Home |
Help |
Advanced search
2024-04-20 01:34:04, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_017542 3852 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens pogo transposable element with KRAB domain (POGK),
mRNA.
ACCESSION NM_017542
VERSION NM_017542.3 GI:22027479
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3852)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 2 (bases 1 to 3852)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 3852)
AUTHORS Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
TITLE A probability-based approach for high-throughput protein
phosphorylation analysis and site localization
JOURNAL Nat. Biotechnol. 24 (10), 1285-1292 (2006)
PUBMED 16964243
REFERENCE 4 (bases 1 to 3852)
AUTHORS Greenhalf,W., Lee,J. and Chaudhuri,B.
TITLE A selection system for human apoptosis inhibitors using yeast
JOURNAL Yeast 15 (13), 1307-1321 (1999)
PUBMED 10509013
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff in
collaboration with Hugh Robertson. The reference sequence was
derived from AB040946.1.
On Jul 31, 2002 this sequence version replaced gi:21314687.
Summary: The exact function of the protein encoded by this gene is
not known. However, this gene product contains a KRAB domain (which
is involved in protein-protein interactions) at the N-terminus, and
a transposase domain at the C-terminus, suggesting that it may
belong to the family of DNA-mediated transposons in human.
[provided by RefSeq, Jul 2008].
##Evidence-Data-START##
Transcript exon combination :: AK056711.1, BC131624.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025083 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..3852
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q24.1"
gene 1..3852
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="pogo transposable element with KRAB domain"
/db_xref="GeneID:57645"
/db_xref="HGNC:18800"
/db_xref="HPRD:17872"
exon 1..118
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
variation 86
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:12749440"
exon 119..252
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
CDS 121..1950
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="KRAB box domain containing 2"
/codon_start=1
/product="pogo transposable element with KRAB domain"
/protein_id="NP_060012.3"
/db_xref="GI:22027480"
/db_xref="CCDS:CCDS1254.1"
/db_xref="GeneID:57645"
/db_xref="HGNC:18800"
/db_xref="HPRD:17872"
/translation="
MESTAYPLNLSLKEEEEEEEIQSRELEDGPADMQKVRICSEGGWVPALFDEVAIYFSDEEWEVLTEQQKALYREVMRMNYETVLSLEFPFPKPDMITRLEGEEESQNSDEWQLQGGTSAENEESDVKPPDWPNPMNATSQFPQPQHFDSFGLRLPRDITELPEWSEGYPFYMAMGFPGYDLSADDIAGKFQFSRGMRRSYDAGFKLMVVEYAESTNNCQAAKQFGVLEKNVRDWRKVKPQLQNAHAMRRAFRGPKNGRFALVDQRVAEYVRYMQAKGDPITREAMQLKALEIAQEMNIPEKGFKASLGWCRRMMRRYDLSLRHKVPVPQHLPEDLTEKLVTYQRSVLALRRAHDYEVAQMGNADETPICLEVPSRVTVDNQGEKPVLVKTPGREKLKITAMLGVLADGRKLPPYIILRGTYIPPGKFPSGMEIRCHRYGWMTEDLMQDWLEVVWRRRTGAVPKQRGMLILNGFRGHATDSVKNSMESMNTDMVIIPGGLTSQLQVLDVVVYKPLNDSVRAQYSNWLLAGNLALSPTGNAKKPPLGLFLEWVMVAWNSISSESIVQGFKKCHISSNLEEEDDVLWEIESELPGGGEPPKDCDTESMAESN
"
misc_feature 265..441
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="krueppel associated box; Region: KRAB; smart00349"
/db_xref="CDD:197671"
misc_feature 265..378
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="KRAB (Kruppel-associated box) domain -A box;
Region: KRAB_A-box; cd07765"
/db_xref="CDD:143639"
misc_feature 703..861
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="Brinker DNA-binding domain; Region: BrkDBD;
pfam09607"
/db_xref="CDD:150315"
misc_feature 886..1089
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="Putative DNA-binding domain in centromere protein
B, mouse jerky and transposases; Region: CENPB;
smart00674"
/db_xref="CDD:197828"
misc_feature 1183..1821
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/note="DDE superfamily endonuclease; Region: DDE_1;
pfam03184"
/db_xref="CDD:190555"
variation 133
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="g"
/replace="t"
/db_xref="dbSNP:138741349"
variation 191
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:141874882"
variation 205
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:140313785"
exon 253..379
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
variation 289
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="g"
/replace="t"
/db_xref="dbSNP:191567727"
variation 292
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:138034118"
variation 294
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:376091366"
variation 301..302
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="g"
/db_xref="dbSNP:35310954"
variation 324
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:199934831"
variation 338
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:144284216"
variation 378
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="g"
/replace="t"
/db_xref="dbSNP:370908805"
exon 380..478
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
variation 387
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:147461120"
variation 462
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:140159043"
exon 479..1964
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
variation 495
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:147708165"
variation 496
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:77068976"
variation 531
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:200681234"
variation 577
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:202168363"
variation 593
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:144587246"
variation 607
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:140373616"
variation 614
