2024-03-29 18:23:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_015957 1266 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens APAF1 interacting protein (APIP), mRNA. ACCESSION NM_015957 VERSION NM_015957.2 GI:166235185 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1266) AUTHORS Kim DK, Cho MH, Hersh CP, Lomas DA, Miller BE, Kong X, Bakke P, Gulsvik A, Agusti A, Wouters E, Celli B, Coxson H, Vestbo J, MacNee W, Yates JC, Rennard S, Litonjua A, Qiu W, Beaty TH, Crapo JD, Riley JH, Tal-Singer R and Silverman EK. CONSRTM ECLIPSE, ICGN, and COPDGene Investigators TITLE Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease JOURNAL Am. J. Respir. Crit. Care Med. 186 (12), 1238-1247 (2012) PUBMED 23144326 REFERENCE 2 (bases 1 to 1266) AUTHORS Kang,W. and Yang,J.K. TITLE Crystallization and preliminary X-ray crystallographic analysis of human Apaf-1-interacting protein JOURNAL Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 68 (PT 12), 1518-1520 (2012) PUBMED 23192037 REMARK GeneRIF: human APIP was overproduced in Escherichia coli, purified and crystallized. An X-ray diffraction data set was collected to 2.40 A resolution REFERENCE 3 (bases 1 to 1266) AUTHORS Ko,D.C., Gamazon,E.R., Shukla,K.P., Pfuetzner,R.A., Whittington,D., Holden,T.D., Brittnacher,M.J., Fong,C., Radey,M., Ogohara,C., Stark,A.L., Akey,J.M., Dolan,M.E., Wurfel,M.M. and Miller,S.I. TITLE Functional genetic screen of human diversity reveals that a methionine salvage enzyme regulates inflammatory cell death JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (35), E2343-E2352 (2012) PUBMED 22837397 REMARK GeneRIF: A polymorphism associated with reduced expression of a putative methionine salvage pathway dehydratase, apoptotic protease activating factor 1 (APAF1)-interacting protein (APIP), was associated with increased caspase-1-mediated cell death in Salmonella. REFERENCE 4 (bases 1 to 1266) AUTHORS Moravcikova,E., Krepela,E., Prochazka,J., Rousalova,I., Cermak,J. and Benkova,K. TITLE Down-regulated expression of apoptosis-associated genes APIP and UACA in non-small cell lung carcinoma JOURNAL Int. J. Oncol. 40 (6), 2111-2121 (2012) PUBMED 22407486 REMARK GeneRIF: The down-regulation of APIP and UACA expression suggests that the threshold to activate the apoptosome apparatus may be decreased in non-small cell lung cancer cells. REFERENCE 5 (bases 1 to 1266) AUTHORS Wright,F.A., Strug,L.J., Doshi,V.K., Commander,C.W., Blackman,S.M., Sun,L., Berthiaume,Y., Cutler,D., Cojocaru,A., Collaco,J.M., Corey,M., Dorfman,R., Goddard,K., Green,D., Kent,J.W. Jr., Lange,E.M., Lee,S., Li,W., Luo,J., Mayhew,G.M., Naughton,K.M., Pace,R.G., Pare,P., Rommens,J.M., Sandford,A., Stonebraker,J.R., Sun,W., Taylor,C., Vanscoy,L.L., Zou,F., Blangero,J., Zielenski,J., O'Neal,W.K., Drumm,M.L., Durie,P.R., Knowles,M.R. and Cutting,G.R. TITLE Genome-wide association and linkage identify modifier loci of lung disease severity in cystic fibrosis at 11p13 and 20q13.2 JOURNAL Nat. Genet. 43 (6), 539-546 (2011) PUBMED 21602797 REFERENCE 6 (bases 1 to 1266) AUTHORS Flachsbart,F., Franke,A., Kleindorp,R., Caliebe,A., Blanche,H., Schreiber,S. and Nebel,A. TITLE Investigation of genetic susceptibility factors for human longevity - a targeted nonsynonymous SNP study JOURNAL Mutat. Res. 694 (1-2), 13-19 (2010) PUBMED 20800603 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 1266) AUTHORS Venkatesan,K., Rual,J.F., Vazquez,A., Stelzl,U., Lemmens,I., Hirozane-Kishikawa,T., Hao,T., Zenkner,M., Xin,X., Goh,K.I., Yildirim,M.A., Simonis,N., Heinzmann,K., Gebreab,F., Sahalie,J.M., Cevik,S., Simon,C., de