GGRNA Home | Help | Advanced search

2019-03-23 03:30:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_017449               4866 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens EPH receptor B2 (EPHB2), transcript variant 1, mRNA.
ACCESSION   NM_017449
VERSION     NM_017449.3  GI:111118977
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4866)
  AUTHORS   Wang,S.D., Rath,P., Lal,B., Richard,J.P., Li,Y., Goodwin,C.R.,
            Laterra,J. and Xia,S.
  TITLE     EphB2 receptor controls proliferation/migration dichotomy of
            glioblastoma by interacting with focal adhesion kinase
  JOURNAL   Oncogene 31 (50), 5132-5143 (2012)
   PUBMED   22310282
  REMARK    GeneRIF: EphB2 silencing increased tumor cell proliferation.
REFERENCE   2  (bases 1 to 4866)
  AUTHORS   Sikkema,A.H., den Dunnen,W.F., Hulleman,E., van Vuurden,D.G.,
            Garcia-Manero,G., Yang,H., Scherpen,F.J., Kampen,K.R., Hoving,E.W.,
            Kamps,W.A., Diks,S.H., Peppelenbosch,M.P. and de Bont,E.S.
  TITLE     EphB2 activity plays a pivotal role in pediatric medulloblastoma
            cell adhesion and invasion
  JOURNAL   Neuro-oncology 14 (9), 1125-1135 (2012)
   PUBMED   22723427
  REMARK    GeneRIF: High ephrin-B1 expression is associated with
            medulloblastoma.
REFERENCE   3  (bases 1 to 4866)
  AUTHORS   Tu,Y., He,S., Fu,J., Li,G., Xu,R., Lu,H. and Deng,J.
  TITLE     Expression of EphrinB2 and EphB4 in glioma tissues correlated to
            the progression of glioma and the prognosis of glioblastoma
            patients
  JOURNAL   Clin Transl Oncol 14 (3), 214-220 (2012)
   PUBMED   22374425
  REMARK    GeneRIF: Data indicated for the first time that EphrinB2 and EphB4
            expressions increase according to the histopathological grade and
            KPS score of glioma, and their expression levels are related to the
            progression-free survival of glioblastoma patients.
REFERENCE   4  (bases 1 to 4866)
  AUTHORS   Azab,F., Azab,A.K., Maiso,P., Calimeri,T., Flores,L., Liu,Y.,
            Quang,P., Roccaro,A.M., Sacco,A., Ngo,H.T., Zhang,Y., Morgan,B.L.,
            Carrasco,R.D. and Ghobrial,I.M.
  TITLE     Eph-B2/ephrin-B2 interaction plays a major role in the adhesion and
            proliferation of Waldenstrom's macroglobulinemia
  JOURNAL   Clin. Cancer Res. 18 (1), 91-104 (2012)
   PUBMED   22010211
  REMARK    GeneRIF: High Eph-B2 is associated with Waldenstrom's
            macroglobulinemia.
REFERENCE   5  (bases 1 to 4866)
  AUTHORS   Benzinou,M., Clermont,F.F., Letteboer,T.G., Kim,J.H., Espejel,S.,
            Harradine,K.A., Arbelaez,J., Luu,M.T., Roy,R., Quigley,D.,
            Higgins,M.N., Zaid,M., Aouizerat,B.E., van Amstel,J.K., Giraud,S.,
            Dupuis-Girod,S., Lesca,G., Plauchu,H., Hughes,C.C., Westermann,C.J.
            and Akhurst,R.J.
  TITLE     Mouse and human strategies identify PTPN14 as a modifier of
            angiogenesis and hereditary haemorrhagic telangiectasia
  JOURNAL   Nat Commun 3, 616 (2012)
   PUBMED   22233626
  REMARK    GeneRIF: PTPN14 has a role in angiogenesis and/or arteriovenous
            fate, acting via EphrinB2 and ACVRL1/activin receptor-like kinase 1
            Erratum:[Nat Commun. 2012;3:1148]
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4866)
  AUTHORS   Saito,T., Seki,N., Matsuda,Y., Kitahara,M., Murata,M., Kanda,N.,
            Nomura,N., Yamamoto,T. and Hori,T.A.