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="g"
/db_xref="dbSNP:143520580"
variation 647
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:375997972"
variation 654
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:111752271"
variation 667
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="g"
/db_xref="dbSNP:61744366"
variation 681..682
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="g"
/db_xref="dbSNP:34864748"
variation 717
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:112544772"
variation 722
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:113329811"
variation 723
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:201306097"
variation 726
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:77682365"
variation 756
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:139118899"
variation 799
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:147324383"
variation 831
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:202109752"
variation 849
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:148807160"
variation 870
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:2075946"
variation 875
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:371202482"
variation 981
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:201461323"
variation 984
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:146707597"
variation 990
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:61745126"
variation 1035
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:41269682"
variation 1056
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:371192826"
variation 1086
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:374953651"
variation 1116
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:369140999"
variation 1138
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="g"
/replace="t"
/db_xref="dbSNP:148246779"
variation 1143
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="t"
/db_xref="dbSNP:143063474"
variation 1152
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:181432813"
variation 1176
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:143821995"
variation 1221
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:368692431"
variation 1256
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:139961044"
variation 1281
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:144764917"
variation 1407
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="t"
/db_xref="dbSNP:148557556"
variation 1419
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:202027505"
variation 1487
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:201172506"
variation 1499
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:146206610"
variation 1561
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:201142996"
variation 1644
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:369557832"
variation 1653
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:150936983"
variation 1678
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:150960796"
variation 1691
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:368130868"
variation 1728
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:372380432"
variation 1758
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:374355761"
variation 1779
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:140857816"
variation 1782
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:368794112"
variation 1878
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:145664155"
variation 1881
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:138362264"
variation 1889
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:142458414"
exon 1965..3852
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/inference="alignment:Splign:1.39.8"
variation 1990..1991
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="g"
/db_xref="dbSNP:34884440"
variation 2088
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:2232524"
variation 2196
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:187323246"
variation 2292..2293
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="g"
/db_xref="dbSNP:34900412"
variation 2326
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:10918585"
variation 2357
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:116344758"
variation 2485
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:2232525"
variation 2529
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:41269686"
variation 2554
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:41269688"
variation 2709
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:2232526"
variation 2802
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:139371750"
variation 2830
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:149459152"
STS 2848..3709
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/standard_name="POGK__5743"
/db_xref="UniSTS:463813"
variation 2939..2940
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="t"
/db_xref="dbSNP:35343311"
variation 2965
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:143897487"
variation 3072..3073
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="a"
/db_xref="dbSNP:3830715"
variation 3124
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:59838524"
variation 3192
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:190241404"
variation 3201..3202
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace=""
/replace="a"
/db_xref="dbSNP:151200534"
variation 3267
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:142127812"
variation 3297
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:183083267"
variation 3360
