GGRNA Home | Help | Advanced search

2019-03-25 14:30:05, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_016232               2058 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens interleukin 1 receptor-like 1 (IL1RL1), transcript
            variant 1, mRNA.
ACCESSION   NM_016232
VERSION     NM_016232.4  GI:27894323
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2058)
  AUTHORS   Chen,L.Q., de Lemos,J.A., Das,S.R., Ayers,C.R. and Rohatgi,A.
  TITLE     Soluble ST2 is associated with all-cause and cardiovascular
            mortality in a population-based cohort: the Dallas Heart Study
  JOURNAL   Clin. Chem. 59 (3), 536-546 (2013)
   PUBMED   23220272
  REMARK    GeneRIF: Soluble ST2 is associated with all-cause and
            cardiovascular mortality in a population-based cohort.
REFERENCE   2  (bases 1 to 2058)
  AUTHORS   Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee
            JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K,
            Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z,
            Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN,
            Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A,
            Boucher G, Brand S, Buning C, Cohain A, Cichon S, D'Amato M, De
            Jong D, Devaney KL, Dubinsky M, Edwards C, Ellinghaus D, Ferguson
            LR, Franchimont D, Fransen K, Gearry R, Georges M, Gieger C, Glas
            J, Haritunians T, Hart A, Hawkey C, Hedl M, Hu X, Karlsen TH,
            Kupcinskas L, Kugathasan S, Latiano A, Laukens D, Lawrance IC, Lees
            CW, Louis E, Mahy G, Mansfield J, Morgan AR, Mowat C, Newman W,
            Palmieri O, Ponsioen CY, Potocnik U, Prescott NJ, Regueiro M,
            Rotter JI, Russell RK, Sanderson JD, Sans M, Satsangi J, Schreiber
            S, Simms LA, Sventoraityte J, Targan SR, Taylor KD, Tremelling M,
            Verspaget HW, De Vos M, Wijmenga C, Wilson DC, Winkelmann J, Xavier
            RJ, Zeissig S, Zhang B, Zhang CK, Zhao H, Silverberg MS, Annese V,
            Hakonarson H, Brant SR, Radford-Smith G, Mathew CG, Rioux JD,
            Schadt EE, Daly MJ, Franke A, Parkes M, Vermeire S, Barrett JC and
            Cho JH.
  CONSRTM   International IBD Genetics Consortium (IIBDGC)
  TITLE     Host-microbe interactions have shaped the genetic architecture of
            inflammatory bowel disease
  JOURNAL   Nature 491 (7422), 119-124 (2012)
   PUBMED   23128233
REFERENCE   3  (bases 1 to 2058)
  AUTHORS   Hirota,T., Takahashi,A., Kubo,M., Tsunoda,T., Tomita,K.,
            Sakashita,M., Yamada,T., Fujieda,S., Tanaka,S., Doi,S.,
            Miyatake,A., Enomoto,T., Nishiyama,C., Nakano,N., Maeda,K.,
            Okumura,K., Ogawa,H., Ikeda,S., Noguchi,E., Sakamoto,T., Hizawa,N.,
            Ebe,K., Saeki,H., Sasaki,T., Ebihara,T., Amagai,M., Takeuchi,S.,
            Furue,M., Nakamura,Y. and Tamari,M.
  TITLE     Genome-wide association study identifies eight new susceptibility
            loci for atopic dermatitis in the Japanese population
  JOURNAL   Nat. Genet. 44 (11), 1222-1226 (2012)
   PUBMED   23042114
REFERENCE   4  (bases 1 to 2058)
  AUTHORS   Salker,M.S., Nautiyal,J., Steel,J.H., Webster,Z., Sucurovic,S.,
            Nicou,M., Singh,Y., Lucas,E.S., Murakami,K., Chan,Y.W., James,S.,
            Abdallah,Y., Christian,M., Croy,B.A., Mulac-Jericevic,B., Quenby,S.
            and Brosens,J.J.