  TITLE     Identification of the human ERK gene as a putative receptor
            tyrosine kinase and its chromosomal localization to 1p36.1: a
            comparative mapping of human, mouse, and rat chromosomes
  JOURNAL   Genomics 26 (2), 382-384 (1995)
   PUBMED   7601466
REFERENCE   7  (bases 1 to 4866)
  AUTHORS   Fox,G.M., Holst,P.L., Chute,H.T., Lindberg,R.A., Janssen,A.M.,
            Basu,R. and Welcher,A.A.
  TITLE     cDNA cloning and tissue distribution of five human EPH-like
            receptor protein-tyrosine kinases
  JOURNAL   Oncogene 10 (5), 897-905 (1995)
   PUBMED   7898931
REFERENCE   8  (bases 1 to 4866)
  AUTHORS   Bannister,A.J., Brown,H.J., Sutherland,J.A. and Kouzarides,T.
  TITLE     Phosphorylation of the c-Fos and c-Jun HOB1 motif stimulates its
            activation capacity
  JOURNAL   Nucleic Acids Res. 22 (24), 5173-5176 (1994)
   PUBMED   7816602
REFERENCE   9  (bases 1 to 4866)
  AUTHORS   Iwase,T., Tanaka,M., Suzuki,M., Naito,Y., Sugimura,H. and Kino,I.
  TITLE     Identification of protein-tyrosine kinase genes preferentially
            expressed in embryo stomach and gastric cancer
  JOURNAL   Biochem. Biophys. Res. Commun. 194 (2), 698-705 (1993)
   PUBMED   7688222
REFERENCE   10 (bases 1 to 4866)
  AUTHORS   Chan,J. and Watt,V.M.
  TITLE     eek and erk, new members of the eph subclass of receptor
            protein-tyrosine kinases
  JOURNAL   Oncogene 6 (6), 1057-1061 (1991)
   PUBMED   1648701
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL158086.32, AL512444.20,
            AL035704.9 and AF025304.1.
            On Aug 2, 2006 this sequence version replaced gi:56119210.
            
            Summary: Ephrin receptors and their ligands, the ephrins, mediate
            numerous developmental processes, particularly in the nervous
            system. Based on their structures and sequence relationships,
            ephrins are divided into the ephrin-A (EFNA) class, which are
            anchored to the membrane by a glycosylphosphatidylinositol linkage,
            and the ephrin-B (EFNB) class, which are transmembrane proteins.
            The Eph family of receptors are divided into 2 groups based on the
            similarity of their extracellular domain sequences and their
            affinities for binding ephrin-A and ephrin-B ligands. Ephrin
            receptors make up the largest subgroup of the receptor tyrosine
            kinase (RTK) family. The protein encoded by this gene is a receptor
            for ephrin-B family members. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) encodes the shorter isoform
            (1).
            
            CCDS Note: The coding region has been updated to represent an
            alternative 3' splice pattern, resulting in a shorter and distinct
            C-terminus that is better supported by available transcript and
            homology data.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB210018.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025086 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-206               AL158086.32        83555-83760
            207-271             AL512444.20        25897-25961
            272-956             AL512444.20        28868-29552
            957-1112            AL512444.20        107513-107668
            1113-1448           AL512444.20        109353-109688
            1449-1573           AL035704.9         2246-2370
            1574-1736           AF025304.1         1454-1616
            1737-1845           AL035704.9         15359-15467
            1846-1910           AL035704.9         16301-16365
            1911-2033           AL035704.9         25874-25996
            2034-2281           AL035704.9         26597-26844
            2282-2497           AL035704.9         27840-28055
            2498-2647           AL035704.9         28909-29058
            2648-2841           AL035704.9         30269-30462
            2842-2997           AL035704.9         32331-32486
            2998-4866           AL035704.9         33349-35217
FEATURES             Location/Qualifiers
     source          1..4866
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p36.1-p35"
     gene            1..4866
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="EPH receptor B2"
                     /db_xref="GeneID:2048"
                     /db_xref="HGNC:3393"
                     /db_xref="MIM:600997"
     exon            1..206
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     CDS             146..3106
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /EC_number="2.7.10.1"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; elk-related tyrosine kinase; ephrin type-B
                     receptor 2; protein-tyrosine kinase HEK5; eph tyrosine
                     kinase 3; EPH-like kinase 5; tyrosine-protein kinase
                     TYRO5; renal carcinoma antigen NY-REN-47; tyrosine-protein
                     kinase receptor EPH-3; developmentally-regulated
                     Eph-related tyrosine kinase"
                     /codon_start=1
                     /product="ephrin type-B receptor 2 isoform 1 precursor"
                     /protein_id="NP_059145.2"
                     /db_xref="GI:111118978"
                     /db_xref="CCDS:CCDS229.2"
                     /db_xref="GeneID:2048"
                     /db_xref="HGNC:3393"
                     /db_xref="MIM:600997"
                     /translation="