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="t"
/db_xref="dbSNP:115498690"
variation 3443
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="g"
/replace="t"
/db_xref="dbSNP:187636380"
variation 3444
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:192602444"
variation 3473
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:185630869"
variation 3594
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="g"
/db_xref="dbSNP:73022899"
variation 3613
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:370114562"
variation 3657
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:187648513"
STS 3670..3829
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/standard_name="D1S1807E"
/db_xref="UniSTS:15490"
variation 3700
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:147789881"
STS 3722..3836
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/standard_name="RH64540"
/db_xref="UniSTS:86531"
variation 3791
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="c"
/replace="t"
/db_xref="dbSNP:369405945"
polyA_signal 3828..3833
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
variation 3847
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="g"
/db_xref="dbSNP:3177230"
variation 3849
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/replace="a"
/replace="c"
/db_xref="dbSNP:3177231"
polyA_site 3852
/gene="POGK"
/gene_synonym="BASS2; KRBOX2; LST003"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
cgctccctcccgaggggccgcgcgcacgggaggacggagaggcggaaaggatggcgctgtgacagccgggccggagccctcgcgtccccaccccgcgccctggccgctgggcccggcgagatggagtccacagcctaccctctcaatttgagcctgaaagaagaggaagaggaagaagagattcagagccgggaactagaggacggcccggcagacatgcagaaagtacgaatctgctctgagggcggatgggtaccggccctatttgatgaggtggccatatatttttccgatgaggaatgggaagttttgacggagcaacaaaaggccctctaccgggaagtcatgaggatgaattatgaaactgtcctgtccctggaattcccattccctaagccagacatgatcacccgtttggaaggggaggaggagtctcagaattctgacgagtggcagctccaaggaggcacctctgcagaaaatgaagaatctgacgtaaagcctccagactggccaaacccaatgaatgctacctcccagtttcctcagcctcagcactttgacagctttggcctccgtctgcctcgggatatcacagagctgcccgagtggagtgaggggtaccccttctacatggccatgggcttcccagggtatgacctctcggctgatgacatagctgggaagtttcagttcagccggggcatgcgccgcagttacgacgcagggttcaagctgatggtagtggaatatgctgagagtaccaacaactgccaggctgccaagcagtttggagtattggaaaaaaacgttcgagactggcgcaaagtgaagccacagcttcaaaacgcccacgccatgcggcgggcattccgaggccccaagaatgggaggtttgctctggtggaccagcgtgtggccgaatatgtcagatacatgcaggccaaaggggaccccatcacccgggaggcgatgcagctgaaagctctcgaaatcgcccaggaaatgaacattccagagaaagggttcaaggcaagcttgggttggtgtcgaagaatgatgagaaggtatgacctgtctctgaggcataaagtgcccgtgccccagcacctgccggaagacctgactgagaaactcgtcacttaccagcgcagtgtcctggctctgcgcagggcgcatgactatgaggtagctcagatggggaatgcagatgagacgcccatttgtttagaggtgccatcacgggtaactgttgataaccagggcgaaaagcctgtcttggtcaagacaccaggcagggaaaaactgaaaatcacagcaatgcttggtgtcttggctgatgggaggaagttaccaccgtacatcattttgaggggaacatatatccccccggggaagtttcccagtgggatggaaattcgctgccaccggtatgggtggatgactgaagacttgatgcaggactggttggaagtggtgtggagacggaggacaggagcagtgcccaagcagcgagggatgctgatcttgaatggcttccggggccatgccacagattccgtgaagaactccatggaaagcatgaacactgacatggtgatcatcccagggggtctgacctcacagcttcaggtgctggatgtcgtggtctacaagccactgaatgacagtgtgcgggcccagtactccaactggcttctggctgggaacctggcgctgagcccaaccgggaatgctaagaagccacccctgggcctctttctggagtgggtcatggtcgcgtggaatagcatctcaagtgagtccatcgtccaagggttcaagaagtgccatatctccagcaacttggaggaggaagacgatgtcctgtgggaaatcgagagtgagttgccaggaggaggagaaccaccaaaagattgtgacaccgaaagcatggctgagagcaactgaagggaaagggaaagcaaatggaactctgatttaaacagctggggatgaaattcctcaagatgattattcctgaaagtgtggatgcgctggatgcgcagggaacatcaggaaaaggccacggggctctgaacagccccggtccagacagcagcctgtacatccatcccaggacacagcccagcccctccccacaccatacaaggtatcagaaaagtctaggacctatcatttcatcagagacatgatcagaaaagaaactgcttctgccccatttcttgttttggagattactccatctgtccatcaaaagaaacctgtaaatatgaaagaacaaaggttatttcctggagaaaagacaatttattcaacaccaacgagggactcatcatatgggcacaactctggtgtccttctatggagaaaacctcaagtaaagttttattctgcctttgaaaatgcttccaaaagtagaccctgtccccacacaggtcaagactacagagaaggctttgtagaaatgtgtcacctatgtacacctgctacttacacatttcctcttttggaaaaatgagatacttagaataacaagaaaattaagacatactggcctggtgccagcagatggcttttctatagacaaactaggttagtgtggaagatataggttaaaataaactatgctgttttatttatcttcccaacctgattggcagctagacttttttagggtctcatttaatggccctgtttttttcattattatatttaatgatagggcaggatttcgtatgcaagctcttgtttctcaggctgcctgcagaagaagtcgctataaattatctgttgtctacatggtacaaggcccattgactcatctgatgcttgttttgttaatttctttaatatttttatcacggggcagtgggagggcttgggcttttagccacagctgttttaagacttctgatctcctgccctgcaggaataggtgggaagtcattgaatttttacactatagtaatttgcattcccacataagtttgagtgttacgaaaacattcctttaaagggatctgtgctacacaaaatatgccaggacctcacagacaaagccattgctagaaatgtcattccaatgatcagatctggaaacaggctgccataaccacttttccttcttgtagactcagctcacctgtatatttaaactgttcttggcatcttgaaacacctatttctactcaggtactcattgtcctgttactgattcacctttctgatccttttcaaccagttttcccccaaggggggaaattttacttaacctctagtatttgaacaactcaatatttgaattgttgccccatttgcttttacctgtactgtattcttggtcatctcaaatggcgtctaaacccagctactttgcattccagaagtttccattccctccaattccacctaatttttcatctgtcctagttactggctctttcttcatgtcttatttctcttgctttgggagcttaaaagattttacaagacctaattttgggttccttccttggagccatagttaccctgccaagaagagtagaaaatgggttcaactcctgtttcgctccaccaacacctctgtgagtctcatcatcagctgagcgatgatgccttacaggttgcatagcactggaactttcctagagtaacggctctgctgccagggtttctctgggctcattcttccactgacttaattatgatctatgcctaacagagccccagtacaactattttgcagaatggctgttaccctagaattactatagcacatattgagatatagttgtactccctagtagataggaactgaccccaacaataaactttgataataaagacaat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:57645 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:57645 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:57645 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:57645 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
GeneID:57645 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.