  TITLE     Disordered IL-33/ST2 activation in decidualizing stromal cells
            prolongs uterine receptivity in women with recurrent pregnancy loss
  JOURNAL   PLoS ONE 7 (12), E52252 (2012)
   PUBMED   23300625
  REMARK    GeneRIF: Il-33/ST2 activation in HESCS drives an autoinflammatory
            response that controls the temporal expression of receptivity genes
REFERENCE   5  (bases 1 to 2058)
  AUTHORS   Ramasamy A, Kuokkanen M, Vedantam S, Gajdos ZK, Couto Alves A, Lyon
            HN, Ferreira MA, Strachan DP, Zhao JH, Abramson MJ, Brown MA, Coin
            L, Dharmage SC, Duffy DL, Haahtela T, Heath AC, Janson C, Kahonen
            M, Khaw KT, Laitinen J, Le Souef P, Lehtimaki T, Madden PA, Marks
            GB, Martin NG, Matheson MC, Palmer CD, Palotie A, Pouta A,
            Robertson CF, Viikari J, Widen E, Wjst M, Jarvis DL, Montgomery GW,
            Thompson PJ, Wareham N, Eriksson J, Jousilahti P, Laitinen T,
            Pekkanen J, Raitakari OT, O'Connor GT, Salomaa V, Jarvelin MR and
            Hirschhorn JN.
  CONSRTM   Australian Asthma Genetics Consortium Collaborators
  TITLE     Genome-wide association studies of asthma in population-based
            cohorts confirm known and suggested loci and identify an additional
            association near HLA
  JOURNAL   PLoS ONE 7 (9), E44008 (2012)
   PUBMED   23028483
REFERENCE   6  (bases 1 to 2058)
  AUTHORS   Lohning,M., Stroehmann,A., Coyle,A.J., Grogan,J.L., Lin,S.,
            Gutierrez-Ramos,J.C., Levinson,D., Radbruch,A. and Kamradt,T.
  TITLE     T1/ST2 is preferentially expressed on murine Th2 cells, independent
            of interleukin 4, interleukin 5, and interleukin 10, and important
            for Th2 effector function
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 95 (12), 6930-6935 (1998)
   PUBMED   9618516
REFERENCE   7  (bases 1 to 2058)
  AUTHORS   Kumar,S., Tzimas,M.N., Griswold,D.E. and Young,P.R.
  TITLE     Expression of ST2, an interleukin-1 receptor homologue, is induced
            by proinflammatory stimuli
  JOURNAL   Biochem. Biophys. Res. Commun. 235 (3), 474-478 (1997)
   PUBMED   9207179
REFERENCE   8  (bases 1 to 2058)
  AUTHORS   Yanagisawa,K., Naito,Y., Kuroiwa,K., Arai,T., Furukawa,Y.,
            Tomizuka,H., Miura,Y., Kasahara,T., Tetsuka,T. and Tominaga,S.
  TITLE     The expression of ST2 gene in helper T cells and the binding of ST2
            protein to myeloma-derived RPMI8226 cells
  JOURNAL   J. Biochem. 121 (1), 95-103 (1997)
   PUBMED   9058198
REFERENCE   9  (bases 1 to 2058)
  AUTHORS   Gayle,M.A., Slack,J.L., Bonnert,T.P., Renshaw,B.R., Sonoda,G.,
            Taguchi,T., Testa,J.R., Dower,S.K. and Sims,J.E.
  TITLE     Cloning of a putative ligand for the T1/ST2 receptor
  JOURNAL   J. Biol. Chem. 271 (10), 5784-5789 (1996)
   PUBMED   8621446
REFERENCE   10 (bases 1 to 2058)
  AUTHORS   Tominaga,S., Yokota,T., Yanagisawa,K., Tsukamoto,T., Takagi,T. and
            Tetsuka,T.
  TITLE     Nucleotide sequence of a complementary DNA for human ST2
  JOURNAL   Biochim. Biophys. Acta 1171 (2), 215-218 (1992)
   PUBMED   1482686
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AB012701.3.
            On Jan 24, 2003 this sequence version replaced gi:24475649.
            
            Summary: The protein encoded by this gene is a member of the
            interleukin 1 receptor family. Studies of the similar gene in mouse
            suggested that this receptor can be induced by proinflammatory
            stimuli, and may be involved in the function of helper T cells.