MALRRLGAALLLLPLLAAVEETLMDSTTATAELGWMVHPPSGWEEVSGYDENMNTIRTYQVCNVFESSQNNWLRTKFIRRRGAHRIHVEMKFSVRDCSSIPSVPGSCKETFNLYYYEADFDSATKTFPNWMENPWVKVDTIAADESFSQVDLGGRVMKINTEVRSFGPVSRSGFYLAFQDYGGCMSLIAVRVFYRKCPRIIQNGAIFQETLSGAESTSLVAARGSCIANAEEVDVPIKLYCNGDGEWLVPIGRCMCKAGFEAVENGTVCRGCPSGTFKANQGDEACTHCPINSRTTSEGATNCVCRNGYYRADLDPLDMPCTTIPSAPQAVISSVNETSLMLEWTPPRDSGGREDLVYNIICKSCGSGRGACTRCGDNVQYAPRQLGLTEPRIYISDLLAHTQYTFEIQAVNGVTDQSPFSPQFASVNITTNQAAPSAVSIMHQVSRTVDSITLSWSQPDQPNGVILDYELQYYEKELSEYNATAIKSPTNTVTVQGLKAGAIYVFQVRARTVAGYGRYSGKMYFQTMTEAEYQTSIQEKLPLIIGSSAAGLVFLIAVVVIAIVCNRRGFERADSEYTDKLQHYTSGHMTPGMKIYIDPFTYEDPNEAVREFAKEIDISCVKIEQVIGAGEFGEVCSGHLKLPGKREIFVAIKTLKSGYTEKQRRDFLSEASIMGQFDHPNVIHLEGVVTKSTPVMIITEFMENGSLDSFLRQNDGQFTVIQLVGMLRGIAAGMKYLADMNYVHRDLAARNILVNSNLVCKVSDFGLSRFLEDDTSDPTYTSALGGKIPIRWTAPEAIQYRKFTSASDVWSYGIVMWEVMSYGERPYWDMTNQDVINAIEQDYRLPPPMDCPSALHQLMLDCWQKDRNHRPKFGQIVNTLDKMIRNPNSLKAMAPLSSGINLPLLDRTIPDYTSFNTVDEWLEAIKMGQYKESFANAGFTSFDVVSQMMMEDILRVGVTLAGHQKKILNSIQVMRAQMNQIQSVEV
"
     sig_peptide     146..199
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     200..3103
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /product="ephrin type-B receptor 2 isoform 1"
     misc_feature    200..733
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Ligand Binding Domain of Ephrin type-B Receptor 2;
                     Region: EphR_LBD_B2; cd10477"
                     /db_xref="CDD:198445"
     misc_feature    order(227..235,239..241,275..286,290..292,302..304,
                     308..310,314..316,323..325,422..430,440..442,446..448,
                     584..586,590..613,617..622,695..697,701..703,707..709)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="ephrin binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:198445"
     misc_feature    938..1051
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="GCC2 and GCC3; Region: GCC2_GCC3; pfam07699"
                     /db_xref="CDD:148998"
     misc_feature    1118..1438
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(1118..1120,1343..1345,1388..1390)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(1391..1393,1397..1399,1403..1408)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    1451..1726
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(1451..1453,1643..1645,1688..1690)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(1691..1696,1700..1705)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    1775..1837
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P29323.5);
                     transmembrane region"
     misc_feature    1874..1876
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1895..1897
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1931..1933
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1949..1951
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:02997"
     misc_feature    1991..2797
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Catalytic domain of the Protein Tyrosine Kinases,
                     Class EphB Ephrin Receptors; Region: PTKc_EphR_B; cd05065"
                     /db_xref="CDD:173638"
     misc_feature    2006..2785
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Protein tyrosine kinase; Region: Pkinase_Tyr;
                     pfam07714"
                     /db_xref="CDD:203736"
     misc_feature    order(2024..2038,2048..2050,2096..2098,2102..2104,
                     2240..2245,2249..2251,2261..2263,2381..2383,2393..2398,
                     2402..2404,2435..2437,2498..2512,2537..2539,2639..2641)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="active site"
                     /db_xref="CDD:173638"
     misc_feature    order(2024..2032,2036..2038,2048..2050,2096..2098,
                     2102..2104,2240..2245,2249..2251,2261..2263,2396..2398,
                     2402..2404,2435..2437)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173638"
     misc_feature    2120..2122
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2351..2353
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2369..2371
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    order(2381..2383,2393..2395,2498..2512,2537..2539,
                     2639..2641)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173638"
     misc_feature    2432..2518
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173638"
     misc_feature    2468..2470
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:02997"
     misc_feature    2471..2473
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:02997"
     misc_feature    2483..2485
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2543..2545
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2873..3085
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="SAM domain of EPH-B2 subfamily of tyrosine kinase
                     receptors; Region: SAM_EPH-B2; cd09552"
                     /db_xref="CDD:188951"
     misc_feature    2873..3076
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="Sterile alpha motif; Region: SAM; smart00454"
                     /db_xref="CDD:197735"
     misc_feature    order(2879..2884,2888..2890,2954..2956,2972..2977,
                     2999..3001,3023..3034,3038..3043,3065..3067,3077..3079)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="homooligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:188951"
     misc_feature    order(2879..2881,2888..2890,2906..2908,2969..2971,
                     3053..3055,3062..3067)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="putative homodimer interface (head-to-head)
                     [polypeptide binding]; other site"
                     /db_xref="CDD:188951"
     misc_feature    order(2933..2935,3032..3034)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="putative phosphorylation site [posttranslational
                     modification]; other site"
                     /db_xref="CDD:188951"
     misc_feature    2933..2935
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    order(2981..2998,3005..3007,3059..3061,3068..3070,
                     3077..3082)
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /note="homodimer interface (tail-to-tail) [polypeptide
                     binding]; other site"
                     /db_xref="CDD:188951"
     exon            207..271
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       210
