GGRNA Home | Help | Advanced search

2019-03-26 15:04:22, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_016009               6382 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1),
            transcript variant 1, mRNA.
ACCESSION   NM_016009
VERSION     NM_016009.4  GI:331284128
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6382)
  AUTHORS   Runkle,K.B., Meyerkord,C.L., Desai,N.V., Takahashi,Y. and Wang,H.G.
  TITLE     Bif-1 suppresses breast cancer cell migration by promoting EGFR
            endocytic degradation
  JOURNAL   Cancer Biol. Ther. 13 (10), 956-966 (2012)
   PUBMED   22785202
  REMARK    GeneRIF: these data suggest a novel function for Bif-1 as a
            suppressor of breast cancer cell migration by promoting EGFR
            degradation through the regulation of endosome maturation
REFERENCE   2  (bases 1 to 6382)
  AUTHORS   Coppola,D., Helm,J., Ghayouri,M., Malafa,M.P. and Wang,H.G.
  TITLE     Down-regulation of Bax-interacting factor 1 in human pancreatic
            ductal adenocarcinoma
  JOURNAL   Pancreas 40 (3), 433-437 (2011)
   PUBMED   21283040
  REMARK    GeneRIF: The expression of Bif-1 is downregulated in a subset of
            pancreatic ductal adenocarcinoma. This novel finding is in
            agreement with the tumor suppressor function of Bif-1.
REFERENCE   3  (bases 1 to 6382)
  AUTHORS   Takahashi,Y., Meyerkord,C.L., Hori,T., Runkle,K., Fox,T.E.,
            Kester,M., Loughran,T.P. and Wang,H.G.
  TITLE     Bif-1 regulates Atg9 trafficking by mediating the fission of Golgi
            membranes during autophagy
  JOURNAL   Autophagy 7 (1), 61-73 (2011)
   PUBMED   21068542
  REMARK    GeneRIF: These findings suggest that Bif-1 acts as a critical
            regulator of Atg9 puncta formation presumably by mediating Golgi
            fission for autophagosome biogenesis during starvation.
REFERENCE   4  (bases 1 to 6382)
  AUTHORS   Thoresen,S.B., Pedersen,N.M., Liestol,K. and Stenmark,H.
  TITLE     A phosphatidylinositol 3-kinase class III sub-complex containing
            VPS15, VPS34, Beclin 1, UVRAG and BIF-1 regulates cytokinesis and
            degradative endocytic traffic
  JOURNAL   Exp. Cell Res. 316 (20), 3368-3378 (2010)
   PUBMED   20643123
  REMARK    GeneRIF: SH3GLB1
REFERENCE   5  (bases 1 to 6382)
  AUTHORS   Karbowski,M., Jeong,S.Y. and Youle,R.J.
  TITLE     Endophilin B1 is required for the maintenance of mitochondrial
            morphology
  JOURNAL   J. Cell Biol. 166 (7), 1027-1039 (2004)
   PUBMED   15452144
  REMARK    GeneRIF: Double knockdown of endophilin B1 and Drp1 leads to a
            mitochondrial phenotype identical to that of the Drp1 single
            knockdown, a result consistent with Drp1 acting upstream of
            endophilin B1 in the maintenance of morphological dynamics of
            mitochondria.
REFERENCE   6  (bases 1 to 6382)
  AUTHORS   Lee,S.Y., Wenk,M.R., Kim,Y., Nairn,A.C. and De Camilli,P.
  TITLE     Regulation of synaptojanin 1 by cyclin-dependent kinase 5 at
            synapses
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (2), 546-551 (2004)
   PUBMED   14704270
REFERENCE   7  (bases 1 to 6382)
  AUTHORS   Modregger,J., Schmidt,A.A., Ritter,B., Huttner,W.B. and Plomann,M.
  TITLE     Characterization of Endophilin B1b, a brain-specific
            membrane-associated lysophosphatidic acid acyl transferase with
            properties distinct from endophilin A1
  JOURNAL   J. Biol. Chem. 278 (6), 4160-4167 (2003)
   PUBMED   12456676
REFERENCE   8  (bases 1 to 6382)
  AUTHORS   Cuddeback,S.M., Yamaguchi,H., Komatsu,K., Miyashita,T., Yamada,M.,
            Wu,C., Singh,S. and Wang,H.G.