Smet,A.S., Dann,E., Smolyar,A., Vinayagam,A., Yu,H., Szeto,D., Borick,H., Dricot,A., Klitgord,N., Murray,R.R., Lin,C., Lalowski,M., Timm,J., Rau,K., Boone,C., Braun,P., Cusick,M.E., Roth,F.P., Hill,D.E., Tavernier,J., Wanker,E.E., Barabasi,A.L. and Vidal,M. TITLE An empirical framework for binary interactome mapping JOURNAL Nat. Methods 6 (1), 83-90 (2009) PUBMED 19060904 REFERENCE 8 (bases 1 to 1266) AUTHORS Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z., Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S., McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J., Dunham,I., Hill,D.E. and Vidal,M. TITLE hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes JOURNAL Genomics 89 (3), 307-315 (2007) PUBMED 17207965 REFERENCE 9 (bases 1 to 1266) AUTHORS Cho,D.H., Hong,Y.M., Lee,H.J., Woo,H.N., Pyo,J.O., Mak,T.W. and Jung,Y.K. TITLE Induced inhibition of ischemic/hypoxic injury by APIP, a novel Apaf-1-interacting protein JOURNAL J. Biol. Chem. 279 (38), 39942-39950 (2004) PUBMED 15262985 REMARK GeneRIF: APIP functions to inhibit muscle ischemic damage by binding to Apaf-1 in the Apaf-1/caspase-9 apoptosis pathway. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from DA729016.1, BC009077.1 and AF088034.1. On Jan 30, 2008 this sequence version replaced gi:7705723. Summary: APIP is an APAF1 (MIM 602233)-interacting protein that acts as a negative regulator of ischemic/hypoxic injury (Cho et al., 2004 [PubMed 15262985]).[supplied by OMIM, Dec 2008]. ##Evidence-Data-START## Transcript exon combination :: DA729016.1, AF132963.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-67 DA729016.1 1-67 68-1184 BC009077.1 1-1117 1185-1266 AF088034.1 561-642 FEATURES Location/Qualifiers source 1..1266 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11p13" gene 1..1266 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="APAF1 interacting protein" /db_xref="GeneID:51074" /db_xref="HGNC:17581" /db_xref="MIM:612491" exon 1..165 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" variation 9 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /replace="c" /replace="t" /db_xref="dbSNP:2956111" variation 39 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /replace="c" /replace="t" /db_xref="dbSNP:2956112" misc_feature 49..51 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="upstream in-frame stop codon" variation 56 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /replace="c" /replace="t" /db_xref="dbSNP:2956113" CDS 109..837 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /EC_number="4.2.1.109" /note="APAF1-interacting protein; probable methylthioribulose-1-phosphate dehydratase; MTRu-1-P dehydratase" /codon_start=1 /product="methylthioribulose-1-phosphate dehydratase" /protein_id="NP_057041.2" /db_xref="GI:166235186" /db_xref="CCDS:CCDS7895.1" /db_xref="GeneID:51074" /db_xref="HGNC:17581" /db_xref="MIM:612491" /translation="
MSGCDAREGDCCSRRCGAQDKEHPRYLIPELCKQFYHLGWVTGTGGGISLKHGDEIYIAPSGVQKERIQPEDMFVCDINEKDISGPSPSKKLKKSQCTPLFMNAYTMRGAGAVIHTHSKAAVMATLLFPGREFKITHQEMIKGIKKCTSGGYYRYDDMLVVPIIENTPEEKDLKDRMAHAMNEYPDSCAVLVRRHGVYVWGETWEKAKTMCECYDYLFDIAVSMKKVGLDPSQLPVGENGIV
" misc_feature 190..789 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="methylthioribulose-1-phosphate dehydratase; Region: salvage_mtnB; TIGR03328" /db_xref="CDD:163216" misc_feature order(196..198,208..210,232..234,298..300,304..309, 457..459,463..468,481..489,514..516,520..525,604..606, 688..690,721..723,742..744,754..756,775..777) /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="intersubunit interface [polypeptide binding]; other site" /db_xref="CDD:29521" misc_feature order(247..249,289..294,373..378,397..399,451..453, 457..459,691..693) /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="active