GGRNA Home | Help | Advanced search

2020-10-24 06:51:31, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_015904               4698 bp    mRNA    linear   PRI 11-MAY-2013
DEFINITION  Homo sapiens eukaryotic translation initiation factor 5B (EIF5B),
            mRNA.
ACCESSION   NM_015904
VERSION     NM_015904.3  GI:84043962
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4698)
  CONSRTM   Psychiatric GWAS Consortium Bipolar Disorder Working Group
  TITLE     Large-scale genome-wide association analysis of bipolar disorder
            identifies a new susceptibility locus near ODZ4
  JOURNAL   Nat. Genet. 43 (10), 977-983 (2011)
   PUBMED   21926972
  REMARK    Erratum:[Nat Genet. 2012 Sep;44(9):1072. Fullerton, Janice M
            [added]; Hyoun, Phil L [corrected to Lee, Phil H]; Meng, Fan Guo
            [corrected to Meng, Fan]]
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 4698)
  AUTHORS   White,J.P., Reineke,L.C. and Lloyd,R.E.
  TITLE     Poliovirus switches to an eIF2-independent mode of translation
            during infection
  JOURNAL   J. Virol. 85 (17), 8884-8893 (2011)
   PUBMED   21697471
  REMARK    GeneRIF: The authors show that the cleavage of initiation factor
            eIF5B during enteroviral infection, along with the viral internal
            ribosome entry site, plays a role in mediating viral translation
            under conditions that are nonpermissive for host cell translation.
REFERENCE   3  (bases 1 to 4698)
  AUTHORS   de Breyne,S., Bonderoff,J.M., Chumakov,K.M., Lloyd,R.E. and
            Hellen,C.U.
  TITLE     Cleavage of eukaryotic initiation factor eIF5B by enterovirus 3C
            proteases
  JOURNAL   Virology 378 (1), 118-122 (2008)
   PUBMED   18572216
  REMARK    GeneRIF: 3Cpro-mediated cleavage of eIF5B may thus play an
            accessory role in the shutoff of translation that occurs in
            enterovirus-infected cells.
REFERENCE   4  (bases 1 to 4698)
  AUTHORS   Unbehaun,A., Marintchev,A., Lomakin,I.B., Didenko,T., Wagner,G.,
            Hellen,C.U. and Pestova,T.V.
  TITLE     Position of eukaryotic initiation factor eIF5B on the 80S ribosome
            mapped by directed hydroxyl radical probing
  JOURNAL   EMBO J. 26 (13), 3109-3123 (2007)
   PUBMED   17568775
  REMARK    GeneRIF: binding of eIF5B might induce conformational changes in
            both subunits, with ribosomal segments wrapping around the factor
REFERENCE   5  (bases 1 to 4698)
  AUTHORS   Hayashi,R., Ueda,T., Farwell,M.A. and Takeuchi,N.
  TITLE     Nuclear respiratory factor 2 activates transcription of human
            mitochondrial translation initiation factor 2 gene
  JOURNAL   Mitochondrion 7 (3), 195-203 (2007)
   PUBMED   17161026
  REMARK    GeneRIF: Transfected nuclear factor 2 trans activates the IF2
            promoter in a cell line.
REFERENCE   6  (bases 1 to 4698)
  AUTHORS   Marintchev,A., Kolupaeva,V.G., Pestova,T.V. and Wagner,G.
  TITLE     Mapping the binding interface between human eukaryotic initiation
            factors 1A and 5B: a new interaction between old partners
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 100 (4), 1535-1540 (2003)
   PUBMED   12569173
  REMARK    GeneRIF: determination of binding site on eukaryotic initiation
            factor 1A
REFERENCE   7  (bases 1 to 4698)
  AUTHORS   Olsen,D.S., Savner,E.M., Mathew,A., Zhang,F., Krishnamoorthy,T.,
            Phan,L. and Hinnebusch,A.G.
  TITLE     Domains of eIF1A that mediate binding to eIF2, eIF3 and eIF5B and
            promote ternary complex recruitment in vivo
  JOURNAL   EMBO J. 22 (2), 193-204 (2003)
   PUBMED   12514125
REFERENCE   8  (bases 1 to 4698)
  AUTHORS   Sorensen,H.P., Hedegaard,J., Sperling-Petersen,H.U. and
            Mortensen,K.K.
  TITLE     Remarkable conservation of translation initiation factors:
            IF1/eIF1A and IF2/eIF5B are universally distributed phylogenetic
            markers
  JOURNAL   IUBMB Life 51 (5), 321-327 (2001)
   PUBMED   11699879
REFERENCE   9  (bases 1 to 4698)
  AUTHORS   Wilson,S.A., Sieiro-Vazquez,C., Edwards,N.J., Iourin,O.,
            Byles,E.D., Kotsopoulou,E., Adamson,C.S., Kingsman,S.M.,
            Kingsman,A.J. and Martin-Rendon,E.