  TITLE     Molecular cloning and characterization of Bif-1. A novel Src
            homology 3 domain-containing protein that associates with Bax
  JOURNAL   J. Biol. Chem. 276 (23), 20559-20565 (2001)
   PUBMED   11259440
REFERENCE   9  (bases 1 to 6382)
  AUTHORS   Pierrat,B., Simonen,M., Cueto,M., Mestan,J., Ferrigno,P. and
            Heim,J.
  TITLE     SH3GLB, a new endophilin-related protein family featuring an SH3
            domain
  JOURNAL   Genomics 71 (2), 222-234 (2001)
   PUBMED   11161816
REFERENCE   10 (bases 1 to 6382)
  AUTHORS   Howard,L., Nelson,K.K., Maciewicz,R.A. and Blobel,C.P.
  TITLE     Interaction of the metalloprotease disintegrins MDC9 and MDC15 with
            two SH3 domain-containing proteins, endophilin I and SH3PX1
  JOURNAL   J. Biol. Chem. 274 (44), 31693-31699 (1999)
   PUBMED   10531379
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB038227.1, AF350371.1,
            AL049597.29 and AI936794.1.
            On Apr 30, 2011 this sequence version replaced gi:108936948.
            
            Summary: This gene encodes a SRC homology 3 domain-containing
            protein. The encoded protein interacts with the proapoptotic member
            of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be
            involved in regulating apoptotic signaling pathways. This protein
            may also be involved in maintaining mitochondrial morphology.
            Alternate splicing results in multiple transcript variants.
            [provided by RefSeq, Sep 2011].
            
            Transcript Variant: This variant (1) is a predominant transcript
            and encodes isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB007960.2, AK001954.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-251               DB038227.1         1-251
            252-1779            AF350371.1         3-1530
            1780-5872           AL049597.29        60580-64672         c
            5873-6382           AI936794.1         1-510               c
FEATURES             Location/Qualifiers
     source          1..6382
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p22"
     gene            1..6382
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="SH3-domain GRB2-like endophilin B1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="HPRD:15333"
                     /db_xref="MIM:609287"
     exon            1..402
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       59
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370826328"
     variation       122
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375428554"
     variation       165
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58494650"
     variation       241
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:263438"
     misc_feature    250..252
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="upstream in-frame stop codon"
     variation       259
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11544892"
     variation       262
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369632914"
     variation       312
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373829970"
     CDS             331..1428
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="isoform 1 is encoded by transcript variant 1;
                     Bax-interacting factor 1; SH3-containing protein SH3GLB1;
                     SH3 domain-containing GRB2-like protein B1; protein
                     phosphatase 1, regulatory subunit 70"
                     /codon_start=1
                     /product="endophilin-B1 isoform 1"
                     /protein_id="NP_057093.1"
                     /db_xref="GI:7705773"
                     /db_xref="CCDS:CCDS710.1"
                     /db_xref="GeneID:51100"
                     /db_xref="HGNC:10833"
                     /db_xref="HPRD:15333"
                     /db_xref="MIM:609287"
                     /translation="
MNIMDFNVKKLAADAGTFLSRAVQFTEEKLGQAEKTELDAHLENLLSKAECTKIWTEKIMKQTEVLLQPNPNARIEEFVYEKLDRKAPSRINNPELLGQYMIDAGTEFGPGTAYGNALIKCGETQKRIGTADRELIQTSALNFLTPLRNFIEGDYKTIAKERKLLQNKRLDLDAAKTRLKKAKAAETRNSSEQELRITQSEFDRQAEITRLLLEGISSTHAHHLRCLNDFVEAQMTYYAQCYQYMLDLQKQLGSFPSNYLSNNNQTSVTPVPSVLPNAIGSSAMASTSGLVITSPSNLSDLKECSGSRKARVLYDYDAANSTELSLLADEVITVFSVVGMDSDWLMGERGNQKGKVPITYLELLN
"
     misc_feature    331..420
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y371.1);
                     Region: Membrane-binding amphipathic helix"
     misc_feature    385..1092
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="BAR domain; Region: BAR; smart00721"
                     /db_xref="CDD:128960"
     misc_feature    400..1086
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="The Bin/Amphiphysin/Rvs (BAR) domain of
                     Endophilin-B1; Region: BAR_Endophilin_B1; cd07616"
                     /db_xref="CDD:153300"
     misc_feature    order(472..474,481..486,496..498,502..507,514..519,
                     523..528,607..612,616..621,628..633,637..642,649..651,
                     691..693,700..705,970..972,979..984,988..990,1000..1002,
                     1009..1014,1018..1023,1030..1035,1042..1047,1051..1056,
                     1063..1068,1072..1077)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:153300"
