GGRNA Home | Help | Advanced search

2020-10-24 06:10:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_016112               3060 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens polycystic kidney disease 2-like 1 (PKD2L1),
            transcript variant 1, mRNA.
ACCESSION   NM_016112
VERSION     NM_016112.2  GI:33598943
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3060)
  AUTHORS   Wu,J.H., Lemaitre,R.N., Manichaikul,A., Guan,W., Tanaka,T., Foy,M.,
            Kabagambe,E.K., Djousse,L., Siscovick,D., Fretts,A.M., Johnson,C.,
            King,I.B., Psaty,B.M., McKnight,B., Rich,S.S., Chen,Y.D.,
            Nettleton,J.A., Tang,W., Bandinelli,S., Jacobs,D.R. Jr.,
            Browning,B.L., Laurie,C.C., Gu,X., Tsai,M.Y., Steffen,L.M.,
            Ferrucci,L., Fornage,M. and Mozaffarian,D.
  TITLE     Genome-wide association study identifies novel loci associated with
            concentrations of four plasma phospholipid fatty acids in the de
            novo lipogenesis pathway: results from the Cohorts for Heart and
            Aging Research in Genomic Epidemiology (CHARGE) consortium
  JOURNAL   Circ Cardiovasc Genet 6 (2), 171-183 (2013)
   PUBMED   23362303
REFERENCE   2  (bases 1 to 3060)
  AUTHORS   Adachi,R., Sasaki,Y., Morita,H., Komai,M., Shirakawa,H., Goto,T.,
            Furuyama,A. and Isono,K.
  TITLE     Behavioral analysis of Drosophila transformants expressing human
            taste receptor genes in the gustatory receptor neurons
  JOURNAL   J. Neurogenet. 26 (2), 198-205 (2012)
   PUBMED   22794107
  REMARK    GeneRIF: This study demonistrated that human PKD2L play the role of
            food preference behavior.
REFERENCE   3  (bases 1 to 3060)
  AUTHORS   Molland,K.L., Paul,L.N. and Yernool,D.A.
  TITLE     Crystal structure and characterization of coiled-coil domain of the
            transient receptor potential channel PKD2L1
  JOURNAL   Biochim. Biophys. Acta 1824 (3), 413-421 (2012)
   PUBMED   22193359
  REMARK    GeneRIF: Trimerization may be important for both homo- and possibly
            heteromeric assemblies of PKD2L1.
REFERENCE   4  (bases 1 to 3060)
  AUTHORS   Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
            Gibbs,R.A. and Butte,N.F.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), E51954 (2012)
   PUBMED   23251661
REFERENCE   5  (bases 1 to 3060)
  AUTHORS   Demirkan,A., van Duijn,C.M., Ugocsai,P., Isaacs,A.,
            Pramstaller,P.P., Liebisch,G., Wilson,J.F., Johansson,A., Rudan,I.,
            Aulchenko,Y.S., Kirichenko,A.V., Janssens,A.C., Jansen,R.C.,
            Gnewuch,C., Domingues,F.S., Pattaro,C., Wild,S.H., Jonasson,I.,
            Polasek,O., Zorkoltseva,I.V., Hofman,A., Karssen,L.C.,
            Struchalin,M., Floyd,J., Igl,W., Biloglav,Z., Broer,L., Pfeufer,A.,
            Pichler,I., Campbell,S., Zaboli,G., Kolcic,I., Rivadeneira,F.,
            Huffman,J., Hastie,N.D., Uitterlinden,A., Franke,L., Franklin,C.S.,
            Vitart,V., Nelson,C.P., Preuss,M., Bis,J.C., O'Donnell,C.J.,
            Franceschini,N., Witteman,J.C., Axenovich,T., Oostra,B.A.,
            Meitinger,T., Hicks,A.A., Hayward,C., Wright,A.F., Gyllensten,U.,
            Campbell,H. and Schmitz,G.
  CONSRTM   DIAGRAM Consortium; CARDIoGRAM Consortium; CHARGE Consortium;
            EUROSPAN consortium
  TITLE     Genome-wide association study identifies novel loci associated with
            circulating phospho- and sphingolipid concentrations
  JOURNAL   PLoS Genet. 8 (2), E1002490 (2012)
   PUBMED   22359512
REFERENCE   6  (bases 1 to 3060)
  AUTHORS   Veldhuisen,B., Spruit,L., Dauwerse,H.G., Breuning,M.H. and
            Peters,D.J.