  TITLE     Cloning and characterization of hIF2, a human homologue of
            bacterial translation initiation factor 2, and its interaction with
            HIV-1 matrix
  JOURNAL   Biochem. J. 342 (PT 1), 97-103 (1999)
   PUBMED   10432305
REFERENCE   10 (bases 1 to 4698)
  AUTHORS   Lee,J.H., Choi,S.K., Roll-Mecak,A., Burley,S.K. and Dever,T.E.
  TITLE     Universal conservation in translation initiation revealed by human
            and archaeal homologs of bacterial translation initiation factor
            IF2
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 96 (8), 4342-4347 (1999)
   PUBMED   10200264
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BX485839.1, AB018284.1,
            BC032639.1 and AC018690.5.
            On Dec 29, 2005 this sequence version replaced gi:15451891.
            
            Summary: Accurate initiation of translation in eukaryotes is
            complex and requires many factors, some of which are composed of
            multiple subunits. The process is simpler in prokaryotes which have
            only three initiation factors (IF1, IF2, IF3). Two of these factors
            are conserved in eukaryotes: the homolog of IF1 is eIF1A and the
            homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and
            eIF5B interact on the ribosome along with other initiation factors
            and GTP to position the initiation methionine tRNA on the start
            codon of the mRNA so that translation initiates accurately.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB018284.1, AJ006776.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-34                BX485839.1         1-34
            35-374              AB018284.1         1-340
            375-1748            BC032639.1         297-1670
            1749-4211           AB018284.1         1715-4177
            4212-4698           AC018690.5         29586-30072
FEATURES             Location/Qualifiers
     source          1..4698
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q11.2"
     gene            1..4698
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="eukaryotic translation initiation factor 5B"
                     /db_xref="GeneID:9669"
                     /db_xref="HGNC:30793"
                     /db_xref="MIM:606086"
     exon            1..219
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       51
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370609784"
     variation       83
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192078616"
     variation       126
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138694732"
     variation       175
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183989818"
     misc_feature    176..178
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="upstream in-frame stop codon"
     CDS             185..3847
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="translation initiation factor IF2; eIF-5B;
                     translation initiation factor IF-2"
                     /codon_start=1
                     /product="eukaryotic translation initiation factor 5B"
                     /protein_id="NP_056988.3"
                     /db_xref="GI:84043963"
                     /db_xref="CCDS:CCDS42721.1"
                     /db_xref="GeneID:9669"
                     /db_xref="HGNC:30793"
                     /db_xref="MIM:606086"
                     /translation="
MGKKQKNKSEDSTKDDIDLDALAAEIEGAGAAKEQEPQKSKGKKKKEKKKQDFDEDDILKELEELSLEAQGIKADRETVAVKPTENNEEEFTSKDKKKKGQKGKKQSFDDNDSEELEDKDSKSKKTAKPKVEMYSGSDDDDDFNKLPKKAKGKAQKSNKKWDGSEEDEDNSKKIKERSRINSSGESGDESDEFLQSRKGQKKNQKNKPGPNIESGNEDDDASFKIKTVAQKKAEKKERERKKRDEEKAKLRKLKEKEELETGKKDQSKQKESQRKFEEETVKSKVTVDTGVIPASEEKAETPTAAEDDNEGDKKKKDKKKKKGEKEEKEKEKKKGPSKATVKAMQEALAKLKEEEERQKREEEERIKRLEELEAKRKEEERLEQEKRERKKQKEKERKERLKKEGKLLTKSQREARARAEATLKLLQAQGVEVPSKDSLPKKRPIYEDKKRKKIPQQLESKEVSESMELCAAVEVMEQGVPEKEETPPPVEPEEEEDTEDAGLDDWEAMASDEETEKVEGNKVHIEVKENPEEEEEEEEEEEEDEESEEEEEEEGESEGSEGDEEDEKVSDEKDSGKTLDKKPSKEMSSDSEYDSDDDRTKEERAYDKAKRRIEKRRLEHSKNVNTEKLRAPIICVLGHVDTGKTKILDKLRHTHVQDGEAGGITQQIGATNVPLEAINEQTKMIKNFDRENVRIPGMLIIDTPGHESFSNLRNRGSSLCDIAILVVDIMHGLEPQTIESINLLKSKKCPFIVALNKIDRLYDWKKSPDSDVAATLKKQKKNTKDEFEERAKAIIVEFAQQGLNAALFYENKDPRTFVSLVPTSAHTGDGMGSLIYLLVELTQTMLSKRLAHCEELRAQVMEVKALPGMGTTIDVILINGRLKEGDTIIVPGVEGPIVTQIRGLLLPPPMKELRVKNQYEKHKEVEAAQGVKILGKDLEKTLAGLPLLVAYKEDEIPVLKDELIHELKQTLNAIKLEEKGVYVQASTLGSLEALLEFLKTSEVPYAGINIGPVHKKDVMKASVMLEHDPQYAVILAFDVRIERDAQEMADSLGVRIFSAEIIYHLFDAFTKYRQDYKKQKQEEFKHIAVFPCKIKILPQYIFNSRDPIVMGVTVEAGQVKQGTPMCVPSKNFVDIGIVTSIEINHKQVDVAKKGQEVCVKIEPIPGESPKMFGRHFEATDILVSKISRQSIDALKDWFRDEMQKSDWQLIVELKKVFEII
"
     misc_feature    503..505
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    503..505
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    521..523
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    521..523
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    521..523
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    584..586
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (O60841.4); phosphorylation site"
     misc_feature    584..586
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    587..589
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    587..589
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    593..595
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    593..595
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    674..676
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    674..676
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    674..676
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    695..697
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    695..697
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    728..730
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    728..730
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    731..733
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    731..733
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    740..742
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    740..742
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    752..754
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    752..754
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    752..754
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    824..826
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    824..826
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1085..1087
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (O60841.4); phosphorylation site"
     misc_feature    1676..1678
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (O60841.4); phosphorylation site"
     misc_feature    1823..1825
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    1862..1864
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    1946..1948
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    1949..1951
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    1955..1957
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    1955..1957
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1967..1969
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60841.4); phosphorylation site"
     misc_feature    2063..3790
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="translation initiation factor IF-2; Validated;
                     Region: PRK04004"
                     /db_xref="CDD:179704"
     misc_feature    2078..2719
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="Initiation Factor 2 (IF2)/ eukaryotic Initiation
                     Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887"
                     /db_xref="CDD:206674"
     misc_feature    2096..2119
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="G1 box; other site"
                     /db_xref="CDD:206674"
     misc_feature    order(2099..2101,2105..2107,2117..2122,2129..2131,
                     2138..2143,2189..2194,2300..2305,2372..2377,2549..2551,
                     2561..2563)