     misc_feature    order(550..552,796..798,808..810,817..819,832..837,
                     862..864,871..873,916..918)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="putative membrane interaction site; other site"
                     /db_xref="CDD:153300"
     misc_feature    763..765
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by CDK5; propagated from
                     UniProtKB/Swiss-Prot (Q9Y371.1); phosphorylation site"
     misc_feature    1243..1425
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="Src homology 3 domain of Endophilin-B1; Region:
                     SH3_Endophilin_B1; cd11945"
                     /db_xref="CDD:212878"
     misc_feature    order(1270..1272,1276..1278,1285..1287,1297..1299,
                     1357..1362,1399..1401,1405..1410)
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212878"
     variation       341
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199927597"
     variation       354
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150324653"
     exon            403..544
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       420
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199985974"
     variation       465
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137962528"
     variation       470
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369632434"
     exon            545..673
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       545
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201622706"
     variation       602
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143094715"
     variation       605
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142378035"
     variation       626
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369336536"
     variation       629
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139332321"
     variation       647
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12035024"
     exon            674..807
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       675
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371476786"
     variation       700
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150243965"
     variation       739
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112687194"
     variation       802
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150004536"
     variation       805
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202154654"
     variation       806
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144540011"
     exon            808..900
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       821
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371893206"
     variation       823
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376780189"
     variation       848
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201518937"
     variation       852
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34037709"
     variation       891
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140791791"
     exon            901..990
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       909
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200907097"
     variation       941
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370892729"
     variation       986
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375726643"
     exon            991..1091
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       1023
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367856961"
     exon            1092..1320
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     variation       1101
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568763"
     variation       1110
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368697600"
     variation       1111
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898007"
     variation       1134
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371821126"
     variation       1146
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199954740"
     variation       1271
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138533867"
     variation       1293
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143210569"
     variation       1301
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113079556"
     exon            1321..6377
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /inference="alignment:Splign:1.39.8"
     STS             1324..1455
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D1S3283"
                     /db_xref="UniSTS:73729"
     variation       1389
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369315549"
     variation       1433
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200149176"
     variation       1436
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371139653"
     variation       1463
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7805"
     variation       1493
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182277538"
     variation       1541
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186477456"
     variation       1547
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372453155"
     variation       1555