  TITLE     Genes homologous to the autosomal dominant polycystic kidney
            disease genes (PKD1 and PKD2)
  JOURNAL   Eur. J. Hum. Genet. 7 (8), 860-872 (1999)
   PUBMED   10602361
REFERENCE   7  (bases 1 to 3060)
  AUTHORS   Chen,X.Z., Vassilev,P.M., Basora,N., Peng,J.B., Nomura,H.,
            Segal,Y., Brown,E.M., Reeders,S.T., Hediger,M.A. and Zhou,J.
  TITLE     Polycystin-L is a calcium-regulated cation channel permeable to
            calcium ions
  JOURNAL   Nature 401 (6751), 383-386 (1999)
   PUBMED   10517637
REFERENCE   8  (bases 1 to 3060)
  AUTHORS   Tsiokas,L., Arnould,T., Zhu,C., Kim,E., Walz,G. and Sukhatme,V.P.
  TITLE     Specific association of the gene product of PKD2 with the TRPC1
            channel
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 96 (7), 3934-3939 (1999)
   PUBMED   10097141
REFERENCE   9  (bases 1 to 3060)
  AUTHORS   Wu,G., Hayashi,T., Park,J.H., Dixit,M., Reynolds,D.M., Li,L.,
            Maeda,Y., Cai,Y., Coca-Prados,M. and Somlo,S.
  TITLE     Identification of PKD2L, a human PKD2-related gene: tissue-specific
            expression and mapping to chromosome 10q25
  JOURNAL   Genomics 54 (3), 564-568 (1998)
   PUBMED   9878261
REFERENCE   10 (bases 1 to 3060)
  AUTHORS   Nomura,H., Turco,A.E., Pei,Y., Kalaydjieva,L., Schiavello,T.,
            Weremowicz,S., Ji,W., Morton,C.C., Meisler,M., Reeders,S.T. and
            Zhou,J.
  TITLE     Identification of PKDL, a novel polycystic kidney disease 2-like
            gene whose murine homologue is deleted in mice with kidney and
            retinal defects
  JOURNAL   J. Biol. Chem. 273 (40), 25967-25973 (1998)
   PUBMED   9748274
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF073481.1 and AF053316.1.
            On Aug 12, 2003 this sequence version replaced gi:7706638.
            
            Summary: This gene encodes a member of the polycystin protein
            family. The encoded protein contains multiple transmembrane
            domains, and cytoplasmic N- and C-termini. The protein may be an
            integral membrane protein involved in cell-cell/matrix
            interactions. This protein functions as a calcium-regulated
            nonselective cation channel. Two transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Dec 2011].
            
            Transcript Variant: This variant (1) encodes the longer isoform
            (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF073481.1, BC025665.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..3060
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q24"
     gene            1..3060
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /note="polycystic kidney disease 2-like 1"
                     /db_xref="GeneID:9033"
                     /db_xref="HGNC:9011"
                     /db_xref="HPRD:16063"
                     /db_xref="MIM:604532"
     exon            1..618
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    339..341
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /note="upstream in-frame stop codon"
     CDS             384..2801
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /note="isoform 1 is encoded by transcript variant 1;
                     transient receptor potential cation channel, subfamily P,
                     member 3; polycystin-L; polycystic kidney disease 2-like 1
                     protein; polycystin-L1; polycystin-2L1; polycystin-2
                     homolog"
                     /codon_start=1
                     /product="polycystic kidney disease 2-like 1 protein
                     isoform 1"
                     /protein_id="NP_057196.2"
                     /db_xref="GI:33598944"
                     /db_xref="CCDS:CCDS7492.1"
                     /db_xref="GeneID:9033"
                     /db_xref="HGNC:9011"
                     /db_xref="HPRD:16063"
                     /db_xref="MIM:604532"
                     /translation="
