzmon,G., Barzilai,N., Brant,S.R., Bressman,S., Burns,E.R., Chowers,Y., Clark,L.N., Darvasi,A., Doheny,D., Duerr,R.H., Eliakim,R., Giladi,N., Gregersen,P.K., Hakonarson,H., Jones,M.R., Marder,K., McGovern,D.P., Mulle,J., Orr-Urtreger,A., Proctor,D.D., Pulver,A., Rotter,J.I., Silverberg,M.S., Ullman,T., Warren,S.T., Waterman,M., Zhang,W., Bergman,A., Mayer,L., Katz,S., Desnick,R.J., Cho,J.H. and Peter,I. TITLE A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci JOURNAL PLoS Genet. 8 (3), E1002559 (2012) PUBMED 22412388 REFERENCE 3 (bases 1 to 5623) AUTHORS Bielinski,S.J., Chai,H.S., Pathak,J., Talwalkar,J.A., Limburg,P.J., Gullerud,R.E., Sicotte,H., Klee,E.W., Ross,J.L., Kocher,J.P., Kullo,I.J., Heit,J.A., Petersen,G.M., de Andrade,M. and Chute,C.G. TITLE Mayo Genome Consortia: a genotype-phenotype resource for genome-wide association studies with an application to the analysis of circulating bilirubin levels JOURNAL Mayo Clin. Proc. 86 (7), 606-614 (2011) PUBMED 21646302 REFERENCE 4 (bases 1 to 5623) AUTHORS Wu,Y.R., Chen,C.M., Chen,Y.C., Chao,C.Y., Ro,L.S., Fung,H.C., Hsiao,Y.C., Hu,F.J. and Lee-Chen,G.J. TITLE Ubiquitin specific proteases USP24 and USP40 and ubiquitin thiolesterase UCHL1 polymorphisms have synergic effect on the risk of Parkinson's disease among Taiwanese JOURNAL Clin. Chim. Acta 411 (13-14), 955-958 (2010) PUBMED 20302855 REMARK GeneRIF: USP24 alone plays a role in PD susceptibility among Taiwanese people >or=60 years of age, or acting synergistically with USP40 and UCHL1 in the total subjects. GeneRIF: Observational study of gene-disease association and gene-gene interaction. (HuGE Navigator) REFERENCE 5 (bases 1 to 5623) AUTHORS Li,Y., Schrodi,S., Rowland,C., Tacey,K., Catanese,J. and Grupe,A. TITLE Genetic evidence for ubiquitin-specific proteases USP24 and USP40 as candidate genes for late-onset Parkinson disease JOURNAL Hum. Mutat. 27 (10), 1017-1023 (2006) PUBMED 16917932 REMARK GeneRIF: Da suggest that genetic variants in USP40 affect the risk for late-onset Parkinson disease (PD), which is consistent with the predicted role of the ubiquitination pathway in PD etiology. GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 5623) AUTHORS Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H., Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M., Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E., Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J., Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C., Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S., Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M., Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T., Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K., Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A., Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J., Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N., Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J., Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M., Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R., Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W., Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J., Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E., Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A., She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J., Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R., Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A., Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P., Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K. TITLE Generation and annotation of the DNA sequences of human chromosomes 2 and 4 JOURNAL Nature 434 (7034), 724-731 (2005) PUBMED 15815621 REFERENCE 7 (bases 1 to 5623) AUTHORS Quesada,V., Diaz-Perales,A., Gutierrez-Fernandez,A., Garabaya,C., Cal,S. and Lopez-Otin,C. TITLE Cloning and enzymatic analysis of 22 novel human ubiquitin-specific proteases JOURNAL Biochem. Biophys. Res. Commun. 