Home |
Help |
Advanced search
2024-04-19 11:21:41, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018076 3572 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens armadillo repeat containing 4 (ARMC4), mRNA.
ACCESSION NM_018076
VERSION NM_018076.2 GI:31657113
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3572)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 2 (bases 1 to 3572)
AUTHORS Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M.,
Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D.,
Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J.
TITLE Genetic variants in nuclear-encoded mitochondrial genes influence
AIDS progression
JOURNAL PLoS ONE 5 (9), E12862 (2010)
PUBMED 20877624
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 3572)
AUTHORS Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
TITLE A scan of chromosome 10 identifies a novel locus showing strong
association with late-onset Alzheimer disease
JOURNAL Am. J. Hum. Genet. 78 (1), 78-88 (2006)
PUBMED 16385451
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 3572)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK001679.1.
On Jun 12, 2003 this sequence version replaced gi:8922385.
##Evidence-Data-START##
Transcript exon combination :: AK001679.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..3572
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10p12.1-p11.23"
gene 1..3572
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="armadillo repeat containing 4"
/db_xref="GeneID:55130"
/db_xref="HGNC:25583"
/db_xref="HPRD:10663"
exon 1..55
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 56..317
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
CDS 94..3228
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/codon_start=1
/product="armadillo repeat-containing protein 4"
/protein_id="NP_060546.2"
/db_xref="GI:31657114"
/db_xref="CCDS:CCDS7157.1"
/db_xref="GeneID:55130"
/db_xref="HGNC:25583"
/db_xref="HPRD:10663"
/translation="
MGVALRKLTQWTAAGHGTGILEITPLNEAILKEIIVFVESFIYKHPQEAKFVFVEPLEWNTSLAPSAFESGYVVSETTVKSEEVDKNGQPLLFLSVPQIKIRSFGQLSRLLLIAKTGKLKEAQACVEANRDPIVKILGSDYNTMKENSIALNILGKITRDDDPESEIKMKIAMLLKQLDLHLLNHSLKHISLEISLSPMTVKKDIELLKRFSGKGNQTVLESIEYTSDYEFSNGCRAPPWRQIRGEICYVLVKPHDGETLCITCSAGGVFLNGGKTDDEGDVNYERKGSIYKNLVTFLREKSPKFSENMSKLGISFSEDQQKEKDQLGKAPKKEEAAALRKDISGSDKRSLEKNQINFWRNQMTKRWEPSLNWKTTVNYKGKGSAKEIQEDKHTGKLEKPRPSVSHGRAQLLRKSAEKIEETVSDSSSESEEDEEPPDHRQEASADLPSEYWQIQKLVKYLKGGNQTATVIALCSMRDFSLAQETCQLAIRDVGGLEVLINLLETDEVKCKIGSLKILKEISHNPQIRQNIVDLGGLPIMVNILDSPHKSLKCLAAETIANVAKFKRARRVVRQHGGITKLVALLDCAHDSTKPAQSSLYEARDVEVARCGALALWSCSKSHTNKEAIRKAGGIPLLARLLKTSHENMLIPVVGTLQECASEENYRAAIKAERIIENLVKNLNSENEQLQEHCAMAIYQCAEDKETRDLVRLHGGLKPLASLLNNTDNKERLAAVTGAIWKCSISKENVTKFREYKAIETLVGLLTDQPEEVLVNVVGALGECCQERENRVIVRKCGGIQPLVNLLVGINQALLVNVTKAVGACAVEPESMMIIDRLDGVRLLWSLLKNPHPDVKASAAWALCPCIKNAKDAGEMVRSFVGGLELIVNLLKSDNKEVLASVCAAITNIAKDQENLAVITDHGVVPLLSKLANTNNNKLRHHLAEAISRCCMWGRNRVAFGEHKAVAPLVRYLKSNDTNVHRATAQALYQLSEDADNCITMHENGAVKLLLDMVGSPDQDLQEAAAGCISNIRRLALATEKARYT
"
misc_feature 1543..1662
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 1"
misc_feature 1555..1872
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(1627..1629,1639..1641,1651..1653,1741..1743,
1753..1755,1762..1764,1774..1776)
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 1666..1785
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 2"
misc_feature 1957..2076
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 3"
misc_feature 1969..2313
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(2041..2043,2053..2055,2065..2067,2155..2157,
2167..2169,2176..2178,2188..2190,2293..2295,2302..2304,
2311..2313)
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 2080..2199
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 4"
misc_feature 2095..2205
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: HEAT"
misc_feature 2215..2556
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(2287..2289,2302..2304,2314..2316,2404..2406,
2416..2418,2425..2427,2437..2439,2539..2541,2548..2550)
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 2329..2448
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 5"
misc_feature 2575..2694
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 6"
misc_feature 2593..2943
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature 2617..2934
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="HEAT repeats; Region: HEAT_2; pfam13646"
/db_xref="CDD:205823"
misc_feature order(2659..2661,2671..2673,2683..2685,2779..2781,
2791..2793,2800..2802,2812..2814,2914..2916,2923..2925,
2932..2937)
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 2704..2823
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 7"
misc_feature 2827..2946
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 8"
misc_feature 2839..3186
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature 2860..3168
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="HEAT repeats; Region: HEAT_2; pfam13646"
/db_xref="CDD:205823"
misc_feature order(2911..2913,2923..2925,2935..2937,3025..3027,
3037..3039,3046..3048,3058..3060,3160..3162,3169..3171,
3178..3183)
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 2950..3069
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 9"
misc_feature 3073..3192
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
Region: ARM 10"
exon 318..475
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 476..668
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 669..775
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 776..912
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 913..1029
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1030..1235
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1236..1331
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1332..1479
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1480..1626
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1627..1836
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 1837..2079
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 2080..2190
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
variation 2090
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35472668"
exon 2191..2345
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 2346..2588
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
variation 2452
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35242712"
variation 2473
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35280610"
exon 2589..2703
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 2704..2892
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
exon 2893..3114
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
variation 2898
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:35181927"
exon 3115..3572
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/inference="alignment:Splign:1.39.8"
variation 3358
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1061577"
polyA_signal 3548..3553
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
polyA_site 3572
/gene="ARMC4"
/gene_synonym="RP11-691I13.1"
ORIGIN