            This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1
            receptor, type II (IL1R2) and interleukin 1 receptor-like 2
            (IL1RL2) form a cytokine receptor gene cluster in a region mapped
            to chromosome 2q12. Alternative splicing of this gene results in
            multiple transcript variants. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB012701.3 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2058
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q12"
     gene            1..2058
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="interleukin 1 receptor-like 1"
                     /db_xref="GeneID:9173"
                     /db_xref="HGNC:5998"
                     /db_xref="HPRD:03123"
                     /db_xref="MIM:601203"
     exon            1..122
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       102
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184386656"
     variation       113
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:57065265"
     exon            123..332
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       200
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13431828"
     variation       201
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77378267"
     variation       210
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370403265"
     misc_feature    257..259
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="upstream in-frame stop codon"
     variation       260
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372016897"
     CDS             272..1942
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; homolog of mouse growth stimulation-expressed;
                     interleukin 1 receptor-related protein; interleukin-1
                     receptor-like 1"
                     /codon_start=1
                     /product="interleukin-1 receptor-like 1 isoform 1
                     precursor"
                     /protein_id="NP_057316.3"
                     /db_xref="GI:27894324"
                     /db_xref="CCDS:CCDS2057.1"
                     /db_xref="GeneID:9173"
                     /db_xref="HGNC:5998"
                     /db_xref="HPRD:03123"
                     /db_xref="MIM:601203"
                     /translation="
MGFWILAILTILMYSTAAKFSKQSWGLENEALIVRCPRQGKPSYTVDWYYSQTNKSIPTQERNRVFASGQLLKFLPAAVADSGIYTCIVRSPTFNRTGYANVTIYKKQSDCNVPDYLMYSTVSGSEKNSKIYCPTIDLYNWTAPLEWFKNCQALQGSRYRAHKSFLVIDNVMTEDAGDYTCKFIHNENGANYSVTATRSFTVKDEQGFSLFPVIGAPAQNEIKEVEIGKNANLTCSACFGKGTQFLAAVLWQLNGTKITDFGEPRIQQEEGQNQSFSNGLACLDMVLRIADVKEEDLLLQYDCLALNLHGLRRHTVRLSRKNPIDHHSIYCIIAVCSVFLMLINVLVIILKMFWIEATLLWRDIAKPYKTRNDGKLYDAYVVYPRNYKSSTDGASRVEHFVHQILPDVLENKCGYTLCIYGRDMLPGEDVVTAVETNIRKSRRHIFILTPQITHNKEFAYEQEVALHCALIQNDAKVILIEMEALSELDMLQAEALQDSLQHLMKVQGTIKWREDHIANKRSLNSKFWKHVRYQMPVPSKIPRKASSLTPLAAQKQ
"
     sig_peptide     272..325
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
     misc_feature    317..583
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="First immunoglobulin (Ig)-like domain of
                     interleukin-1 receptor (IL1R) and similar proteins;
                     Region: Ig1_IL1R_like; cd05756"
                     /db_xref="CDD:143233"
     misc_feature    order(323..325,329..346)
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="antagonist binding site; other site"
                     /db_xref="CDD:143233"
     mat_peptide     326..1939
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /product="interleukin-1 receptor-like 1 isoform 1"
     misc_feature    533..535
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="acetylation site"
     misc_feature    623..883
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="Second immunoglobulin (Ig)-like domain of
                     interleukin-1 receptor (IL1R) and similar proteins;
                     Region: Ig2_IL1R_like; cd05757"
                     /db_xref="CDD:143234"
     misc_feature    order(623..628,632..643,659..661,674..676,680..682,
                     764..766,878..880)
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="antagonist binding site; other site"
                     /db_xref="CDD:143234"
     misc_feature    1256..1318
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q01638.4);
                     transmembrane region"
     misc_feature    1463..1870
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /note="TIR domain; Region: TIR; pfam01582"
                     /db_xref="CDD:201870"
     variation       290
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142516188"
     variation       291
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201837678"
     variation       298
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115399106"
     variation       310
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200098412"
     variation       324
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376279073"
     exon            333..543
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       376
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144435600"
     variation       380
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146539272"
     variation       406
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190188722"
     variation       407
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182781591"
     variation       410
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201523855"
     variation       415
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147316935"
     variation       444
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140931129"
     variation       449
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146872465"
     variation       455
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375754947"
     variation       461
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202037442"
     variation       504
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1041973"
     variation       509
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200028993"
     variation       510
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34210856"
     variation       528
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145568700"
     variation       531
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369779260"
     exon            544..718
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       570
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141061248"
     variation       577
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148229923"
     variation       584
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200221077"
     variation       586