site" /db_xref="CDD:29521" misc_feature 367..369 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q96GX9.1); phosphorylation site" misc_feature order(451..453,457..459,691..693) /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /note="Zn2+ binding site [ion binding]; other site" /db_xref="CDD:29521" variation 127 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /replace="c" /replace="t" /db_xref="dbSNP:2956114" exon 166..266 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" exon 267..315 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" exon 316..433 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" exon 434..569 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" exon 570..737 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" exon 738..1259 /gene="APIP" /gene_synonym="APIP2; CGI-29; CGI29; dJ179L10.2; hAPIP; MMRP19" /inference="alignment:Splign:1.39.8" ORIGIN
ctcagcgccgcctgattgcatttgcggcctcgctgccgtatcccaggctaagcgccgcgcgcaaagccgtgcggagattggaggccgcgcgggtccctggtctgggccatgtctggctgtgatgctcgggagggagactgttgttcccggagatgcggcgcgcaggacaaggagcatccaagatacctgatcccagaactttgcaaacagttttaccatttaggctgggtcactgggactggaggaggaattagcttgaagcatggcgatgaaatctacattgctccttcaggagtgcaaaaggaacgaattcagcctgaagacatgtttgtttgtgatataaatgaaaaggacataagtggaccttcgccatcgaagaagctaaaaaaaagccagtgtactcctcttttcatgaatgcttacacaatgagaggagcaggtgcagtgattcatacccactctaaagctgctgtgatggccacacttctctttccaggacgggagtttaaaattacacatcaagagatgataaaaggaataaagaaatgtacttccggagggtattatagatatgatgatatgttagtggtacccattattgagaatacacctgaggagaaagacctcaaagatagaatggctcatgcaatgaatgaatacccagactcctgtgcagtactggtcagacgtcatggagtatatgtgtggggggaaacatgggagaaggccaaaaccatgtgtgagtgttatgactatttatttgatattgccgtatcaatgaagaaagtaggacttgatccttcacagctcccagttggagaaaatggaattgtctaagccaaaagaaagtctaattatatacagagataaagctaaacgtaattattatttaaatgaaagctatttttttaaatgaattgaaatttttcatgatgctactaatttgccactaaatactgcaaatggtcaccctgaatctcttctgacattggatgttatttgcttatattcttataattttaaatgagggcacagtgaaatgaaaattttatactctatgtttctgtttatttttaaatccttaacagcaaaatatttgcctttaatttcttttttatatatactctcagagaattcctcttaatttttaaagatgctggtgataataaaattcattagaaaatttcctcattgtggaatgagcattctcttgttttaatgttggtgtcagaaaataaatatgaaacattaagtccaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:51074 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:51074 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA GeneID:51074 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI GeneID:51074 -> Molecular function: GO:0046570 [methylthioribulose 1-phosphate dehydratase activity] evidence: TAS GeneID:51074 -> Biological process: GO:0000096 [sulfur amino acid metabolic process] evidence: TAS GeneID:51074 -> Biological process: GO:0006595 [polyamine metabolic process] evidence: TAS GeneID:51074 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:51074 -> Biological process: GO:0019284 [L-methionine biosynthetic process from S-adenosylmethionine] evidence: IEA GeneID:51074 -> Biological process: GO:0019509 [L-methionine salvage from methylthioadenosine] evidence: IEA GeneID:51074 -> Biological process: GO:0019509 [L-methionine salvage from methylthioadenosine] evidence: IMP GeneID:51074 -> Biological process: GO:0019509 [L-methionine salvage from methylthioadenosine] evidence: TAS GeneID:51074 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS GeneID:51074 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP GeneID:51074 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:51074 -> Biological process: GO:0070372 [regulation of ERK1 and ERK2 cascade] evidence: ISS GeneID:51074 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_057041 -> EC 4.2.1.109
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.