GGRNA Home | Help | Advanced search

2024-04-25 01:49:15, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018076               3572 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens armadillo repeat containing 4 (ARMC4), mRNA.
ACCESSION   NM_018076
VERSION     NM_018076.2  GI:31657113
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3572)
  AUTHORS   Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
            Gibbs,R.A. and Butte,N.F.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), E51954 (2012)
   PUBMED   23251661
REFERENCE   2  (bases 1 to 3572)
  AUTHORS   Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M.,
            Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D.,
            Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J.
  TITLE     Genetic variants in nuclear-encoded mitochondrial genes influence
            AIDS progression
  JOURNAL   PLoS ONE 5 (9), E12862 (2010)
   PUBMED   20877624
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 3572)
  AUTHORS   Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
            Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
            Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
            Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
            Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
            Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
            Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
  TITLE     A scan of chromosome 10 identifies a novel locus showing strong
            association with late-onset Alzheimer disease
  JOURNAL   Am. J. Hum. Genet. 78 (1), 78-88 (2006)
   PUBMED   16385451
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   4  (bases 1 to 3572)
  AUTHORS   Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
            French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
            Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
            Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
            Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
            Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
            Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
            Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
            Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
            Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
            Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
            Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
            Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
            Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
            Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
            Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
            Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
            Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
            Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
            Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
            Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
            Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
            Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
            Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
            Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
            Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
            Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
  TITLE     The DNA sequence and comparative analysis of human chromosome 10
  JOURNAL   Nature 429 (6990), 375-381 (2004)
   PUBMED   15164054
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK001679.1.
            On Jun 12, 2003 this sequence version replaced gi:8922385.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK001679.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..3572
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10p12.1-p11.23"
     gene            1..3572
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="armadillo repeat containing 4"
                     /db_xref="GeneID:55130"
                     /db_xref="HGNC:25583"
                     /db_xref="HPRD:10663"
     exon            1..55
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            56..317
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     CDS             94..3228
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /codon_start=1
                     /product="armadillo repeat-containing protein 4"
                     /protein_id="NP_060546.2"
                     /db_xref="GI:31657114"
                     /db_xref="CCDS:CCDS7157.1"
                     /db_xref="GeneID:55130"
                     /db_xref="HGNC:25583"
                     /db_xref="HPRD:10663"
                     /translation="
MGVALRKLTQWTAAGHGTGILEITPLNEAILKEIIVFVESFIYKHPQEAKFVFVEPLEWNTSLAPSAFESGYVVSETTVKSEEVDKNGQPLLFLSVPQIKIRSFGQLSRLLLIAKTGKLKEAQACVEANRDPIVKILGSDYNTMKENSIALNILGKITRDDDPESEIKMKIAMLLKQLDLHLLNHSLKHISLEISLSPMTVKKDIELLKRFSGKGNQTVLESIEYTSDYEFSNGCRAPPWRQIRGEICYVLVKPHDGETLCITCSAGGVFLNGGKTDDEGDVNYERKGSIYKNLVTFLREKSPKFSENMSKLGISFSEDQQKEKDQLGKAPKKEEAAALRKDISGSDKRSLEKNQINFWRNQMTKRWEPSLNWKTTVNYKGKGSAKEIQEDKHTGKLEKPRPSVSHGRAQLLRKSAEKIEETVSDSSSESEEDEEPPDHRQEASADLPSEYWQIQKLVKYLKGGNQTATVIALCSMRDFSLAQETCQLAIRDVGGLEVLINLLETDEVKCKIGSLKILKEISHNPQIRQNIVDLGGLPIMVNILDSPHKSLKCLAAETIANVAKFKRARRVVRQHGGITKLVALLDCAHDSTKPAQSSLYEARDVEVARCGALALWSCSKSHTNKEAIRKAGGIPLLARLLKTSHENMLIPVVGTLQECASEENYRAAIKAERIIENLVKNLNSENEQLQEHCAMAIYQCAEDKETRDLVRLHGGLKPLASLLNNTDNKERLAAVTGAIWKCSISKENVTKFREYKAIETLVGLLTDQPEEVLVNVVGALGECCQERENRVIVRKCGGIQPLVNLLVGINQALLVNVTKAVGACAVEPESMMIIDRLDGVRLLWSLLKNPHPDVKASAAWALCPCIKNAKDAGEMVRSFVGGLELIVNLLKSDNKEVLASVCAAITNIAKDQENLAVITDHGVVPLLSKLANTNNNKLRHHLAEAISRCCMWGRNRVAFGEHKAVAPLVRYLKSNDTNVHRATAQALYQLSEDADNCITMHENGAVKLLLDMVGSPDQDLQEAAAGCISNIRRLALATEKARYT
