GGRNA Home | Help | Advanced search

2019-03-23 03:24:29, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_016376               7959 bp    mRNA    linear   PRI 11-MAY-2013
DEFINITION  Homo sapiens ankyrin repeat and FYVE domain containing 1 (ANKFY1),
            transcript variant 1, mRNA.
ACCESSION   NM_016376
VERSION     NM_016376.3  GI:110815812
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7959)
  AUTHORS   Zhang,J., Reiling,C., Reinecke,J.B., Prislan,I., Marky,L.A.,
            Sorgen,P.L., Naslavsky,N. and Caplan,S.
  TITLE     Rabankyrin-5 interacts with EHD1 and Vps26 to regulate endocytic
            trafficking and retromer function
  JOURNAL   Traffic 13 (5), 745-757 (2012)
   PUBMED   22284051
  REMARK    GeneRIF: Rabankyrin-5 interacts with EHD1 and Vps26 to regulate
            endocytic trafficking and retromer function
REFERENCE   2  (bases 1 to 7959)
  AUTHORS   Bouslam,N., Bouhouche,A., Benomar,A., Hanein,S., Klebe,S.,
            Azzedine,H., Di Giandomenico,S., Boland-Auge,A., Santorelli,F.M.,
            Durr,A., Brice,A., Yahyaoui,M. and Stevanin,G.
  TITLE     A novel locus for autosomal recessive spastic ataxia on chromosome
            17p
  JOURNAL   Hum. Genet. 121 (3-4), 413-420 (2007)
   PUBMED   17273843
REFERENCE   3  (bases 1 to 7959)
  AUTHORS   Schnatwinkel,C., Christoforidis,S., Lindsay,M.R.,
            Uttenweiler-Joseph,S., Wilm,M., Parton,R.G. and Zerial,M.
  TITLE     The Rab5 effector Rabankyrin-5 regulates and coordinates different
            endocytic mechanisms
  JOURNAL   PLoS Biol. 2 (9), E261 (2004)
   PUBMED   15328530
  REMARK    GeneRIF: Rab5 regulates and coordinates different endocytic
            mechanisms through its effector Rabankyrin-5
REFERENCE   4  (bases 1 to 7959)
  AUTHORS   Kuriyama,H., Asakawa,S., Minoshima,S., Maruyama,H., Ishii,N.,
            Ito,K., Gejyo,F., Arakawa,M., Shimizu,N. and Kuwano,R.
  TITLE     Characterization and chromosomal mapping of a novel human gene,
            ANKHZN
  JOURNAL   Gene 253 (2), 151-160 (2000)
   PUBMED   10940552
REFERENCE   5  (bases 1 to 7959)
  AUTHORS   Ito,K., Ishii,N., Miyashita,A., Tominaga,K., Kuriyama,H.,
            Maruyama,H., Shirai,M., Naito,M., Arakawa,M. and Kuwano,R.
  TITLE     Molecular cloning of a novel 130-kDa cytoplasmic protein, Ankhzn,
            containing Ankyrin repeats hooked to a zinc finger motif
  JOURNAL   Biochem. Biophys. Res. Commun. 257 (1), 206-213 (1999)
   PUBMED   10092534
  REMARK    GeneRIF: Characterization of the related mouse gene
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA856905.1, AK057047.1 and
            AC087292.14.
            On Jul 28, 2006 this sequence version replaced gi:31317211.
            
            Summary: This gene encodes a cytoplasmic protein that contains a
            coiled-coil structure and a BTB/POZ domain at its N-terminus,
            ankyrin repeats in the middle portion, and a FYVE-finger motif at
            its C-terminus. This protein belongs to a subgroup of double zinc
            finger proteins which may be involved in vesicle or protein
            transport. Alternate splicing results in multiple transcript
            variants of this gene. [provided by RefSeq, Apr 2012].