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201121087"
     variation       223
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144258519"
     variation       225
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372861666"
     variation       236
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141486320"
     variation       255
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113343034"
     exon            272..956
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       309
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202156735"
     variation       310
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201427890"
     variation       335
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72653677"
     variation       365
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372282301"
     variation       380
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139122679"
     variation       384
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181872637"
     variation       387
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368075671"
     variation       391
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146514629"
     variation       392
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201337795"
     variation       424
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371651342"
     variation       437
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200905937"
     variation       451
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375951467"
     variation       459
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113970284"
     variation       460
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369585313"
     variation       498
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200904787"
     variation       592
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372861886"
     variation       609
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185887197"
     variation       610
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145478829"
     variation       611
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376990288"
     variation       628
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144238498"
     variation       652
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199957897"
     variation       655
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61732489"
     variation       691
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377706540"
     variation       709
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373502541"
     variation       712
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150957873"
     variation       715
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147098147"
     variation       729
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370909083"
     variation       741
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201754821"
     variation       769
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141122680"
     variation       780
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202146067"
     variation       799
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149351655"
     variation       802
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371869"
     variation       817
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368738883"
     variation       831
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200990235"
     variation       835
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374426229"
     variation       853
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146009391"
     variation       891
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202178471"
     variation       895
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113102633"
     variation       898
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368639670"
     variation       902
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200565776"
     variation       932
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150803261"
     variation       938
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202059800"
     variation       947
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369702152"
     exon            957..1112
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       964
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372620832"
     variation       980
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35882952"
     variation       992
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142113032"
     variation       1026
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147727992"
     variation       1069
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12083517"
     variation       1075
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75882465"
     variation       1094
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150415344"
     exon            1113..1448
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1124
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200298851"
     variation       1126
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199559345"
     variation       1133
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142890560"
     variation       1190
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368529651"
     variation       1192
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370793503"
     variation       1226
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56180036"
     variation       1245
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199648689"
     variation       1251
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141626076"
     variation       1256
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200609603"
     variation       1273
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200412547"