314 (1), 54-62 (2004) PUBMED 14715245 REFERENCE 8 (bases 1 to 5623) AUTHORS Puente,X.S., Sanchez,L.M., Overall,C.M. and Lopez-Otin,C. TITLE Human and mouse proteases: a comparative genomic approach JOURNAL Nat. Rev. Genet. 4 (7), 544-558 (2003) PUBMED 12838346 REMARK Review article REFERENCE 9 (bases 1 to 5623) AUTHORS Bass,B.L. TITLE RNA editing by adenosine deaminases that act on RNA JOURNAL Annu. Rev. Biochem. 71, 817-846 (2002) PUBMED 12045112 REMARK Review article REFERENCE 10 (bases 1 to 5623) AUTHORS Chen,X., Zhang,Y., Douglas,L. and Zhou,P. TITLE UV-damaged DNA-binding proteins are targets of CUL-4A-mediated ubiquitination and degradation JOURNAL J. Biol. Chem. 276 (51), 48175-48182 (2001) PUBMED 11673459 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AJ583821.2, AC019072.8, AK001647.1, AL833371.1 and AI375976.1. On Oct 12, 2006 this sequence version replaced gi:41055952. Summary: Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]. ##Evidence-Data-START## Transcript exon combination :: AJ583821.2 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1194 AJ583821.2 1-1194 1195-1203 AC019072.8 135341-135349 1204-3462 AK001647.1 1166-3424 3463-5610 AL833371.1 575-2722 5611-5623 AI375976.1 1-13 c FEATURES Location/Qualifiers source 1..5623 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q37.1" gene 1..5623 /gene="USP40" /note="ubiquitin specific peptidase 40" /db_xref="GeneID:55230" /db_xref="HGNC:20069" /db_xref="HPRD:07166" /db_xref="MIM:610570" CDS 1..3744 /gene="USP40" /EC_number="3.4.19.12" /note="ubiquitin specific protease 40; ubiquitin-specific-processing protease 40; deubiquitinating enzyme 40; ubiquitin thioesterase 40; ubiquitin thiolesterase 40" /codon_start=1 /product="ubiquitin carboxyl-terminal hydrolase 40" /protein_id="NP_060688.1" /db_xref="GI:41055953" /db_xref="CCDS:CCDS46547.1" /db_xref="GeneID:55230" /db_xref="HGNC:20069" /db_xref="HPRD:07166" /db_xref="MIM:610570" /translation="
MSLFLRVVFSFTMFGDLFEEEYSTVSNNQYGKGKKLKTKALEPPAPREFTNLSGIRNQGGTCYLNSLLQTLHFTPEFREALFSLGPEELGLFEDKDKPDAKVRIIPLQLQRLFAQLLLLDQEAASTADLTDSFGWTSNEEMRQHDVQELNRILFSALETSLVGTSGHDLIYRLYHGTIVNQIVCKECKNVSERQEDFLDLTVAVKNVSGLEDALWNMYVEEEVFDCDNLYHCGTCDRLVKAAKSAKLRKLPPFLTVSLLRFNFDFVKCERYKETSCYTFPLRINLKPFCEQSELDDLEYIYDLFSVIIHKGGCYGGHYHVYIKDVDHLGNWQFQEEKSKPDVNLKDLQSEEEIDHPLMILKAILLEENNLIPVDQLGQKLLKKIGISWNKKYRKQHGPLRKFLQLHSQIFLLSSDESTVRLLKNSSLQAESDFQRNDQQIFKMLPPESPGLNNSISCPHWFDINDSKVQPIREKDIEQQFQGKESAYMLFYRKSQLQRPPEARANPRYGVPCHLLNEMDAANIELQTKRAECDSANNTFELHLHLGPQYHFFNGALHPVVSQTESVWDLTFDKRKTLGDLRQSIFQLLEFWEGDMVLSVAKLVPAGLHIYQSLGGDELTLCETEIADGEDIFVWNGVEVGGVHIQTGIDCEPLLLNVLHLDTSSDGEKCCQVIESPHVFPANAEVGTVLTALAIPAGVIFINSAGCPGGEGWTAIPKEDMRKTFREQGLRNGSSILIQDSHDDNSLLTKEEKWVTSMNEIDWLHVKNLCQLESEEKQVKISATVNTMVFDIRIKAIKELKLMKELADNSCLRPIDRNGKLLCPVPDSYTLKEAELKMGSSLGLCLGKAPSSSQLFLFFAMGSDVQPGTEMEIVVEETISVRDCLKLMLKKSGLQGDAWHLRKMDWCYEAGEPLCEEDATLKELLICSGDTLLLIEGQLPPLGFLKVPIWWYQLQGPSGHWESHQDQTNCTSSWGRVWRATSSQGASGNEPAQVSLLYLGDIEISEDATLAELKSQAMTLPPFLEFGVPSPAHLRAWTVERKRPGRLLRTDRQPLREYKLGRRIEICLEPLQKGENLGPQDVLLRTQVRIPGERTYAPALDLVWNAAQGGTAGSLRQRVADFYRLPVEKIEIAKYFPEKFEWLPISSWNQQITKRKKKKKQDYLQGAPYYLKDGDTIGVKNLLIDDDDDFSTIRDDTGKEKQKQRALGRRKSQEALHEQSSYILSSAETPARPRAPETSLSIHVGSFR