            
            Transcript Variant: This variant (1) encodes isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC060812.1, AK292930.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-551               DA856905.1         1-551
            552-1558            AK057047.1         410-1416
            1559-1559           AC087292.14        172048-172048       c
            1560-3494           AK057047.1         1418-3352
            3495-7959           AC087292.14        150422-154886       c
FEATURES             Location/Qualifiers
     source          1..7959
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p13.3"
     gene            1..7959
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeat and FYVE domain containing 1"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
     exon            1..48
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     CDS             39..3551
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="isoform 1 is encoded by transcript variant 1;
                     ankyrin repeat hooked to zinc finger motif; Rabankyrin-5;
                     ankyrin repeat and FYVE domain-containing protein 1;
                     ankyrin repeats hooked to a zinc finger motif"
                     /codon_start=1
                     /product="ankyrin repeat and FYVE domain-containing
                     protein 1 isoform 1"
                     /protein_id="NP_057460.3"
                     /db_xref="GI:110815813"
                     /db_xref="CCDS:CCDS42236.1"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
                     /translation="
MAEEEVAKLEKHLMLLRQEYVKLQKKLAETEKRCALLAAQANKESSSESFISRLLAIVADLYEQEQYSDLKIKVGDRHISAHKFVLAARSDSWSLANLSSTKELDLSDANPEVTMTMLRWIYTDELEFREDDVFLTELMKLANRFQLQLLRERCEKGVMSLVNVRNCIRFYQTAEELNASTLMNYCAEIIASHWDDLRKEDFSSMSAQLLYKMIKSKTEYPLHKAIKVEREDVVFLYLIEMDSQLPGKLNEADHNGDLALDLALSRRLESIATTLVSHKADVDMVDKSGWSLLHKGIQRGDLFAATFLIKNGAFVNAATLGAQETPLHLVALYSSKKHSADVMSEMAQIAEALLQAGANPNMQDSKGRTPLHVSIMAGNEYVFSQLLQCKQLDLELKDHEGSTALWLAVQHITVSSDQSVNPFEDVPVVNGTSFDENSFAARLIQRGSHTDAPDTATGNCLLQRAAGAGNEAAALFLATNGAHVNHRNKWGETPLHTACRHGLANLTAELLQQGANPNLQTEEALPLPKEAASLTSLADSVHLQTPLHMAIAYNHPDVVSVILEQKANALHATNNLQIIPDFSLKDSRDQTVLGLALWTGMHTIAAQLLGSGAAINDTMSDGQTLLHMAIQRQDSKSALFLLEHQADINVSRTQDGETALQLAIRNQLPLVVDAICTRGADMSVPDEKGNPPLWLALANNLEDIASTLVRHGCDATCWGPGPGGCLQTLLHRAIDENNEPTACFLIRSGCDVNSPRQPGANGEGEEEARDGQTPLHLAASWGLEETVQCLLEFGANVNAQDAEGRTPIHVAISSQHGVIIQLLVSHPDIHLNVRDRQGLTPFACAMTFKNNKSAEAILKRESGAAEQVDNKGRNFLHVAVQNSDIESVLFLISVHANVNSRVQDASKLTPLHLAVQAGSEIIVRNLLLAGAKVNELTKHRQTALHLAAQQDLPTICSVLLENGVDFAAVDENGNNALHLAVMHGRLNNIRVLLTECTVDAEAFNLRGQSPLHILGQYGKENAAAIFDLFLECMPGYPLDKPDADGSTVLLLAYMKGNANLCRAIVRSGARLGVNNNQGVNIFNYQVATKQLLFRLLDMLSKEPPWCDGSYCYECTARFGVTTRKHHCRHCGRLLCHKCSTKEIPIIKFDLNKPVRVCNICFDVLTLGGVS
"
     misc_feature    42..44
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylalanine; propagated from
                     UniProtKB/Swiss-Prot (Q9P2R3.2); acetylation site"
     misc_feature    216..506
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="BTB/POZ domain; Region: BTB; pfam00651"
                     /db_xref="CDD:201372"
     misc_feature    537..>743
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="BTB And C-terminal Kelch; Region: BACK; smart00875"
                     /db_xref="CDD:197943"
     misc_feature    687..779
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 1"
     misc_feature    693..1049
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    801..890
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 2"
     misc_feature    885..1274
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    900..989
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 3"