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111382791"
     variation       593
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199800154"
     variation       638
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371207219"
     variation       640
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140675864"
     variation       655
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376294785"
     variation       670
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149494752"
     variation       678
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143378674"
     variation       699
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367674419"
     variation       701
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141010284"
     variation       718
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200484415"
     exon            719..881
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       729
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114797672"
     variation       754
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142878092"
     variation       757
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189627011"
     variation       796
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200131845"
     variation       797
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34225180"
     variation       808
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368736748"
     variation       810
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141101455"
     variation       837
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148867750"
     variation       847
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112336397"
     variation       855
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201973706"
     variation       858
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200831341"
     variation       862
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368468978"
     variation       867
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368053458"
     variation       872
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137964169"
     variation       873
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143458919"
     variation       874
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201621624"
     variation       875
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201365371"
     exon            882..953
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       914
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75320001"
     variation       917
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111970215"
     variation       921
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188504053"
     variation       923
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373122141"
     exon            954..1095
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       962
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75779188"
     variation       1015
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150894779"
     variation       1016
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146105446"
     variation       1018
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372957266"
     variation       1023
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140073514"
     exon            1096..1241
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       1129
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199635856"
     variation       1144
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35298562"
     variation       1157
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146406137"
     variation       1161
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140301260"
     variation       1162
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373664545"
     variation       1175
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150347157"
     variation       1200
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368714053"
     variation       1216
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372391703"
     variation       1231
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202062299"
     exon            1242..1388
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       1248
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180959006"
     variation       1251
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369104980"
     variation       1256
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112595294"
     variation       1257
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185314669"
     variation       1301
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367848630"
     variation       1311
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188567206"
     variation       1326
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369445462"
     variation       1327
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116272080"
     variation       1336
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148165655"
     variation       1370
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201256810"
     exon            1389..1556
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       1418
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376977990"
     variation       1422
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200610115"
     variation       1424
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187567035"
     variation       1425
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190651658"
     variation       1443
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146118394"
     variation       1457
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200737120"
     variation       1458
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138892317"
     variation       1461
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139260265"
     variation       1500
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373904303"
     variation       1503
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149971818"
     variation       1518
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148477219"
     variation       1526
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201555383"
     variation       1528
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370672033"
     variation       1536
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199998092"
     exon            1557..2058
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /inference="alignment:Splign:1.39.8"
     variation       1568
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4988956"
     variation       1579
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151156973"
     variation       1580
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367543539"
     variation       1582
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200442848"
     variation       1587
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150294315"
     variation       1594
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201145282"
     variation       1598
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145147690"
     variation       1600
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111942110"
     variation       1636
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4988957"
     variation       1651
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112596146"
     variation       1669
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371424721"
     variation       1676
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114130235"
     variation       1685
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145303895"
     variation       1690
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73004242"
     variation       1720
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151022743"
     variation       1730
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372144350"
     variation       1772
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10192036"
     variation       1773
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10204137"
     variation       1792
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138992262"
     variation       1794
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201612691"
     variation       1804
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113360315"
     variation       1819
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181315872"
     variation       1827
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149593692"
     variation       1840
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369745219"
     variation       1846
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4988958"
     variation       1862
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373778810"
     variation       1917
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10192157"
     variation       1923
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10206753"
     variation       1951
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367840654"
     variation       1979
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371673572"
     variation       1996
                     /gene="IL1RL1"
                     /gene_synonym="DER4; FIT-1; IL33R; ST2; ST2L; ST2V; T1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367576518"
ORIGIN      
aaagagaggctggctgttgtatttagtaaagctataaagctgtaagagaaattggctttctgagttgtgaaactgtgggcagaaagttgaggaagaaagaactcaagtacaacccaatgaggttgagatataggctactcttcccaactcagtcttgaagagtatcaccaactgcctcatgtgtggtgaccttcactgtcgtatgccagtgactcatctggagtaatctcaacaacgagttaccaatacttgctcttgattgataaacagaatggggttttggatcttagcaattctcacaattctcatgtattccacagcagcaaagtttagtaaacaatcatggggcctggaaaatgaggctttaattgtaagatgtcctagacaaggaaaacctagttacaccgtggattggtattactcacaaacaaacaaaagtattcccactcaggaaagaaatcgtgtgtttgcctcaggccaacttctgaagtttctaccagctgcagttgctgattctggtatttatacctgtattgtcagaagtcccacattcaataggactggatatgcgaatgtcaccatatataaaaaacaatcagattgcaatgttccagattatttgatgtattcaacagtatctggatcagaaaaaaattccaaaatttattgtcctaccattgacctctacaactggacagcacctcttgagtggtttaagaattgtcaggctcttcaaggatcaaggtacagggcgcacaagtcatttttggtcattgataatgtgatgactgaggacgcaggtgattacacctgtaaatttatacacaatgaaaatggagccaattatagtgtgacggcgaccaggtccttcacggtcaaggatgagcaaggcttttctctgtttccagtaatcggagcccctgcacaaaatgaaataaaggaagtggaaattggaaaaaacgcaaacctaacttgctctgcttgttttggaaaaggcactcagttcttggctgccgtcctgtggcagcttaatggaacaaaaattacagactttggtgaaccaagaattcaacaagaggaagggcaaaatcaaagtttcagcaatgggctggcttgtctagacatggttttaagaatagctgacgtgaaggaagaggatttattgctgcagtacgactgtctggccctgaatttgcatggcttgagaaggcacaccgtaagactaagtaggaaaaatccaattgatcatcatagcatctactgcataattgcagtatgtagtgtatttttaatgctaatcaatgtcctggttatcatcctaaaaatgttctggattgaggccactctgctctggagagacatagctaaaccttacaagactaggaatgatggaaagctctatgatgcttatgttgtctacccacggaactacaaatccagtacagatggggccagtcgtgtagagcactttgttcaccagattctgcctgatgttcttgaaaataaatgtggctataccttatgcatttatgggagagatatgctacctggagaagatgtagtcactgcagtggaaaccaacatacgaaagagcaggcggcacattttcatcctgacccctcagatcactcacaataaggagtttgcctacgagcaggaggttgccctgcactgtgccctcatccagaacgacgccaaggtgatacttattgagatggaggctctgagcgagctggacatgctgcaggctgaggcgcttcaggactccctccagcatcttatgaaagtacaggggaccatcaagtggagggaggaccacattgccaataaaaggtccctgaattctaaattctggaagcacgtgaggtaccaaatgcctgtgccaagcaaaattcccagaaaggcctctagtttgactcccttggctgcccagaagcaatagtgcctgctgtgatgtgcaaaggcatctgagtttgaagctttcctgacttctcctagctggcttatgcccctgcactgaagtgtgaggagcaggaatattaaagggattcaggcctc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9173 -> Molecular function: GO:0002113 [interleukin-33 binding] evidence: IEA
            GeneID:9173 -> Molecular function: GO:0002114 [interleukin-33 receptor activity] evidence: IEA
            GeneID:9173 -> Molecular function: GO:0004896 [cytokine receptor activity] evidence: TAS
            GeneID:9173 -> Molecular function: GO:0004908 [interleukin-1 receptor activity] evidence: IEA
            GeneID:9173 -> Molecular function: GO:0005057 [receptor signaling protein activity] evidence: TAS
            GeneID:9173 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9173 -> Biological process: GO:0002826 [negative regulation of T-helper 1 type immune response] evidence: IEA
            GeneID:9173 -> Biological process: GO:0006955 [immune response] evidence: NAS
            GeneID:9173 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:9173 -> Biological process: GO:0032689 [negative regulation of interferon-gamma production] evidence: IEA
            GeneID:9173 -> Biological process: GO:0032754 [positive regulation of interleukin-5 production] evidence: IEA
            GeneID:9173 -> Biological process: GO:0043032 [positive regulation of macrophage activation] evidence: IEA
            GeneID:9173 -> Biological process: GO:0043124 [negative regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IEA
            GeneID:9173 -> Biological process: GO:0050729 [positive regulation of inflammatory response] evidence: IEA
            GeneID:9173 -> Biological process: GO:0090197 [positive regulation of chemokine secretion] evidence: IEA
            GeneID:9173 -> Cellular component: GO:0005576 [extracellular region] evidence: IEA
            GeneID:9173 -> Cellular component: GO:0009897 [external side of plasma membrane] evidence: IEA
            GeneID:9173 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.