" misc_feature 151..1068 /gene="USP40" /note="A subfamily of Peptidase C19. Peptidase C19 contains ubiquitinyl hydrolases. They are intracellular peptidases that remove ubiquitin molecules from polyubiquinated peptides by cleavage of isopeptide bonds. They hydrolyze bonds involving the carboxyl...; Region: peptidase_C19C; cd02659" /db_xref="CDD:73065" misc_feature 157..969 /gene="USP40" /note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH_1; pfam13423" /db_xref="CDD:205601" misc_feature order(169..171,184..186,949..951,1003..1005) /gene="USP40" /note="active site" /db_xref="CDD:73065" misc_feature <1378..1476 /gene="USP40" /note="Peptidase C19 contains ubiquitinyl hydrolases. They are intracellular peptidases that remove ubiquitin molecules from polyubiquinated peptides by cleavage of isopeptide bonds. They hydrolyse bonds involving the carboxyl group of the C-terminal Gly...; Region: Peptidase_C19; cd02257" /db_xref="CDD:73062" exon 1..235 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 7..8 /gene="USP40" /replace="" /replace="t" /db_xref="dbSNP:371356658" variation 13..14 /gene="USP40" /replace="" /replace="t" /db_xref="dbSNP:112086362" variation 14..15 /gene="USP40" /replace="" /replace="t" /db_xref="dbSNP:60563116" exon 236..303 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 304..417 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 418..582 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 583..729 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 730..873 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 874..1002 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1003..1098 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1099..1203 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 1195 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:2167884" exon 1204..1504 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1505..1586 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1587..1758 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1759..1843 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1844..1914 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 1915..2234 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 2033 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:838543" exon 2235..2358 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2359..2416 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2417..2470 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2471..2559 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2560..2646 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 2612 /gene="USP40" /replace="a" /replace="g" /db_xref="dbSNP:2602392" exon 2647..2683 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2684..2748 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2749..2823 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2824..2950 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 2951..3045 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 3046..3164 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 3165..3230 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 3231..3441 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 3285 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:2603547" variation 