     misc_feature    915..1232
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1002..1124
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 4"
     misc_feature    1134..1226
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 5"
     misc_feature    1227..1727
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1476..1742
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1506..1595
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 6"
     misc_feature    1662..2063
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1662..1754
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 7"
     misc_feature    1677..1988
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1800..1889
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 8"
     misc_feature    1884..2411
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1899..1988
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 9"
     misc_feature    1914..2180
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2001..2090
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 10"
     misc_feature    2100..2189
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 11"
     misc_feature    2211..2300
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 12"
     misc_feature    2226..2543
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2343..2819
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2346..2435
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 13"
     misc_feature    2445..2537
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 14"
     misc_feature    2547..2636
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 15"
     misc_feature    2637..3017
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2649..2738
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 16"
     misc_feature    2664..2948
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2754..2843
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 17"
     misc_feature    2838..3233
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2853..2942
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 18"
     misc_feature    2913..3077
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Ankyrin repeats (many copies); Region: Ank_5;
                     pfam13857"
                     /db_xref="CDD:206028"
     misc_feature    2952..3044
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 19"
     misc_feature    3054..3152
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 20"
     misc_feature    3168..3257
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P2R3.2);
                     Region: ANK 21"
     misc_feature    3345..3530
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Protein present in Fab1, YOTB, Vac1, and EEA1;
                     Region: FYVE; smart00064"
                     /db_xref="CDD:197498"
     misc_feature    3357..3524
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="FYVE domain; Zinc-binding domain; targets proteins
                     to membrane lipids via interaction with
                     phosphatidylinositol-3-phosphate, PI3P; present in Fab1,
                     YOTB, Vac1, and EEA1; Region: FYVE; cd00065"
                     /db_xref="CDD:28947"
     misc_feature    order(3369..3371,3378..3380,3417..3419,3426..3428,
                     3441..3443,3450..3452,3507..3509,3516..3518)
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="Zn binding sites [ion binding]; other site"
                     /db_xref="CDD:28947"
     misc_feature    order(3405..3422,3435..3437,3501..3503)
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="phosphatidylinositol 3-phosphate binding site
                     [chemical binding]; other site"