"
     misc_feature    1543..1662
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 1"
     misc_feature    1555..1872
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="Armadillo/beta-catenin-like repeats. An
                     approximately 40 amino acid long tandemly repeated
                     sequence motif first identified in the Drosophila segment
                     polarity gene armadillo; these repeats were also found in
                     the mammalian armadillo homolog beta-catenin; Region: ARM;
                     cd00020"
                     /db_xref="CDD:28904"
     misc_feature    order(1627..1629,1639..1641,1651..1653,1741..1743,
                     1753..1755,1762..1764,1774..1776)
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="protein binding surface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28904"
     misc_feature    1666..1785
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 2"
     misc_feature    1957..2076
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 3"
     misc_feature    1969..2313
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="Armadillo/beta-catenin-like repeats. An
                     approximately 40 amino acid long tandemly repeated
                     sequence motif first identified in the Drosophila segment
                     polarity gene armadillo; these repeats were also found in
                     the mammalian armadillo homolog beta-catenin; Region: ARM;
                     cd00020"
                     /db_xref="CDD:28904"
     misc_feature    order(2041..2043,2053..2055,2065..2067,2155..2157,
                     2167..2169,2176..2178,2188..2190,2293..2295,2302..2304,
                     2311..2313)
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="protein binding surface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28904"
     misc_feature    2080..2199
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 4"
     misc_feature    2095..2205
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: HEAT"
     misc_feature    2215..2556
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="Armadillo/beta-catenin-like repeats. An
                     approximately 40 amino acid long tandemly repeated
                     sequence motif first identified in the Drosophila segment
                     polarity gene armadillo; these repeats were also found in
                     the mammalian armadillo homolog beta-catenin; Region: ARM;
                     cd00020"
                     /db_xref="CDD:28904"
     misc_feature    order(2287..2289,2302..2304,2314..2316,2404..2406,
                     2416..2418,2425..2427,2437..2439,2539..2541,2548..2550)
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="protein binding surface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28904"
     misc_feature    2329..2448
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 5"
     misc_feature    2575..2694
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 6"
     misc_feature    2593..2943
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="Armadillo/beta-catenin-like repeats. An
                     approximately 40 amino acid long tandemly repeated
                     sequence motif first identified in the Drosophila segment
                     polarity gene armadillo; these repeats were also found in
                     the mammalian armadillo homolog beta-catenin; Region: ARM;
                     cd00020"
                     /db_xref="CDD:28904"
     misc_feature    2617..2934
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="HEAT repeats; Region: HEAT_2; pfam13646"
                     /db_xref="CDD:205823"
     misc_feature    order(2659..2661,2671..2673,2683..2685,2779..2781,
                     2791..2793,2800..2802,2812..2814,2914..2916,2923..2925,
                     2932..2937)
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="protein binding surface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28904"
     misc_feature    2704..2823
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 7"
     misc_feature    2827..2946
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 8"
     misc_feature    2839..3186
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="Armadillo/beta-catenin-like repeats. An
                     approximately 40 amino acid long tandemly repeated
                     sequence motif first identified in the Drosophila segment
                     polarity gene armadillo; these repeats were also found in
                     the mammalian armadillo homolog beta-catenin; Region: ARM;
                     cd00020"
                     /db_xref="CDD:28904"
     misc_feature    2860..3168
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="HEAT repeats; Region: HEAT_2; pfam13646"
                     /db_xref="CDD:205823"
     misc_feature    order(2911..2913,2923..2925,2935..2937,3025..3027,
                     3037..3039,3046..3048,3058..3060,3160..3162,3169..3171,
                     3178..3183)
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /note="protein binding surface [polypeptide binding];
                     other site"
                     /db_xref="CDD:28904"
     misc_feature    2950..3069
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 9"
     misc_feature    3073..3192