3367 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:1048603" exon 3442..3537 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 3538..3632 /gene="USP40" /inference="alignment:Splign:1.39.8" exon 3633..5617 /gene="USP40" /inference="alignment:Splign:1.39.8" variation 4030 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:2242096" variation 4073 /gene="USP40" /replace="c" /replace="t" /db_xref="dbSNP:2924809" variation 4506 /gene="USP40" /replace="a" /replace="g" /db_xref="dbSNP:2242097" STS 5075..5263 /gene="USP40" /standard_name="RH102130" /db_xref="UniSTS:96464" variation 5186 /gene="USP40" /replace="a" /replace="g" /db_xref="dbSNP:7724" STS 5333..5572 /gene="USP40" /standard_name="RH79707" /db_xref="UniSTS:84266" STS 5406..5531 /gene="USP40" /standard_name="RH94290" /db_xref="UniSTS:83890" polyA_signal 5587..5592 /gene="USP40" polyA_site 5609 /gene="USP40" ORIGIN
atgtcactttttttaagggtagtatttagtttcacaatgtttggggacctgtttgaagaggagtattccactgtgtctaataatcagtatggaaaagggaagaaattaaagactaaagctttggagccacctgctcctagagaattcaccaatttaagcggaatcagaaatcagggtggaacctgttacctcaattcccttcttcagactcttcatttcacacctgaattcagagaagctctattttctcttggcccagaagagcttggtttgtttgaagataaggataaacccgatgcaaaggttcgaatcatccctttacagttacagcgcttgtttgctcagcttctgctcttagaccaggaagctgcatccacagcagacctcactgacagctttgggtggaccagtaatgaggaaatgaggcaacatgatgtgcaggaactgaatcgaatcctcttcagcgctttggaaacttctttagttgggacctccggtcatgacctcatctatcgtctgtaccatggaaccattgttaaccagattgtttgtaaagaatgtaagaacgttagcgagaggcaggaagacttcttagatctaacagtagcagtcaaaaatgtatccggtttggaagatgctctctggaacatgtatgtagaagaggaagtttttgattgtgacaacttgtaccactgtggaacttgtgacaggctggttaaagcagcaaagtcggccaaattacgtaagctgcctccttttcttactgtttcattactaagatttaattttgattttgtgaaatgcgaacgctacaaggaaactagctgttatacattccctctccggattaatctcaagcccttttgtgaacagagtgaattggatgacttagaatatatatatgacctcttctcagttattatacacaaaggtggctgctacggaggccattaccatgtatatattaaagatgttgatcatttgggaaactggcagtttcaagaggaaaaaagtaaaccagatgtgaatctgaaagatctccagagtgaagaagagattgatcatccactgatgattctaaaagcaatcttattagaggagaataatctaattcctgttgatcagctgggccagaaacttttgaaaaagataggaatatcttggaacaagaagtacagaaaacagcatggaccactgcggaagttcttacagctccattctcagatatttctactcagttcagatgaaagtacagttcgtctcttgaagaatagttctctccaggctgagtctgatttccaaaggaatgaccagcaaattttcaagatgcttcctccagaatccccaggtttaaacaatagcatctcctgtccccactggtttgatataaatgattctaaagtccagccaatcagggaaaaggatattgaacagcaatttcagggtaaagaaagtgcctacatgttgttttatcggaaatcccagttgcagagaccccctgaagctcgagctaatccaagatatggggttccatgtcatttactgaatgaaatggatgcagctaacattgaactgcaaaccaaaagggcagaatgtgattctgcaaacaatacttttgaattgcatcttcacctgggccctcagtatcatttcttcaatggggctctgcacccagtagtctctcaaacagaaagcgtgtgggatttgacctttgataaaagaaaaactttaggagatctccggcagtcaatatttcagctgttagaattttgggaaggagacatggttcttagtgttgcaaagcttgtaccagcaggacttcacatttaccagtcacttggcggggatgaactgacactgtgtgaaactgaaattgctgatggggaagacatctttgtgtggaatggggtggaggttggtggagtccacattcaaactggtattgactgcgaacctctacttttaaatgttcttcatctagacacaagcagtgatggagaaaagtgttgtcaggtgatagaatctccacatgtctttccagctaatgcagaagtgggcactgtcctcacagccttagcaatcccagcaggtgtcatcttcatcaacagtgctggatgtccaggtggggagggttggacggccatccccaaggaagacatgaggaagacgttcagggagcaagggctcagaaatggaagctcaattttaattcaggattctcatgatgataacagcttgttgaccaaggaagagaaatgggtcactagtatgaatgagattgactggctccacgttaaaaatttatgccagttagaatctgaagagaagcaagttaaaatatcagcaactgttaacacaatggtgtttgatattcgaattaaagccataaaggaattaaaattaatgaaggaactagctgacaacagctgtttgagacctattgatagaaatgggaagcttctttgtccagtgccggacagctatactttgaaggaagcagaattgaagatgggaagttcattgggactgtgtcttggaaaagcaccaagttcgtctcagttgttcctgttttttgcaatggggagtgacgttcaacctgggacagaaatggaaatcgtagtagaagaaacaatatctgtgagagattgtttaaagttaatgctgaagaaatctggcctacaaggagatgcctggcatttacgaaaaatggattggtgctatgaagctggagagcctttatgtgaagaagatgcaacactgaaagaacttctgatatgttctggagatactttgcttttaattgaaggacaacttcctcctctgggtttcctgaaggtgcccatctggtggtaccagcttcagggtccctcaggacactgggagagtcatcaggaccagaccaactgtacttcgtcttggggcagagtttggagagccacttccagccaaggtgcttctgggaacgagcctgcgcaagtttctctcctctacttgggagacatagagatctcagaagatgccacgctggcggagctgaagtctcaggccatgaccttgcctcctttcctggagttcggtgtcccgtccccagcccacctcagagcctggacggtggagaggaagcgcccaggcaggcttttacgaactgaccggcagccactcagggaatataaactaggacggagaattgagatctgcttagagccccttcagaaaggcgaaaacttgggcccccaggacgtgctgctgaggacacaggtgcgcatccctggtgagaggacctatgcccctgccctggacctggtgtggaacgcggcccagggtgggactgccggctccctgaggcagagagttgccgatttctatcgtcttcccgtggagaagattgaaattgccaaatactttcccgaaaagttcgagtggcttccgatatctagctggaaccaacaaataaccaagaggaaaaagaaaaaaaaacaagattatttgcaaggggcaccgtattacttgaaagacggagatactattggtgttaagaatctcctgattgacgacgatgatgatttcagtacaatcagagatgacactggaaaagaaaagcagaaacaacgggccctggggagaaggaaaagccaagaagccctccatgagcagagcagctacatcctctccagtgcagagacgcctgcccggccccgagccccggaaacttctctctccatccacgtggggagcttcagataaccgcgccgctgcacggctctactcccgatgaactctccggctgatgccacaaacgtgggtttcctgggcatggggactggctgcctggcgcctccaatcccaaatcctctgcttcctttgagcacagggacggctcctctgaggcctggccagtgcatgtagtcacttagctctgcaacacgtggcagccacgggggctggtgcagctctggatgtcgcccacccagctgccagtaggtgctgggctctctcacacagcacccggccccagctgcctttttttttcttttaaccagaaaatgcacaacgtgtgcgtgaaccgcaggtatggaggcagcggcatgccgttgctccgctgtgggaggtgtgtggggtcaggccagccactttcctccgtgttcagatgactctcgttcgccctgaccggcttctcacagtgtctcaggccactgcgccaccgcgctggtgctgagcagaagcgggcagaagtggggtctgctttcaggacttcatttcccccactcgttccggccccgcatgctccacgtctgccctttggtctgagttaaaactgcgatgctgaaaagtgcgagctctttccacgaggaggagccacacagggtggcctccgagggtgagtcgctctgctaagcaagggcagccgctgcacgtcagcccgcaggccaagggtccagcttatcctgggtgctctgtgatcagaaggtccttggatcccgaggactgcagctgctgccgtccacagcgcctcagcctctcttcctgtgtggaagcggggcaggcagggctgtggcagacaggcctggcatagcccaggttccaggtgtcctgggcagcctgaccggtttcctgagtagcctcaatgaaaacacctgagaaaaagaaaatgtaaactaaggaagggttttcccacttaatccaacccagatttctattcaacttaaaggatttaattggcatttgtgagaaataatagtacctgtgtcactgagttgattgatttgggacatagacggttgactttcccagacagcagcttagcggaaagcagcatcccgaagacggtgtcgcatgtcctgagcctgcttgtcacctgggcctcacggtttctcgtcagccccgtcactgatgggaagcagcactgaagtgtgagggcagaaaggacaccgctggagtcaggcgctcccctgcctgtgacccttttccaacaagctgatgctgagccagcggcctgctttgtccctcatactcctcccaacagtccaaacccctaccagacagaagccacgtcgcttctgcacacgtgtctgagagcgtctgccatagacgtctgtgcgtttccgtgaagcactgcgccctaaggacccaactctgactagcagctgcctcccactcccaaacactaaccccgctcaggagactcgcactgggtgtagactgcgtctttgcagagggagatgatagaggcttctgatgacgccagagctgtaagtgtcgtgacgagctgggcgcccagcccttcttaagctgttctgtttctgtggctttaactgacatatttctgtagcatctgccttcatctcatctcagcgtaatgaaatattaatgaaatcgctgaaaagctttgccttcgagaggccagaagcctcgcggaatgtctgcaagtccaaagacgcgtgtgggttgtgccctgaagtgccgtccagcaggcgcgtgcggccgggccggcctgtgcgtgtggcctttgccttcttccctttcttcctgttttctgtttttttaatttggggattgagaaagctgtacgattttgttaaagaaaaaaataaaccattttttaaagttgtagcccttaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:55230 -> Molecular function: GO:0004221 [ubiquitin thiolesterase activity] evidence: IEA GeneID:55230 -> Molecular function: GO:0008234 [cysteine-type peptidase activity] evidence: IEA GeneID:55230 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: IEA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_060688 -> EC 3.4.19.12
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.