     variation       1279
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147147271"
     variation       1288
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375578940"
     variation       1289
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368104279"
     variation       1306
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147798911"
     variation       1381
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139840326"
     variation       1385
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149014913"
     exon            1449..1573
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1456
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375004699"
     variation       1484
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199940448"
     variation       1490
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369350136"
     variation       1510
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200120268"
     variation       1522
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229872"
     variation       1533
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377028693"
     variation       1538
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371215652"
     variation       1566
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138869509"
     exon            1574..1736
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1574
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138075206"
     variation       1576
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200298496"
     variation       1595..1596
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace=""
                     /replace="cccccc"
                     /db_xref="dbSNP:138296617"
     variation       1595
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116848191"
     variation       1621
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370664820"
     variation       1628
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201691912"
     variation       1646
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373865135"
     variation       1648
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147223001"
     variation       1681
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142703174"
     variation       1687
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367743248"
     variation       1690
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:309472"
     variation       1693
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34273063"
     variation       1697
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369387828"
     exon            1737..1845
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1744
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370702549"
     variation       1793
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144480560"
     variation       1816
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141173528"
     variation       1829
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199607174"
     variation       1834
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35847739"
     exon            1846..1910
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1847
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200219468"
     variation       1849
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376417187"
     variation       1867
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56264796"
     variation       1869
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146071874"
     variation       1870
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200494586"
     variation       1878
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375717760"
     variation       1897
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200015506"
     variation       1903
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200099574"
     exon            1911..2033
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       1921
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:56108846"
     variation       1933
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142696573"
     variation       1963
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137975389"
     variation       1998
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200952273"
     variation       2002
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376597441"
     variation       2003
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149475426"
     variation       2026
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371734479"
     exon            2034..2281
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       2039
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112384431"
     variation       2041..2042
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35262576"
     variation       2042
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201626283"
     variation       2094
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142173175"
     variation       2101
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55927202"
     variation       2115
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202216139"
     variation       2116
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199972358"
     variation       2125
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375552698"
     variation       2177
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28936395"
     variation       2209
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369642059"
     variation       2210
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372886782"
     variation       2279
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375886598"
     variation       2280
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150002185"
     exon            2282..2497
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       2305
