GGRNA Home | Help | Advanced search

2019-03-23 03:26:11, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018040               2336 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens G patch domain containing 2 (GPATCH2), mRNA.
ACCESSION   NM_018040
VERSION     NM_018040.2  GI:142353610
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2336)
  AUTHORS   Fox,C.S., Liu,Y., White,C.C., Feitosa,M., Smith,A.V.,
            Heard-Costa,N., Lohman,K., Johnson,A.D., Foster,M.C.,
            Greenawalt,D.M., Griffin,P., Ding,J., Newman,A.B., Tylavsky,F.,
            Miljkovic,I., Kritchevsky,S.B., Launer,L., Garcia,M.,
            Eiriksdottir,G., Carr,J.J., Gudnason,V., Harris,T.B., Cupples,L.A.
            and Borecki,I.B.
  CONSRTM   GIANT Consortium; MAGIC Consortium; GLGC Consortium
  TITLE     Genome-wide association for abdominal subcutaneous and visceral
            adipose reveals a novel locus for visceral fat in women
  JOURNAL   PLoS Genet. 8 (5), E1002695 (2012)
   PUBMED   22589738
REFERENCE   2  (bases 1 to 2336)
  AUTHORS   Murea,M., Lu,L., Ma,L., Hicks,P.J., Divers,J., McDonough,C.W.,
            Langefeld,C.D., Bowden,D.W. and Freedman,B.I.
  TITLE     Genome-wide association scan for survival on dialysis in
            African-Americans with type 2 diabetes
  JOURNAL   Am. J. Nephrol. 33 (6), 502-509 (2011)
   PUBMED   21546767
REFERENCE   3  (bases 1 to 2336)
  AUTHORS   Lin,M.L., Fukukawa,C., Park,J.H., Naito,K., Kijima,K., Shimo,A.,
            Ajiro,M., Nishidate,T., Nakamura,Y. and Katagiri,T.
  TITLE     Involvement of G-patch domain containing 2 overexpression in breast
            carcinogenesis
  JOURNAL   Cancer Sci. 100 (8), 1443-1450 (2009)
   PUBMED   19432882
  REMARK    GeneRIF: Involvement of GPATCH2 overexpression in breast
            carcinogensis is reported.
REFERENCE   4  (bases 1 to 2336)
  AUTHORS   Hendrickx,A., Beullens,M., Ceulemans,H., Den Abt,T., Van Eynde,A.,
            Nicolaescu,E., Lesage,B. and Bollen,M.
  TITLE     Docking motif-guided mapping of the interactome of protein
            phosphatase-1
  JOURNAL   Chem. Biol. 16 (4), 365-371 (2009)
   PUBMED   19389623
REFERENCE   5  (bases 1 to 2336)
  AUTHORS   Nishidate,T., Katagiri,T., Lin,M.L., Mano,Y., Miki,Y., Kasumi,F.,
            Yoshimoto,M., Tsunoda,T., Hirata,K. and Nakamura,Y.
  TITLE     Genome-wide gene-expression profiles of breast-cancer cells
            purified with laser microbeam microdissection: identification of
            genes associated with progression and metastasis
  JOURNAL   Int. J. Oncol. 25 (4), 797-819 (2004)
   PUBMED   15375528
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AK001114.1.
            On Apr 6, 2007 this sequence version replaced gi:8922312.
            
            Sequence Note: removed 2 bases from the 5' end that did not align
            to the reference genome assembly.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK001114.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2336              AK001114.1         3-2338
FEATURES             Location/Qualifiers
     source          1..2336
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q41"
     gene            1..2336
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /note="G patch domain containing 2"
                     /db_xref="GeneID:55105"
                     /db_xref="HGNC:25499"
                     /db_xref="HPRD:07657"
     exon            1..152
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    64..66
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /note="upstream in-frame stop codon"
     variation       85
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944730"
     CDS             97..1683
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /note="cancer/testis antigen 110; protein phosphatase 1,
                     regulatory subunit 30"
                     /codon_start=1
                     /product="G patch domain-containing protein 2"
                     /protein_id="NP_060510.1"
                     /db_xref="GI:8922313"
                     /db_xref="CCDS:CCDS1518.1"
                     /db_xref="GeneID:55105"
                     /db_xref="HGNC:25499"
                     /db_xref="HPRD:07657"
                     /translation="
MFGAAGRQPIGAPAAGNSWHFSRTMEELVHDLVSALEESSEQARGGFAETGDHSRSISCPLKRQARKRRGRKRRSYNVHHPWETGHCLSEGSDSSLEEPSKDYRENHNNNKKDHSDSDDQMLVAKRRPSSNLNNNVRGKRPLWHESDFAVDNVGNRTLRRRRKVKRMAVDLPQDISNKRTMTQPPEGCRDQDMDSDRAYQYQEFTKNKVKKRKLKIIRQGPKIQDEGVVLESEETNQTNKDKMECEEQKVSDELMSESDSSSLSSTDAGLFTNDEGRQGDDEQSDWFYEKESGGACGITGVVPWWEKEDPTELDKNVPDPVFESILTGSFPLMSHPSRRGFQARLSRLHGMSSKNIKKSGGTPTSMVPIPGPVGNKRMVHFSPDSHHHDHWFSPGARTEHDQHQLLRDNRAERGHKKNCSVRTASRQTSMHLGSLCTGDIKRRRKAAPLPGPTTAGFVGENAQPILENNIGNRMLQNMGWTPGSGLGRDGKGISEPIQAMQRPKGLGLGFPLPKSTSATTTPNAGKSA
"
     misc_feature    439..441
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NW75.1); phosphorylation site"
     misc_feature    439..441
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    445..447