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192547923"
     variation       1570
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115786910"
     variation       1588
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118078895"
     variation       1744
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055807"
     polyA_signal    1760..1765
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      1782
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     variation       2014..2015
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:369144718"
     variation       2135
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146178664"
     variation       2168
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:263476"
     variation       2234..2235
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:148528174"
     variation       2244
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370236588"
     variation       2265
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74635891"
     variation       2266
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184671274"
     variation       2271
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115686750"
     variation       2303
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80179040"
     variation       2321
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190177169"
     variation       2327
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139775213"
     variation       2336
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193068181"
     variation       2367
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17129455"
     variation       2392
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:372495516"
     variation       2403
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116809966"
     variation       2460
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370921223"
     variation       2524
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:71660692"
     variation       2650
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74097437"
     variation       2659
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114006993"
     variation       2711
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148772273"
     variation       2776
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189926701"
     variation       2800
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181084322"
     variation       2883
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142377175"
     variation       2885
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6693019"
     variation       3034..3036
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="ttc"
                     /db_xref="dbSNP:374106896"
     variation       3065
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185347963"
     variation       3087
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151286456"
     variation       3244
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375815130"
     variation       3259
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287733"
     variation       3275
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140493017"
     variation       3344
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188250289"
     variation       3400
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182063957"
     variation       3442
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187273072"
     variation       3453
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191719770"
     variation       3711..3712
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34167887"
     variation       3737
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147045004"
     variation       3806
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183730198"
     variation       3839..3840
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:36110352"
     variation       3929
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:41287735"
     variation       4126
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147661424"
     variation       4199
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186643470"
     variation       4279
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190126132"
     variation       4282..4283
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201785649"
     variation       4333
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372613370"
     variation       4438
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182401439"
     variation       4450
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10489890"
     variation       4526
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369595750"
     variation       4541
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74851582"
     variation       4610
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112702619"
     variation       4624
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72961649"
     variation       4651
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186807942"
     variation       4758
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41287737"
     STS             4854..4981
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="D15S1477"