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201544391"
     variation       2309
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121912582"
     variation       2311
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370900320"
     variation       2332
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375579646"
     variation       2335
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375588609"
     variation       2336
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142161660"
     variation       2371
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149590849"
     variation       2404
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368213597"
     variation       2405
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201892962"
     variation       2410
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141476431"
     variation       2420
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201156841"
     variation       2434
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147014777"
     variation       2450
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367548936"
     variation       2464
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141632768"
     exon            2498..2647
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       2500
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376647308"
     variation       2501
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138551214"
     variation       2516
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369660719"
     variation       2529
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372696024"
     variation       2547
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376209284"
     variation       2554
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201751121"
     variation       2557
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370226176"
     variation       2560
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373295870"
     variation       2570
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376515026"
     STS             2585..2794
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /standard_name="MARC_17495-17496:1030378704:1"
                     /db_xref="UniSTS:268320"
     exon            2648..2841
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       2673
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140172215"
     variation       2675
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55826626"
     variation       2688
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376945636"
     variation       2755
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199695952"
     variation       2762
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201327859"
     variation       2769
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143865228"
     variation       2770
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55993650"
     variation       2782
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142464595"
     variation       2785
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147815673"
     variation       2792
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372653137"
     variation       2803
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199868010"
     exon            2842..2997
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       2854
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201578620"
     variation       2868
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370710705"
     variation       2896
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138093963"
     variation       2902
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375575103"
     variation       2905
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368101425"
     variation       2912
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054792"
     variation       2916
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:66534620"
     variation       2920
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149030035"
     variation       2927
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141672966"
     variation       2947
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138938253"
     variation       2956
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201185822"
     variation       2975
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78707665"
     exon            2998..4866
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /inference="alignment:Splign:1.39.8"
     variation       3009
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200208409"
     variation       3061
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369377482"
     variation       3068
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372681830"
     variation       3069
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142146570"
     STS             3121..3236
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /standard_name="GDB:593997"
                     /db_xref="UniSTS:157983"
     variation       3121
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202088860"
     variation       3127
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2229871"
     variation       3155
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373982551"
     variation       3157
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140655693"
     variation       3166
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371418612"
     STS             3173..3268
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /standard_name="D1S3214"
                     /db_xref="UniSTS:39105"
     variation       3177
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111422315"
     variation       3206
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368971406"