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q5T2S8.1);
                     Region: ARM 10"
     exon            318..475
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            476..668
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            669..775
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            776..912
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            913..1029
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1030..1235
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1236..1331
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1332..1479
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1480..1626
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1627..1836
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1837..2079
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2080..2190
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2090
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35472668"
     exon            2191..2345
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2346..2588
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2452
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35242712"
     variation       2473
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35280610"
     exon            2589..2703
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2704..2892
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2893..3114
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2898
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35181927"
     exon            3115..3572
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /inference="alignment:Splign:1.39.8"
     variation       3358
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1061577"
     polyA_signal    3548..3553
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
     polyA_site      3572
                     /gene="ARMC4"
                     /gene_synonym="RP11-691I13.1"
ORIGIN      
atacggtgcaacgggtccgcgggaatcttggatgcgcggaggtcccgagaccaggtgcgtgtgctaagctcaggtctgagcacggtggatcccatgggtgtggctctgaggaaattgacgcagtggactgctgccggacatggaactggaatcctcgaaatcacccctctaaatgaagcgatattgaaagaaattattgtgtttgtggagagttttatctataaacatcctcaagaggcaaaatttgtttttgtggaaccacttgaatggaacacaagtttggcgccctcagcatttgaatcaggttatgttgtcagtgaaacaacagtcaaatcagaagaagttgataaaaatggacagcctttgctatttctctctgtaccacaaattaaaattaggagctttgggcagctgtcacgcttgttacttattgccaaaactgggaagttgaaggaagcccaagcatgtgttgaagctaacagagaccccatagtaaaaatcctgggctctgattataatacaatgaaagaaaactcaattgcattaaatattcttggcaaaattaccagagatgatgatcctgaaagtgaaattaagatgaagattgctatgctgcttaagcaattggatctgcacctcctcaatcattctctaaaacatatttcattagaaataagtttaagtcccatgacggtgaagaaggatatagaactgctcaaacgtttctcaggaaaaggaaaccaaacagtcttggaatctattgaatatacctcagattatgaattttcaaatggatgtcgagccccaccgtggagacaaattcgtggggaaatttgttatgtgctggtgaaacctcacgatggtgagactctgtgcattacttgcagtgcaggaggagtatttttaaatggtggcaaaacagatgatgaaggggacgttaattatgagagaaaaggttcaatttataaaaaccttgtcacatttttaagagaaaaatcaccaaaattttcagaaaatatgtctaaattgggaattagcttcagtgaagaccagcaaaaggaaaaggatcagcttggcaaagcccccaagaaggaagaagcagctgccctccgcaaagacatttctggttcagacaaaaggtcactggagaagaaccaaattaatttttggaggaatcaaatgaccaagagatgggaaccaagcttaaactggaagaccactgttaattacaaaggcaaaggctcagcaaaagaaatccaagaggacaaacacacaggaaaacttgaaaaaccaagaccatctgtttcacacggaagagcacaattacttcggaagagtgctgaaaagattgaggaaactgttagcgatagctcctcagaaagtgaggaagatgaagaaccacctgaccatcgtcaggaagcaagtgcagatttgccatcagaatattggcaaattcagaagctggtgaaatatttaaagggaggaaatcaaacagctacagtgattgcgttgtgttcaatgagggatttcagcttagctcaagaaacctgccagttggccatcagagatgttggaggcctggaagtgctgataaatttgcttgaaaccgatgaagtcaaatgtaagattggttcattaaaaatactgaaggaaatcagtcataatcctcaaatcagacagaatattgttgaccttgggggcttaccaattatggtgaatatacttgattctccacacaagagtctaaaatgtttggcagccgagactatcgcgaatgttgccaagtttaaaagagcacggcgggtggtgaggcagcacgggggtatcaccaaactggttgctctactagactgtgcacatgattccacaaaacctgcccaatcgagtctgtatgaggccagagacgtggaagtggctcgctgtggggcactggccctgtggagctgcagtaagagtcatacgaataaagaagccatccgcaaagctgggggcattcctctgttggctcggctgctgaagacttctcatgaaaacatgctaattccagtggtggggacattgcaagagtgtgcatcagaggaaaactaccgggctgcaatcaaagcagaaaggatcattgaaaaccttgtcaagaacctaaatagtgagaatgagcagctgcaggagcactgcgccatggccatttaccagtgtgctgaagataaggaaacccgggacctcgttaggctgcacggaggacttaagcccttggccagtctactcaataacactgacaataaagagcggttagctgctgtcacaggggctatatggaaatgttccatcagcaaagagaatgttaccaagtttcgggaatacaaagccattgaaaccttggtgggacttctaacagatcagcctgaagaagtacttgtgaatgtggttggggccttgggagaatgctgccaagaacgtgaaaaccgagtcattgtccggaaatgtggtggcattcaaccacttgtgaacctccttgttggaataaaccaagctcttcttgtgaatgttacaaaagcagttggtgcttgtgcagtagaacctgaaagtatgatgataattgatcgcttagatggagttcgtttgttgtggtccctgctgaaaaatcctcacccagacgtgaaggccagcgcagcatgggcactctgtccatgcatcaaaaatgcaaaggatgctggggaaatggttcgttcctttgttggtggtttggaacttattgtcaatttactgaaatcagataacaaagaagttctggcaagtgtatgtgctgccattaccaacatagcaaaagatcaagaaaatttagctgttatcacagatcatggagttgttcctttattgtccaaactggcaaatacaaataacaataaattgagacatcatctagcagaagctatttcacgttgctgtatgtggggcaggaatagagtggccttcggtgagcacaaagcagtggctccactagtgcgttatctgaaatcaaatgacaccaacgtgcatcgggcgacagctcaggccttgtaccaactctcagaagacgccgataactgcatcaccatgcatgagaatggtgcagtaaagcttctactggatatggttgggtcccctgaccaggatctccaggaagctgcagctggttgtatatccaatatccgcaggctggctcttgctacagagaaggcaagatacacttgaaatttaaatggacattacaagctatcaaattctacatgacacaggacatgtcactcccatggccagaaagcctaaattgggaaacagttgttagcaaaccctttcaaccatctaaatgaaaacacacaaattgaaaatgcacagaatgtttttcatctgaaaattgcatggagacttttgtttctatttaatgttttcgagatatgacatgtgataagatggaaagccaataaacctgtgataagtttctaagaatatgagaatatacgtatatgatgtatttttagttcagtgatgcttttgtatttgtggcgattttaataaaaaggatatggccttcccaa
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.