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NW75.1); phosphorylation site"
     misc_feature    445..447
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    679..681
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9NW75.1); phosphorylation site"
     misc_feature    1495..1629
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /note="G-patch domain; Region: G-patch; pfam01585"
                     /db_xref="CDD:144978"
     exon            153..869
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     STS             231..361
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /standard_name="SHGC-76370"
                     /db_xref="UniSTS:76392"
     variation       276
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34839777"
     STS             454..576
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /standard_name="SHGC-76358"
                     /db_xref="UniSTS:33442"
     STS             456..690
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /standard_name="STS-AA026113"
                     /db_xref="UniSTS:53290"
     variation       731
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3210309"
     exon            870..931
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            932..1114
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1115..1194
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1195..1262
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1263..1302
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1303..1373
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1374..1462
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1407
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34341444"
     exon            1463..2336
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1516
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35737297"
     variation       1678
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34576349"
     STS             2024..2159
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /standard_name="RH103365"
                     /db_xref="UniSTS:97694"
     STS             2071..2204
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /standard_name="SHGC-76374"
                     /db_xref="UniSTS:18632"
     variation       2323
                     /gene="GPATCH2"
                     /gene_synonym="CT110; GPATC2; PPP1R30; RP11-361K17.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048126"
ORIGIN      
aaaatgctgaactgctctttggaagtcgccggtgctgttgtagttggagtctgttcacgggcctgagcttcgaggccaggctcccgggtgtcgttaatgttcggggccgccgggcgccaaccgatcggagctccagcagccgggaacagctggcatttcagtagaaccatggaggagctggttcatgaccttgtctcagcattggaagagagctcagagcaagctcgaggtggatttgctgaaacaggagaccattctcgaagtatatcttgccctctgaaacgccaggcaaggaaaaggagagggagaaaacggaggtcgtataatgtgcatcacccgtgggagactggtcactgcttaagtgaaggctctgattctagtttagaagaaccaagcaaggactatagagagaatcacaataataataaaaaagatcacagtgactctgatgaccaaatgttagtagcaaagcgcaggccgtcatcaaacttaaataataatgttcgagggaaaagacctctatggcatgagtctgattttgctgtggacaatgttgggaatagaactctgcgcaggaggagaaaggtaaaacgcatggcagtagatctcccacaggacatctctaacaaacggacaatgacccagccacctgagggttgtagagatcaggacatggacagtgatagagcctaccagtatcaagaatttaccaagaacaaagtcaaaaaaagaaagttgaaaataatcagacaaggaccaaaaatccaagatgaaggagtagttttagaaagtgaggaaacgaaccagaccaataaggacaaaatggaatgtgaagagcaaaaagtctcagatgagctcatgagtgaaagtgattccagcagtctcagcagcactgatgctggattgtttaccaatgatgagggaagacaaggtgatgatgaacagagtgactggttctacgaaaaggaatcaggtggagcatgtggtatcactggagttgtgccctggtgggaaaaggaagatcctactgagctagacaaaaatgtaccagatcctgtctttgaaagtatcttaactggttcttttccccttatgtcacacccaagcagaagaggtttccaagctagactcagtcgccttcatggaatgtcttcaaagaatattaaaaaatctggagggactccaacttcaatggtacccattcctggcccagtgggtaacaagagaatggttcatttttccccggattctcatcaccatgaccattggtttagccctggggctaggacagagcatgaccagcatcagcttctgagagataatcgagctgaaagaggacacaagaaaaattgttctgtgagaacagccagcaggcaaacaagcatgcatttaggatccttatgcacgggagatatcaaacggagaagaaaagctgcacctttgcctggacctactactgcaggatttgtaggtgaaaatgcccagccaatcctagaaaataatattggaaaccgaatgcttcagaatatgggctggacgcctgggtcaggccttggacgagatggcaaggggatctctgagccaattcaagccatgcagaggccaaagggattaggacttggatttcctctaccaaaaagtacttccgcaactactacccccaatgcaggaaaatccgcctaagaaaagcaaagaagaaatgttttacagactttattcactatgtcccattgttctaaaatgataacatgacttctgtttttgaagcaaaaatctacattgcctcaaacacatcactctagcttccttactgcatacagtcctgccatagtgagagaaatgggatttcatcacaattcatggtgctaaaatgaaaacctctgcactttaatttttttcagtaatttccagctatttctaggtataaagagcagctcgtttctcttatttattttagtctcatgtgtcaatactttccgatgctttgcttaattcatgtatgtgtgcagtgctgcaatgcccagacaaacgtgagcacacccaccagtttctaaaatggaatagacaggaaaagattgtgttttatatcatccctatctattgtaacccaaaagacctaccatcgcatcagtgaagtccgaacacatctttgtttgaaaggcttgtcaatttcatattccttgaattggcttcttggtgaggattttctgacagagtgatacccatcaattttctatccttagacaatgtagtgtgaagttcacagttgacaaacaacaattaatgtttcccttggatgttttgacaaaaataaacctcatcgttgttatcaccag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:55105 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:55105 -> Biological process: GO:0010923 [negative regulation of phosphatase activity] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.