     variation       3251
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375096051"
     variation       3284
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377206396"
     variation       3287
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188399389"
     variation       3293
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76826147"
     variation       3297
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:56871920"
     variation       3319
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377584109"
     variation       3336
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369027672"
     variation       3383
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:180810246"
     variation       3390
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372635662"
     variation       3430
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185077182"
     STS             3488..3632
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /standard_name="GDB:636068"
                     /db_xref="UniSTS:158519"
     variation       3506
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79966863"
     variation       3731
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189454653"
     variation       3867
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138319537"
     variation       3883
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77863597"
     variation       3908
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149199458"
     variation       3980
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368495544"
     variation       4020
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181945619"
     polyA_site      4127
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
     variation       4155
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187028066"
     variation       4180
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370791639"
     polyA_site      4209
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
     variation       4236
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41266949"
     variation       4357
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146762731"
     variation       4364
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139185835"
     variation       4382
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143121637"
     variation       4504
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191464781"
     variation       4595
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147471914"
     variation       4644
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295022"
     variation       4645
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181505314"
     variation       4663
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2675498"
     variation       4711
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113699887"
     variation       4767
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77096904"
     variation       4811
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185396266"
     polyA_signal    4842..4847
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
     variation       4848
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189865592"
     polyA_site      4866
                     /gene="EPHB2"
                     /gene_synonym="CAPB; DRT; EK5; EPHT3; ERK; Hek5; PCBC;
                     Tyro5"
ORIGIN      
cattctgctggctgcgcggtggcggcggctgtgtgtgcgccgcgccttgccgccccccctggccccccgagcccggggcgcgcgctcccgcccgggccgtccgggccccgcggcgccgcggcccgaggccccgggaagcgcagccatggctctgcggaggctgggggccgcgctgctgctgctgccgctgctcgccgccgtggaagaaacgctaatggactccactacagcgactgctgagctgggctggatggtgcatcctccatcagggtgggaagaggtgagtggctacgatgagaacatgaacacgatccgcacgtaccaggtgtgcaacgtgtttgagtcaagccagaacaactggctacggaccaagtttatccggcgccgtggcgcccaccgcatccacgtggagatgaagttttcggtgcgtgactgcagcagcatccccagcgtgcctggctcctgcaaggagaccttcaacctctattactatgaggctgactttgactcggccaccaagaccttccccaactggatggagaatccatgggtgaaggtggataccattgcagccgacgagagcttctcccaggtggacctgggtggccgcgtcatgaaaatcaacaccgaggtgcggagcttcggacctgtgtcccgcagcggcttctacctggccttccaggactatggcggctgcatgtccctcatcgccgtgcgtgtcttctaccgcaagtgcccccgcatcatccagaatggcgccatcttccaggaaaccctgtcgggggctgagagcacatcgctggtggctgcccggggcagctgcatcgccaatgcggaagaggtggatgtacccatcaagctctactgtaacggggacggcgagtggctggtgcccatcgggcgctgcatgtgcaaagcaggcttcgaggccgttgagaatggcaccgtctgccgaggttgtccatctgggactttcaaggccaaccaaggggatgaggcctgtacccactgtcccatcaacagccggaccacttctgaaggggccaccaactgtgtctgccgcaatggctactacagagcagacctggaccccctggacatgccctgcacaaccatcccctccgcgccccaggctgtgatttccagtgtcaatgagacctccctcatgctggagtggacccctccccgcgactccggaggccgagaggacctcgtctacaacatcatctgcaagagctgtggctcgggccggggtgcctgcacccgctgcggggacaatgtacagtacgcaccacgccagctaggcctgaccgagccacgcatttacatcagtgacctgctggcccacacccagtacaccttcgagatccaggctgtgaacggcgttactgaccagagccccttctcgcctcagttcgcctctgtgaacatcaccaccaaccaggcagctccatcggcagtgtccatcatgcatcaggtgagccgcaccgtggacagcattaccctgtcgtggtcccagccggaccagcccaatggcgtgatcctggactatgagctgcagtactatgagaaggagctcagtgagtacaacgccacagccataaaaagccccaccaacacggtcaccgtgcagggcctcaaagccggcgccatctatgtcttccaggtgcgggcacgcaccgtggcaggctacgggcgctacagcggcaagatgtacttccagaccatgacagaagccgagtaccagacaagcatccaggagaagttgccactcatcatcggctcctcggccgctggcctggtcttcctcattgctgtggttgtcatcgccatcgtgtgtaacagacgggggtttgagcgtgctgactcggagtacacggacaagctgcaacactacaccagtggccacatgaccccaggcatgaagatctacatcgatcctttcacctacgaggaccccaacgaggcagtgcgggagtttgccaaggaaattgacatctcctgtgtcaaaattgagcaggtgatcggagcaggggagtttggcgaggtctgcagtggccacctgaagctgccaggcaagagagagatctttgtggccatcaagacgctcaagtcgggctacacggagaagcagcgccgggacttcctgagcgaagcctccatcatgggccagttcgaccatcccaacgtcatccacctggagggtgtcgtgaccaagagcacacctgtgatgatcatcaccgagttcatggagaatggctccctggactcctttctccggcaaaacgatgggcagttcacagtcatccagctggtgggcatgcttcggggcatcgcagctggcatgaagtacctggcagacatgaactatgttcaccgtgacctggctgcccgcaacatcctcgtcaacagcaacctggtctgcaaggtgtcggactttgggctctcacgctttctagaggacgatacctcagaccccacctacaccagtgccctgggcggaaagatccccatccgctggacagccccggaagccatccagtaccggaagttcacctcggccagtgatgtgtggagctacggcattgtcatgtgggaggtgatgtcctatggggagcggccctactgggacatgaccaaccaggatgtaatcaatgccattgagcaggactatcggctgccaccgcccatggactgcccgagcgccctgcaccaactcatgctggactgttggcagaaggaccgcaaccaccggcccaagttcggccaaattgtcaacacgctagacaagatgatccgcaatcccaacagcctcaaagccatggcgcccctctcctctggcatcaacctgccgctgctggaccgcacgatccccgactacaccagctttaacacggtggacgagtggctggaggccatcaagatggggcagtacaaggagagcttcgccaatgccggcttcacctcctttgacgtcgtgtctcagatgatgatggaggacattctccgggttggggtcactttggctggccaccagaaaaaaatcctgaacagtatccaggtgatgcgggcgcagatgaaccagattcagtctgtggaggtttgacattcacctgcctcggctcacctcttcctccaagccccgccccctctgccccacgtgccggccctcctggtgctctatccactgcagggccagccactcgccaggaggccacgggccacgggaagaaccaagcggtgccagccacgagacgtcaccaagaaaacatgcaactcaaacgacggaaaaaaaaagggaatgggaaaaaagaaaacagatcctgggagggggcgggaaatacaaggaatattttttaaagaggattctcataaggaaagcaatgactgttcttgcgggggataaaaaagggcttgggagattcatgcgatgtgtccaatcggagacaaaagcagtttctctccaactccctctgggaaggtgacctggccagagccaagaaacactttcagaaaaacaaatgtgaaggggagagacaggggccgcccttggctcctgtccctgctgctcctctaggcctcactcaacaaccaagcgcctggaggacgggacagatggacagacagccaccctgagaacccctctgggaaaatctattcctgccaccactgggcaaacagaagaatttttctgtctttggagagtattttagaaactccaatgaaagacactgtttctcctgttggctcacagggctgaaaggggcttttgtcctcctgggtcagggagaacgcggggaccccagaaaggtcagccttcctgaggatgggcaacccccaggtctgcagctccaggtacatatcacgcgcacagcctggcagcctggccctcctggtgcccactcccgccagcccctgcctcgaggactgatactgcagtgactgccgtcagctccgactgccgctgagaagggttgatcctgcatctgggtttgtttacagcaattcctggactcgggggtattttggtcacagggtggttttggtttagggggtttgtttgttgggttgttttttgttttttggttttttttaatgacaatgaagtgacactttgacatttcctaccttttgaggacttgatccttctccaggaagaaggtgctttctgcttactgacttaggcaatacaccaagggcgagattttatatgcacatttctggatttttttatacggttttcattgacactcttccctcctcccacctgccaccaggcctcaccaaagcccactgccatggggccatctgggccattcagagactggagtgagatttgggtgtggagggggaggcgccaaggtggaggagcttcccactccaggactgttgatgaaagggacagattgaggaggaagtgggctctgaggctgcagggctggaagtccttgcccacttcccactctcctgccccaatctatctagtacttcccaggcaaataggcccctttgaggctcctgagtgccctcagatggtcaaaacccagttttccctctgggagcctaaaccaggctgcatcggaggccaggacccggatcattcactgtgataccctgccctccagagggtgcgctcagagacacgggcaagcatgcctcttcccttccctggagagaaagtgtgtgatttctctcccacctccttccccccaccagacctttgctgggcctaaaggtcttggccatggggacgccctcagtctagggatctggccacagactccctcctgtgaaccaacacagacacccaagcagagcaatcagttagtgaattgaatggaaataaacgctttagttataatatga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2048 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: ISS
            GeneID:2048 -> Molecular function: GO:0005005 [transmembrane-ephrin receptor activity] evidence: ISS
            GeneID:2048 -> Molecular function: GO:0005005 [transmembrane-ephrin receptor activity] evidence: TAS
            GeneID:2048 -> Molecular function: GO:0005102 [receptor binding] evidence: IEA
            GeneID:2048 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:2048 -> Molecular function: GO:0008046 [axon guidance receptor activity] evidence: IEA
            GeneID:2048 -> Biological process: GO:0001525 [angiogenesis] evidence: ISS
            GeneID:2048 -> Biological process: GO:0001655 [urogenital system development] evidence: ISS
            GeneID:2048 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
            GeneID:2048 -> Biological process: GO:0007399 [nervous system development] evidence: TAS
            GeneID:2048 -> Biological process: GO:0007411 [axon guidance] evidence: ISS
            GeneID:2048 -> Biological process: GO:0007411 [axon guidance] evidence: TAS
            GeneID:2048 -> Biological process: GO:0007413 [axonal fasciculation] evidence: ISS
            GeneID:2048 -> Biological process: GO:0007612 [learning] evidence: IEA
            GeneID:2048 -> Biological process: GO:0016310 [phosphorylation] evidence: ISS
            GeneID:2048 -> Biological process: GO:0018108 [peptidyl-tyrosine phosphorylation] evidence: ISS
            GeneID:2048 -> Biological process: GO:0021631 [optic nerve morphogenesis] evidence: IEA
            GeneID:2048 -> Biological process: GO:0021952 [central nervous system projection neuron axonogenesis] evidence: IEA
            GeneID:2048 -> Biological process: GO:0022038 [corpus callosum development] evidence: ISS
            GeneID:2048 -> Biological process: GO:0031290 [retinal ganglion cell axon guidance] evidence: IEA
            GeneID:2048 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: ISS
            GeneID:2048 -> Biological process: GO:0048013 [ephrin receptor signaling pathway] evidence: ISS
            GeneID:2048 -> Biological process: GO:0048170 [positive regulation of long-term neuronal synaptic plasticity] evidence: IEA
            GeneID:2048 -> Biological process: GO:0048593 [camera-type eye morphogenesis] evidence: IEA
            GeneID:2048 -> Biological process: GO:0050771 [negative regulation of axonogenesis] evidence: IEA
            GeneID:2048 -> Biological process: GO:0050878 [regulation of body fluid levels] evidence: ISS
            GeneID:2048 -> Biological process: GO:0051965 [positive regulation of synapse assembly] evidence: ISS
            GeneID:2048 -> Biological process: GO:0060021 [palate development] evidence: ISS
            GeneID:2048 -> Biological process: GO:0060996 [dendritic spine development] evidence: ISS
            GeneID:2048 -> Biological process: GO:0060997 [dendritic spine morphogenesis] evidence: ISS
            GeneID:2048 -> Biological process: GO:0071679 [commissural neuron axon guidance] evidence: ISS
            GeneID:2048 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: ISS
            GeneID:2048 -> Cellular component: GO:0030424 [axon] evidence: ISS
            GeneID:2048 -> Cellular component: GO:0030425 [dendrite] evidence: ISS
            GeneID:2048 -> Cellular component: GO:0043025 [neuronal cell body] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_059145 -> EC 2.7.10.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.