                     /db_xref="UniSTS:474482"
     variation       4964
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189701711"
     variation       5032
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142324982"
     variation       5123
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113438342"
     variation       5127
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147012806"
     variation       5163
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184011272"
     variation       5444
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376906"
     variation       5488
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188996159"
     variation       5492
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113225472"
     variation       5509
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10446"
     STS             5534..5644
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /standard_name="SHGC-75080"
                     /db_xref="UniSTS:44451"
     variation       5589
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138062316"
     variation       5654
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74632026"
     variation       5692
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11293484"
     variation       5692
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75427542"
     variation       5693
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79757555"
     variation       5694
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112330637"
     variation       5694
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201436487"
     variation       5834
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74097438"
     variation       5887
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149522642"
     variation       5922
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201221938"
     variation       5987
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7523137"
     variation       6071
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11544893"
     variation       6125
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193042715"
     variation       6187
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371895650"
     variation       6229
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143128170"
     variation       6231
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185293609"
     variation       6261..6265
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="tatat"
                     /db_xref="dbSNP:71789713"
     variation       6312..6316
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="atttt"
                     /db_xref="dbSNP:141790894"
     variation       6338
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35844916"
     variation       6354..6355
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:373436380"
     polyA_signal    6357..6362
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
     polyA_site      6377
                     /gene="SH3GLB1"
                     /gene_synonym="Bif-1; CGI-61; dJ612B15.2; PPP1R70"
ORIGIN      
gcgcttgtttttcccttgggacccgggtccacacggcggggtcgcccgtccatctccggctcgcccgcggggcccatcgtcgacgttagcggccgttctccgagccgactgacccatccttggcgctgccgccgcgcgcttgttctcctccctcgccccgccttcatcctccccgttcacggaaacgacagctgcggctgcggggctggcgccgcctccctccacctaccacgtctgccctcgccgctctagccctgcgccccagcccggccgcggcacctccgcctcgccgccgctaggtcggccggctccgcccggctgccgcctaggatgaatatcatggacttcaacgtgaagaagctggcggccgacgcaggcaccttcctcagtcgcgccgtgcagttcacagaagaaaagcttggccaggctgagaagacagaattggatgctcacttagagaacctccttagcaaagctgaatgtaccaaaatatggacagaaaaaataatgaaacaaactgaagtgttattgcagccaaatccaaatgccaggatagaagaatttgtttatgagaaactggatagaaaagctccaagtcgtataaacaacccagaacttttgggacaatatatgattgatgcagggactgagtttggcccaggaacagcttatggtaatgcccttattaaatgtggagaaacccaaaaaagaattggaacagcagacagagaactgattcaaacgtcagccttaaattttcttactcctttaagaaactttatagaaggagattacaaaacaattgctaaagaaaggaaactattgcaaaataagagactggatttggatgctgcaaaaacgagactaaaaaaggcaaaagctgcagaaactagaaattcatctgaacaggaattaagaataactcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaatcagcagtacacatgcccatcaccttcgctgtctgaatgactttgtagaagcccagatgacttactatgcacagtgttaccagtatatgttggacctccagaaacaactgggaagttttccatccaattatcttagtaacaacaatcagacttctgtgacacctgtaccatcagttttaccaaatgcgattggttcttctgccatggcttcaacaagtggcctagtaatcacctctccttccaacctcagtgaccttaaggagtgtagtggcagcagaaaggccagggttctctatgattatgatgcagcaaacagtactgaattatcacttctggcagatgaggtgatcactgtgttcagtgttgttggaatggattcagactggctaatgggggaaaggggaaaccagaagggcaaggtgccaattacctacttagaactgctcaattaagtaggtggactatggaaaggttgcccatcatgactttgtatttatatacaattaactctaaataaagcaggttaagtatcttccatgttaatgtgttaagagactgaaaataccagccatcagaaactggcctttctgccaataaagttgcatggtaaatatttcattacagaatttatgttagagctttcatgccaagaatgttttcttacaaaattctctttttattgaggtttcactaataagcagcttctacttttgagcctcaacttaaagcagaactgttttctactggatttttcattaacagcaagctttttcttttatgtaaaataaatctattgtgaattgatatcagcgactcatttattaggtataaataatagccaaagaataaaattaaaatttattttaaactttcggtcttaaaaagagctgtaggatataaacctcttttgtgaaaagtagaattttctgaatgctttcatagacaaaaacgcatttaaactatgtttacctggttttccaacagaaatcaaatgattttaatattatgttttgatgggttattttcagagttgtttggttttttaaacactactgaatggtttcttttaaatttaagaacaactagttcttgaaaagcaataccgtatttctctgataaatttgtagttaaggttctagaaaatctaggacaaatttacttcattaaacataaagtttttaagattattcagttggcacaatttaatgcataattgggattggatccatttactgtactgtggtacagtaaagagaatgtgttcttattgaacagcagatttgtatacaaatacggaataatgcaactacattataaattgtatacgaacaaaataaattgggtcactctgagcttactattaaaacattgaaaatttattaatgaacacaggctatcttgatgaggatctctgcttatgaaacacatactaatgaaattattagtgacacattggaagctagaaaattgctgttggggccattgctataaatcattgtttccatgttaagacttctgttctaattcattcattcaacaaacatttgttgagggccagatactgtgctggtcaactggggatactgtcctgaacaatatgcacacagttcttgcccctgcagagcttaaagaccattaaaggatacagaaaattaagcaattatcctatagtaggattcgtggtgtgatggggaaaatacaaggtactgtatttgggagtcatgtaactccagttttgggagtgagagagggtctggggaagaactgttccagataaaaagatgtgtaaccaagatagcatagcacattctgacaactaaagcaatttactctaacttaagcatgaagtacaaaagtatagttcatttattgagggaatgttaagctattaaaatgatactttttggtacttttaaaaaaatgaatacttaaacaccgttttaaaattttgtgttaagagctcctaataagaacttggtaaacatgttgacaatttaactcacagtctaaactttaaaagtagtagttacccttttatttctgtgccatgagacaaattcttctgcagttttatagttgtacaagatgttttgactcactctcaattgccatattcttaaagaaaccctgaaaagctgctcaagctggtcagttttctgtaaaaccaagtaaatgaaattttctctcccctcagaaaggaagttctacagcctagagtaccatctattgtgttttataagtccagatttaggctttgaaagatcataccaaaacttcagatcgacttaaacagcaactatgaattaggtttatgggaaatgtagtaatacaggggaaagaatatcggtaatggagtgaaatggtcctgggttcaaatccagtcttcctcacatattgtgctctttaagcttcaaatgagatgtataactgccttttccttaccagtaaaatgaggacaataattatgacaccatagggtggttgtgaggattagcaaatgttatcttgtatttcaggtgcctttcagggaaaggcttggcacatagtaaacacatcctgtaaatatcagtttccccttgttagcccctgtagcatcctgacctaccaagtctataggccttgcatatcactgtgcaccagagatacctcttttacatctgggctctgttttctctctatcaatcctatcctccaccctctttaaatcagaccccaggtttaaccttcccacagtcagtataaatcatttttcagaactttcagctttccatcaagtgaaagttgattttagttacccagtaatgtacagaaaccttcaataatgttaagcttcaaaggcttctggtacgtttgtctaccacagaaccaccacaatatatatgcttgttcttaggtttattgctttttattttaatggggtttggttgtttgggttttattttggttttggcttattttaaagtcaagtttagtttttactcaggtaaaggcctgaagtttcttgggcgtggaagaaaaagcttgggaagcctattaattcatggtgcagttcagaattgtttaaataagctctgtgccactgagcttaatctgaaagtatagtgacatgtgaaggatgcacatatgaatgaaaaactaaaataattgtaggctcttctataaatgaaaaaaaaagtgattggattgtgtctacctttttcctcaaagtaatctaacctaaacggtcatggtgttaaaactttttatggtgctaatcagaaaaattgatgttgcaagaaatgaggtctcaaaaatgggaatgtgcctcctcactctgcgtcacatgggaaataaatcctgaggccaggatcaccagtggggtagagtcatcttcatagtctcctgttatcctccccctgaacaaagaacaaagtgagactgggaagctagtgttggggaaacatttctgggataaactgtggagtggagaagacaatggagggcaaggcaaaaacccacagacttgtttacccatagaggccccactcacctccatgctgacagaattccagaaaaattccttccctatctcccaaacacctgaaattctgaaatattgccctactatttagcactttaagcttcagtgaggtgctgtaatggagagatagcttcatagtttagcctatagccaactttgcctcaagacctccagataagatgaagtggcttttacctcatgtgagtctcaaacgctggagagagagttccacaaccacccctgccctttctcccatattacgctcattagaaagtctactcagggctgggtgccgtggctcatgcctgtaatcccagcactttggaggctgaggcgggtggatcatctgaggtcaggagttcgagaccagcctggccaacatggggaaaccctgtctctactgaaaatataaaaattagccgggcatggtggcgtgcacctgtaattccagctactcgggaggctgaggcaggagaatcacttgaaccccagaggcagaggctacagtgagccaagattgcaccactgcactccaacctgggtgatagaataagactcttgtctcaaggaaagaaaaaatgtctactcagtagagcagtgattggcaaagtgtgagaccccagaccggcaatattggcatctcctggagacttgtttaaaatgctgattactattttcaagaactttctaccttcatttttacttattttttgttttcaagggctcatggaatcagtcttccatgtgacagctttttaaatattttaagacaaaaactgagtcttctaatcttaattgtgttctagcagtagtcattgtaattatagttatttttataatttatttgtttagtgtatatctgtcactctagaatgtaggctccctgagataaaaactataattcttttgatggcagttacattcccaactcttagcacaagatctaggacatagtatgaactcaataaatttttgttgaatgaaagaaaaatgcaaatttataagccttttcagagacctactgaatcaaactctgagagtggagcccagcaatctgttgtaaaagctgtttgagtaatactgttgcactctaagcttgagaaccactgcaatagaactaagagaacattcatttcaccttcaggcctattctctgacatcacttgaaaaatcctctctgccttctgtaacccttaaccaacaacagtgccctgtccatgtaggggaaacttctgggctgtattacaagtgggtaggaaggtataaggatatcatagtgggaagtattgcttagaatgccagtacttgtttgctgtggaaggtttctaggaatggattgcttagtctaaagtaagcactaccaccatccacgttttcactcaacacagtgccttttaattggtgactaacatcaaaacaccttgacaaaccgttaaaacagtatcagaaaccatgtgtacatccctgtgcctcttagattgctaagttctgctctcattcttacttcaaaggacactttttaaagaattgttaatgcttttttataatacaagtcatagccctgttggcaaaaagaaaaaagattcagtgagaaagaaaaatcactgataattccatcatccagggagaaccactgttatttaagtatatggccttccagacttttctgtgcatttatagatatttttaatgggatcaaagtgtacatactgttttgtaactttttttcactcaacaataccatgactgtcttgctgtgtcaagtatatttctacatctcttaatggctgcatgatattccatcatatgtgccacattttattaaactactgttcaatttttaggtttccaactttcattaataaagtgctttaaagaacaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51100 -> Molecular function: GO:0005504 [fatty acid binding] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042171 [lysophosphatidic acid acyltransferase activity] evidence: IEA
            GeneID:51100 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:51100 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:51100 -> Biological process: GO:0006654 [phosphatidic acid biosynthetic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:51100 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:0051084 ['de novo' posttranslational protein folding] evidence: IEA
            GeneID:51100 -> Biological process: GO:0051259 [protein oligomerization] evidence: IDA
            GeneID:51100 -> Biological process: GO:1900740 [positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:51100 -> Cellular component: GO:0005741 [mitochondrial outer membrane] evidence: IEA
            GeneID:51100 -> Cellular component: GO:0043234 [protein complex] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.