MNAVGSPEGQELQKLGSGAWDNPAYSGPPSPHGTLRVCTISSTGPLQPQPKKPEDEPQETAYRTQVSSCCLHICQGIRGLWGTTLTENTAENRELYIKTTLRELLVYIVFLVDICLLTYGMTSSSAYYYTKVMSELFLHTPSDTGVSFQAISSMADFWDFAQGPLLDSLYWTKWYNNQSLGHGSHSFIYYENMLLGVPRLRQLKVRNDSCVVHEDFREDILSCYDVYSPDKEEQLPFGPFNGTAWTYHSQDELGGFSHWGRLTSYSGGGYYLDLPGSRQGSAEALRALQEGLWLDRGTRVVFIDFSVYNANINLFCVLRLVVEFPATGGAIPSWQIRTVKLIRYVSNWDFFIVGCEVIFCVFIFYYVVEEILELHIHRLRYLSSIWNILDLVVILLSIVAVGFHIFRTLEVNRLMGKLLQQPNTYADFEFLAFWQTQYNNMNAVNLFFAWIKIFKYISFNKTMTQLSSTLARCAKDILGFAVMFFIVFFAYAQLGYLLFGTQVENFSTFIKCIFTQFRIILGDFDYNAIDNANRILGPAYFVTYVFFVFFVLLNMFLAIINDTYSEVKEELAGQKDELQLSDLLKQGYNKTLLRLRLRKERVSDVQKVLQGGEQEIQFEDFTNTLRELGHAEHEITELTATFTKFDRDGNRILDEKEQEKMRQDLEEERVALNTEIEKLGRSIVSSPQGKSGPEAARAGGWVSGEEFYMLTRRVLQLETVLEGVVSQIDAVGSKLKMLERKGWLAPSPGVKEQAIWKHPQPAPAVTPDPWGVQGGQESEVPYKREEEALEERRLSRGEIPTLQRS
"
     misc_feature    693..755
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     misc_feature    819..2084
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /note="Polycystin cation channel; Region: PKD_channel;
                     pfam08016"
                     /db_xref="CDD:203839"
     misc_feature    966..1004
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     Region: Polycystin motif"
     misc_feature    1323..1385
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     misc_feature    1425..1487
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     misc_feature    1536..1598
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     misc_feature    1812..1874
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     misc_feature    2001..2063
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9P0L9.1);
                     transmembrane region"
     variation       581
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569511"
     exon            619..732
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            733..860
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            861..1114
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     variation       999
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2305383"
     exon            1115..1339
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            1340..1568
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     variation       1560
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2278842"
     exon            1569..1739
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            1740..1921
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            1922..2042
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2043..2141
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2142..2263
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2264..2390
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2391..2509
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2510..2633
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2634..2718
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     exon            2719..3051
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    3029..3034
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
     polyA_site      3051
                     /gene="PKD2L1"
                     /gene_synonym="PCL; PKD2L; PKDL; TRPP3"
ORIGIN      
cagcatcgccttttcctcccgtttctccttccactcccagctccacatcctcctcctattctcccctctcccctcttcaaacccccaccttccagttccctcacctcccctttcggctggtcccctggggcttgcagcaagagggagagagagctcctgacaggattgatggtccttccccaccctgtcctctcatccgctccctccccagcaggcacagacatccccctacaaaaggcaggagcccaggctgtgtggaaacagctgctctcagacgcctttccatttgctctctgctggctaggctgggctgtgcctctgctccctcttcctctagctgagagtgggcacctggggtaccgggcccccccacctcattccccatgaatgctgtgggaagtcctgaggggcaggagctgcaaaagctggggagtggagcctgggacaaccccgcctacagtggtcccccttccccacacgggacgctgagagtctgcaccatctccagcacggggcctctccagccccaacccaagaagcctgaagatgaaccccaggagacggcatacaggacccaggtgtccagctgctgcctccatatctgtcaaggcatcagaggactttggggaacaaccctgactgagaacacagctgagaaccgggaactttatatcaagaccaccctgagggagctgttggtatatattgtgttcctggtggacatctgtctactgacctatggaatgacaagctccagtgcttattactacaccaaagtgatgtctgagctcttcttacatactccatcagacactggagtctcctttcaggccatcagcagcatggcggacttctgggattttgcccagggcccactactggacagtttgtattggaccaaatggtacaacaaccagagcctgggccatggctcccactccttcatctactatgagaacatgctgctgggggttccgaggctgcggcagctaaaggtccgcaatgactcctgtgtggtgcatgaagacttccgggaggacattctgagctgctatgatgtctactctccagacaaagaagaacaactcccctttgggcccttcaatggcacagcgtggacataccactcgcaggatgagttggggggcttctcccactggggcaggctcacaagctacagcggaggtggctactacctggaccttccaggatcccgacagggtagtgcagaggctctccgggcccttcaggaggggctgtggctggacaggggcactcgagtggtgttcatcgacttctcagtctacaatgccaatatcaatcttttctgtgtcctgaggctggtggtggagtttccagctacaggaggtgccatcccatcctggcaaatccgcacagtcaagctgatccgctatgtcagcaactgggacttctttatcgttggctgtgaggtcatcttctgcgtcttcatcttctactatgtggtggaagagatcctggagctccacattcaccggcttcgctacctcagcagcatctggaacatactggacctggtggtcatcttgctctccattgtggctgtgggcttccacatattccgaaccctcgaggtgaatcggctcatggggaagctcctgcagcagccaaacacgtatgcagactttgagttcctcgccttctggcagacacagtacaacaacatgaatgctgtcaacctcttcttcgcctggatcaagatattcaagtacatcagcttcaacaaaaccatgacccagctctcctccacgctggcccgctgtgccaaggacatcctgggcttcgccgtcatgttcttcattgttttcttcgcctatgcccaactcggctacctgcttttcgggacccaagtggaaaactttagcactttcatcaagtgcattttcactcagttccggataatcctcggggactttgactacaatgctatcgacaatgccaaccgcatcctgggccctgcctactttgtcacctatgtcttcttcgtcttcttcgtgctcctgaacatgttcctggccatcatcaatgacacatattcagaggtcaaggaggagctggctggacagaaggatgagctgcaactttctgacctcctgaaacagggctacaacaagaccctactaagactgcgtctgaggaaggagagggtttcggatgtgcagaaggtcctgcagggtggggagcaggagatccagtttgaggatttcaccaacaccttaagggaactgggacacgcagagcatgaaatcactgagctcacggccaccttcaccaagtttgacagagatgggaatcgtattctggatgagaaggaacaggaaaaaatgcgacaggacctggaggaagagagggtggccctcaacactgagattgagaaactaggccgatctattgtgagcagcccacaaggcaaatcgggtccagaggctgccagagcaggaggctgggtttcaggagaagaattctacatgctcacaaggagagttctgcagctggagactgtcctggaaggagtagtgtcccagattgatgctgtaggctcaaagctgaaaatgctggagaggaaggggtggctggctccctccccaggcgtgaaggaacaagctatttggaagcacccgcagccagccccagctgtgaccccagacccctggggagtccagggtgggcaggagagtgaggttccctataaaagagaagaggaagccttagaggagaggagactctcccgtggtgagattccaacgttgcagaggagttaagtgtgaggcactcccggagcaaagtctatgaaggatcttctgcaagaggctgcctcctggtccactgaacctggaaactgagtgggctttaaccaggagataaaaatggagcctgaagggaatcaggcaaggaaatgaactcaggattcagagatctttgaattaatatgtggtgggttctgacattattcttccataagaccatgtgggtttccatggtggctatcaataaaactccttaggaaaacttaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9033 -> Molecular function: GO:0005227 [calcium activated cation channel activity] evidence: IDA
            GeneID:9033 -> Molecular function: GO:0005261 [cation channel activity] evidence: IDA
            GeneID:9033 -> Molecular function: GO:0005262 [calcium channel activity] evidence: IBA
            GeneID:9033 -> Molecular function: GO:0005272 [sodium channel activity] evidence: IDA
            GeneID:9033 -> Molecular function: GO:0005509 [calcium ion binding] evidence: ISS
            GeneID:9033 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9033 -> Molecular function: GO:0008092 [cytoskeletal protein binding] evidence: IPI
            GeneID:9033 -> Molecular function: GO:0008324 [cation transmembrane transporter activity] evidence: ISS
            GeneID:9033 -> Molecular function: GO:0015269 [calcium-activated potassium channel activity] evidence: IDA
            GeneID:9033 -> Molecular function: GO:0033040 [sour taste receptor activity] evidence: ISS
            GeneID:9033 -> Molecular function: GO:0042802 [identical protein binding] evidence: ISS
            GeneID:9033 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:9033 -> Molecular function: GO:0051393 [alpha-actinin binding] evidence: IPI
            GeneID:9033 -> Biological process: GO:0001581 [detection of chemical stimulus involved in sensory perception of sour taste] evidence: ISS
            GeneID:9033 -> Biological process: GO:0006812 [cation transport] evidence: ISS
            GeneID:9033 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
            GeneID:9033 -> Biological process: GO:0050982 [detection of mechanical stimulus] evidence: IBA
            GeneID:9033 -> Biological process: GO:0070588 [calcium ion transmembrane transport] evidence: IBA
            GeneID:9033 -> Biological process: GO:0071468 [cellular response to acidity] evidence: ISS
            GeneID:9033 -> Biological process: GO:0071805 [potassium ion transmembrane transport] evidence: IDA
            GeneID:9033 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: ISS
            GeneID:9033 -> Cellular component: GO:0005886 [plasma membrane] evidence: IMP
            GeneID:9033 -> Cellular component: GO:0009986 [cell surface] evidence: ISS
            GeneID:9033 -> Cellular component: GO:0016021 [integral to membrane] evidence: NAS
            GeneID:9033 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.