                     /db_xref="CDD:28947"
     exon            49..241
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            242..360
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            361..496
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            497..620
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            621..770
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            771..936
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       800
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369749781"
     variation       830
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3744671"
     exon            937..1141
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1142..1210
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1211..1410
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1411..1508
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1509..1737
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       1559
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2020118"
     variation       1676
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1973059"
     exon            1738..1836
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1837..1990
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1991..2162
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2163..2281
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2282..2438
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2439..2639
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2640..2816
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2817..2964
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2965..3055
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3056..3180
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3181..3327
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3328..3418
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3419..7959
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     STS             4394..4504
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="G54294"
                     /db_xref="UniSTS:116130"
     variation       4609
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045016"
     STS             4884..5065
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="RH103073"
                     /db_xref="UniSTS:97407"
     variation       4889
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3760471"
     variation       6765
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:3840875"
     variation       7072
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043587"
     variation       7309
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043592"
     STS             7369..7493
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /standard_name="SHGC-36655"
                     /db_xref="UniSTS:81079"
ORIGIN      
gcacttctcgcgaggttgcaggcagtgccgggccagacatggcggaagaggaggtggccaagttggagaagcacttgatgcttctgcggcaggagtatgtcaagctgcagaagaagctggcggagacagagaagcgctgcgctctcttggctgcgcaggcaaacaaggagagcagcagcgagtccttcatcagccgtctgctggccatcgtggcagacctctacgagcaggagcagtacagcgatctgaagataaaggttggggacaggcacatcagtgctcacaagtttgtcctggcagcccgcagtgacagctggagtctggctaacttgtcttccactaaagagttggacctgtcagatgctaatcctgaggtgacgatgacaatgcttcgctggatctatacagatgagctggagttcagagaggatgatgtgttcctgactgaactgatgaaactagcaaatcggtttcagctacagctcctcagggagagatgtgagaagggtgttatgtctctagtgaatgtcaggaactgtattcgcttctaccagacggcagaggagctgaatgccagcacactgatgaactactgtgcagaaattattgcaagtcattgggacgacctgaggaaggaggatttcagcagcatgagcgctcagttgttatacaaaatgatcaaatccaagacagagtacccgctacataaagccatcaaagtggagagagaagacgtggtcttcctgtatctgattgaaatggattcccagctccctgggaagctgaatgaagcggatcataacggagatctggcattagatctagccctctcacgacgactggagagtattgccaccacgctggttagtcacaaagctgatgtggacatggtggacaagagtggctggagcttgttacacaaaggaatccaaagaggagatctctttgctgccactttcctcattaagaatggggcctttgtcaacgctgctacactgggtgcccaggagacaccactgcaccttgtggccttgtacagttcaaagaaacactcagcagatgtgatgtctgagatggcgcagattgcagaggcccttctgcaggctggtgccaaccccaacatgcaggacagcaaggggaggactcctttacatgtgtccatcatggccgggaatgaatatgtgttcagtcagctgctgcagtgcaaacaactagatttagaactcaaagaccacgagggcagcacggctctgtggctggcagtgcagcatatcacagtgtcttctgaccagtctgtgaaccccttcgaagatgtccccgtggtaaatgggacttcatttgatgagaacagctttgcagccagactcatccagcgcggcagccacacagacgcacctgacacggcgacaggaaactgtttactacagcgggcagctggagcaggaaacgaggcagcagctcttttcctggcaaccaacggtgcccatgtcaaccacagaaacaagtggggagaaaccccgttgcacacagcgtgtcggcatggcctggccaacctcacggcagagctcctgcagcaaggcgccaacccaaacctgcagacggaggaagctctgcctctgccaaaggaggccgcatccctgaccagcttggcggacagcgtccatctgcagacgccactgcacatggcgatcgcctataaccatccggatgtggtgtctgtcatcctggagcagaaagccaatgctcttcatgccaccaacaacttgcagatcattccggacttcagcctcaaagattcccgagaccagactgtgctgggcctggcattatggactggcatgcacacgatcgcagcccagctgctgggctctggagccgccatcaatgacaccatgtcggatgggcagacgctactgcacatggccatacagcggcaggacagcaagagcgcactcttcctgctggagcaccaggcagatataaatgtcagcaggactcaggacggggagacagccctccagctggccatcagaaaccagcttccactcgtagttgatgccatatgcacccgaggagctgacatgtctgtgccagatgagaaggggaaccccccgctgtggcttgcattggcaaacaatctggaggacatcgcatccactctggtcagacatggctgtgatgccacatgctggggtccgggacctggtgggtgccttcagacgctcctgcacagagccattgatgaaaacaacgagcccaccgcctgctttcttattcgcagtggctgtgacgtgaacagtcccagacaaccaggcgccaatggagaaggagaggaagaggctagagatgggcagacccctttgcatttggcagcctcttgggggctggaagagacagtacagtgtcttctggagtttggtgccaacgtgaacgcacaggatgcagaaggaagaacccccatccacgtggccatcagcagccaacacggtgtcatcattcagctgttggtttctcaccccgatatccatttgaatgtacgagacagacaagggctgaccccgtttgcctgtgccatgactttcaagaacaacaagtcagccgaggccattctcaaacgagagtccggggctgctgagcaggtggataacaagggccggaatttccttcatgtggcagttcagaactctgatattgaaagtgtgctgttcctgatcagtgtccacgctaatgtgaattcaagagtccaggatgcctccaagttgacccccctgcacctcgctgtccaagcaggctcagaaattattgtccgcaatttgcttcttgcgggagccaaagtgaacgaattaaccaagcatcgccagactgccctccatcttgctgcccagcaggacctgcccaccatctgctcagtcctcctagagaatggcgtggactttgctgccgtggatgagaatggaaacaatgctcttcatcttgctgtcatgcacggccggctcaacaacatccgggttctcctgacagagtgcacagtggacgccgaagcctttaatctcagaggccagtcaccactgcacattttgggacaatatggcaaggagaatgcagcggccatctttgatctcttcctagaatgcatgccggggtatcctctggacaagccggatgcagacggcagcacggtgctgctcctggcatacatgaaagggaacgccaacttgtgccgcgccatcgtccggtcgggggctcgcctcggggtgaataacaaccagggagtcaacatcttcaactaccaggtcgccaccaagcagctcctgttccgactgctggatatgctgtccaaggagcctccgtggtgtgacggctcctactgctatgagtgcactgccaggttcggagtcaccactcgcaaacaccactgtcgtcactgcggacgtcttctttgccataaatgctcgaccaaggagattcctattataaagtttgatctgaacaagcctgtgcgggtttgcaacatttgttttgatgtactgactctgggtggggtttcttagtgagccccccggagggtccaggccacgtccttggtcacctccccagcagctgctctgctcaccagcctgaccccacccagagcaggagctggcgggtgtcttcctgcggcaatagactggaacgattaaggaccatggtgtgatagatcccatttcaaatgattccatatgattgtcagtgtgtgtgtcagactgtgatcgatttcactagatgtctcactcatcagaccaggccattgggcctaagtggtaaatgtgattaggaattagacctctccccattctgctagcaacatacagggacacttggaaaaccatttccccttccagtagcttggtgtccatcccagagcattcatgaagtcttcccgcctgggctgactgatgaggcagagcctctcagcgtaggaagctggctgcttaatgagctggctttactctagggtaagtggctgtggacttttctgcacagtgttttcataaagataataggatcctcttgccctgaagtctttttttctttttacgctaagctgtatttttagtgagctaccccttttaaaaaggtgaaatctttcttaacagggttcaaagatgagagctgaaaaatcgtggccttaacaactgaaagctttacagtgttcatgctactgaggtgtcaggagtgcagctgggccgcttgacacctcgtagcagccgtctcattctctcgtcttgctgcgtcctgtctgtggagtcctcagtcactctgctgttggagagtgctggaggaaatgcacttttactgtgctgcactttttatagagctgcattgtcggtgattccaatttaaaaatccatattcaaaaataccctcacacatccctgcatcagtgattctaatgatcagctttgactggacctcagctcacacgaatctccaaggaaaaactctacagagcatcttttagagcaagagattcatacaggccaagtgatgagagggggagtcaccaaggcttcagccccaagggcatctccagcctcaggccggcaggtcctatgtccttgacacaaatgcttcttgctgaaatcctccctagtgatgctgcgagtgctgttggtcccagttctgtgtagcttgccctgccccatgaagggccaccagccaagggccctggccacgtgtgcgccaccttactttggaagtctctggcttgtgtgctggatgaggctgccagaacttgttgggcgttcatcgctgttagtacatatattaaccgtgaggtgttaaacttttcttttgaaggtttggccagtttctaaaaaatgcacatttaaagagaagcatctaccacggctttaaaacaaaacaactctgagatgaacaatatgtgttatactcagagattaacaatctcaatcatacatactgattctttcagacatttaataaccactacatttttttgcattaatgaagtttgactatatgtgtaaagggactaaatatttttgcaacagcctgttctttgttcattcttttctggatagtgtgtcctctgtattgcggtagatttatacattctgttgcctaaatatgtgtgtaaaatgagctgataaactggagtactacttaaaaaaaagtctgtgatttataagatgtatatgctttctatgtgaatataagcttgtgcacaatgtttaaaagaaaaacaatgaattagaagagatcccccgtcccccagtctgacatatttcatacagaatgtttaaaagaaaaactctgctagtcttggcaaacatttggccatgtgaggcatgtggtcagtttccattttctattacctggaaagggccataaggaagcaggcagggcttaggtagcttggttacctaagttagaaagtaagagaatcatgattcggatatgaattgaagtggttggtacatggatacctgttctttaaaaggaatgtgggagatgagtcaagggtgaggccgattgttctgcccatgccctaccataccaatttcaataacaatcttgcctgtcattgcactcagaatcttaagatcatgtttcaaatatgttgattcaaacttgcttctaagcctgagtccagggatagcaatggtactgaccagctatggactgggagaacattgagtcctgttttccattggcttcagggcgcatccatgtggatataggaaaagcctctttccacagacttaggaagccccccgaccacgcggacgctcgctgggctgcactcagcaggctgcttgagtgggagctgactccaacatgccctgccctggctgggactaggcatgcttccagcccttcccgtgctctccctgctgtcaacacttgcgtacaaacctgcctagctgttgtaagttttcatcagtagcttaagtactagtagcaaaaacttaaattcattcagaaagttgccacttctgaatgagtagagcaggaaaagtaaactttactgaaacataatttgctgcaacagtcaacattgttatgctgaatgtgctctcaactgccctttgctcatcgccagatttattatccagtgtattcctaacagtcttttgttgtcgttgtttttaaaacaaaggtacggaccatgtgctatatataaatcgaatggcttaaactaatttgctatgatcctctaacaccgaaatttcccataaacttaagtgcctacacttaggacttttgaactttcagtcatctttttcgtggtgtctcactgaacgatgtgttagaacatgtgttccatttggagttttgggcctgtgcacggtcaaccccaattaccaatttagttgaggctggattcgattgctcagttcacctgccacgttctctccaaggagtggggtctacgtgacctttagtcctctacctcagagccccgagtcatttctgaccaccccgttctgtgtcctcactcttgtccctgaatgggtccctgtgtggatctcagtgtgtgtgtggtttctccactcctccccgctcatgtcccacacctgccatattgaaccgtttctgcactaatcttctccacgggcacggagtggagggaacgtcttgggaaaggggagagcttgacctccatctaggtttcttttatctggagaaaaagaacacttttgaactatgtaatgcttcaccctgaaaggcaagctaacgctaacttcccaggtgacagtagcaggaacaaggaagggtaatgtttccatgacagacacttgcttcccttgggacaagtcccagaagaactacctgaagcaccaaagctccccaccccagcctggtggcagaggaagcaggtggcaccaactcaccaaagggacttgggagccaccttctcactctgtggaagtactttagtgagagctgactggcaagataaaaaccctgaaattcccagaagttacagatgccttaaagactttctttggaagatcattgcctgtactattccttttttgtgtggcataaataatatattaacctgttacaactgacaacattggttttctgcagctagggagtcttgagtcgagactgctcgccttgatgacttgctcttttttggcagatgtgtggagttggctgttacgacatccctgtgtgatcccagaggaggggcagtagctgggcagaaactgcaggcacacatttgggtggatcacctggcttccagccccttcggggtggtgctcagtgtggggtgatggtatcatagaggaccacggcgcttatcagcattgtttctttggagtctgtgtaatggaatgtatttttcaaatactgatatttgcattttctgtaacaattccttataataaaatgaagtaaaattgtgcatttaaagtggaaactttaataagacatttgtagttacttctaatgcagaagtaccaataagcattaaaaacaaattttagaaaactcctgacgtgaataagtttcttgaccagctgccctccagaaagtttgaattccaacatttttcaggaacatgctgttgacagcagtaaaagtagctattttatgtatgtatttttaatttttaaaagtttcagtaggtttttggggttcaggtggtgtttggttacgtgaggttctttagcggtgatttccaggattttggggcacccatcacccaagcagtgtacactggacccttttatccctcaccccaaccctttcccctgagcccccaaagtccactgtatcattcttaatgcctttacgtcctcatggcttagctcccgaaaagtagttattttaaacatactagctgcctgaacttactgtgcccttggcccagatttcagctcatagcaccgagcgtgatcactgaggcagtctcagtcaccgtcacctgacccctctgaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51479 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51479 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:51479 -> Cellular component: GO:0010008 [endosome membrane] evidence: ISS
            GeneID:51479 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.