atacggtgcaacgggtccgcgggaatcttggatgcgcggaggtcccgagaccaggtgcgtgtgctaagctcaggtctgagcacggtggatcccatgggtgtggctctgaggaaattgacgcagtggactgctgccggacatggaactggaatcctcgaaatcacccctctaaatgaagcgatattgaaagaaattattgtgtttgtggagagttttatctataaacatcctcaagaggcaaaatttgtttttgtggaaccacttgaatggaacacaagtttggcgccctcagcatttgaatcaggttatgttgtcagtgaaacaacagtcaaatcagaagaagttgataaaaatggacagcctttgctatttctctctgtaccacaaattaaaattaggagctttgggcagctgtcacgcttgttacttattgccaaaactgggaagttgaaggaagcccaagcatgtgttgaagctaacagagaccccatagtaaaaatcctgggctctgattataatacaatgaaagaaaactcaattgcattaaatattcttggcaaaattaccagagatgatgatcctgaaagtgaaattaagatgaagattgctatgctgcttaagcaattggatctgcacctcctcaatcattctctaaaacatatttcattagaaataagtttaagtcccatgacggtgaagaaggatatagaactgctcaaacgtttctcaggaaaaggaaaccaaacagtcttggaatctattgaatatacctcagattatgaattttcaaatggatgtcgagccccaccgtggagacaaattcgtggggaaatttgttatgtgctggtgaaacctcacgatggtgagactctgtgcattacttgcagtgcaggaggagtatttttaaatggtggcaaaacagatgatgaaggggacgttaattatgagagaaaaggttcaatttataaaaaccttgtcacatttttaagagaaaaatcaccaaaattttcagaaaatatgtctaaattgggaattagcttcagtgaagaccagcaaaaggaaaaggatcagcttggcaaagcccccaagaaggaagaagcagctgccctccgcaaagacatttctggttcagacaaaaggtcactggagaagaaccaaattaatttttggaggaatcaaatgaccaagagatgggaaccaagcttaaactggaagaccactgttaattacaaaggcaaaggctcagcaaaagaaatccaagaggacaaacacacaggaaaacttgaaaaaccaagaccatctgtttcacacggaagagcacaattacttcggaagagtgctgaaaagattgaggaaactgttagcgatagctcctcagaaagtgaggaagatgaagaaccacctgaccatcgtcaggaagcaagtgcagatttgccatcagaatattggcaaattcagaagctggtgaaatatttaaagggaggaaatcaaacagctacagtgattgcgttgtgttcaatgagggatttcagcttagctcaagaaacctgccagttggccatcagagatgttggaggcctggaagtgctgataaatttgcttgaaaccgatgaagtcaaatgtaagattggttcattaaaaatactgaaggaaatcagtcataatcctcaaatcagacagaatattgttgaccttgggggcttaccaattatggtgaatatacttgattctccacacaagagtctaaaatgtttggcagccgagactatcgcgaatgttgccaagtttaaaagagcacggcgggtggtgaggcagcacgggggtatcaccaaactggttgctctactagactgtgcacatgattccacaaaacctgcccaatcgagtctgtatgaggccagagacgtggaagtggctcgctgtggggcactggccctgtggagctgcagtaagagtcatacgaataaagaagccatccgcaaagctgggggcattcctctgttggctcggctgctgaagacttctcatgaaaacatgctaattccagtggtggggacattgcaagagtgtgcatcagaggaaaactaccgggctgcaatcaaagcagaaaggatcattgaaaaccttgtcaagaacctaaatagtgagaatgagcagctgcaggagcactgcgccatggccatttaccagtgtgctgaagataaggaaacccgggacctcgttaggctgcacggaggacttaagcccttggccagtctactcaataacactgacaataaagagcggttagctgctgtcacaggggctatatggaaatgttccatcagcaaagagaatgttaccaagtttcgggaatacaaagccattgaaaccttggtgggacttctaacagatcagcctgaagaagtacttgtgaatgtggttggggccttgggagaatgctgccaagaacgtgaaaaccgagtcattgtccggaaatgtggtggcattcaaccacttgtgaacctccttgttggaataaaccaagctcttcttgtgaatgttacaaaagcagttggtgcttgtgcagtagaacctgaaagtatgatgataattgatcgcttagatggagttcgtttgttgtggtccctgctgaaaaatcctcacccagacgtgaaggccagcgcagcatgggcactctgtccatgcatcaaaaatgcaaaggatgctggggaaatggttcgttcctttgttggtggtttggaacttattgtcaatttactgaaatcagataacaaagaagttctggcaagtgtatgtgctgccattaccaacatagcaaaagatcaagaaaatttagctgttatcacagatcatggagttgttcctttattgtccaaactggcaaatacaaataacaataaattgagacatcatctagcagaagctatttcacgttgctgtatgtggggcaggaatagagtggccttcggtgagcacaaagcagtggctccactagtgcgttatctgaaatcaaatgacaccaacgtgcatcgggcgacagctcaggccttgtaccaactctcagaagacgccgataactgcatcaccatgcatgagaatggtgcagtaaagcttctactggatatggttgggtcccctgaccaggatctccaggaagctgcagctggttgtatatccaatatccgcaggctggctcttgctacagagaaggcaagatacacttgaaatttaaatggacattacaagctatcaaattctacatgacacaggacatgtcactcccatggccagaaagcctaaattgggaaacagttgttagcaaaccctttcaaccatctaaatgaaaacacacaaattgaaaatgcacagaatgtttttcatctgaaaattgcatggagacttttgtttctatttaatgttttcgagatatgacatgtgataagatggaaagccaataaacctgtgataagtttctaagaatatgagaatatacgtatatgatgtatttttagttcagtgatgcttttgtatttgtggcgattttaataaaaaggatatggccttcccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.