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="putative GEF interaction site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:206674"
     misc_feature    order(2102..2122,2303..2305,2450..2455,2459..2464,
                     2654..2662)
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="GTP/Mg2+ binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:206674"
     misc_feature    2171..2191
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="Switch I region; other site"
                     /db_xref="CDD:206674"
     misc_feature    2177..2179
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="G2 box; other site"
                     /db_xref="CDD:206674"
     misc_feature    2288..2299
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="G3 box; other site"
                     /db_xref="CDD:206674"
     misc_feature    2294..2350
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="Switch II region; other site"
                     /db_xref="CDD:206674"
     misc_feature    2450..2461
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="G4 box; other site"
                     /db_xref="CDD:206674"
     misc_feature    2654..2662
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="G5 box; other site"
                     /db_xref="CDD:206674"
     misc_feature    2750..3079
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="aeIF5B_II: This family represents the domain II of
                     archeal and eukaryotic aeIF5B. aeIF5B is a homologue of
                     prokaryotic Initiation Factor 2 (IF2).  Disruption of the
                     eIF5B gene (FUN12) in yeast causes a severe slow-growth
                     phenotype, associated with a...; Region: aeIF5B_II;
                     cd03703"
                     /db_xref="CDD:58094"
     misc_feature    3074..3385
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /note="Translation-initiation factor 2; Region: IF-2;
                     pfam11987"
                     /db_xref="CDD:204802"
     misc_feature    3686..3688
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     variation       190
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375012629"
     variation       191
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11547670"
     exon            220..345
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     STS             229..390
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /standard_name="RH41971"
                     /db_xref="UniSTS:69981"
     variation       239
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374733590"
     variation       241
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369962372"
     variation       279
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373467460"
     variation       334
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41280587"
     variation       336
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201319020"
     exon            346..430
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       396
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189331174"
     variation       422
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114030806"
     exon            431..1103
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       447
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368200530"
     variation       448
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201274732"
     variation       459
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371596671"
     variation       547
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112337722"
     variation       557
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201058940"
     variation       581
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374863320"
     variation       601
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368947558"
     variation       604
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371235079"
     variation       656
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200355647"
     variation       691
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373226163"
     variation       794
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199960647"
     variation       815
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369384557"
     variation       841
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201879439"
     variation       844
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201286460"
     variation       848
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200249768"
     variation       851
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373822335"
     variation       868
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12233086"
     variation       894
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201583340"
     variation       900
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376145963"
     variation       911
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374785464"
     variation       966
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371646128"
     variation       1041
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377020889"
     variation       1050
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200353540"
     variation       1073
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199694603"
     exon            1104..1321
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1120
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74430561"
     variation       1165
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368501708"
     variation       1166..1171
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="aaagag"
                     /db_xref="dbSNP:369984953"
     variation       1167..1168
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11547669"
     variation       1189
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:71413834"
     variation       1193
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10642"
     variation       1195
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75521402"
     variation       1202
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11547668"
     STS             1208..1331
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /standard_name="RH46976"
                     /db_xref="UniSTS:29530"
     variation       1249
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17352888"
     variation       1262
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3205296"
     variation       1287
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371784944"
     variation       1297
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1801875"
     variation       1319
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199730736"
     exon            1322..1472
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1326
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372770046"
     variation       1343
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375743473"
     variation       1350..1351
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3205306"
     variation       1370
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1135362"
     variation       1374
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1135361"
     variation       1380
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369596945"
     variation       1399
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117138860"
     variation       1401
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199686500"
     variation       1448
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377592493"
     variation       1450
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139598770"
     variation       1470
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190999744"
     exon            1473..1571
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1534
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3205291"
     variation       1546
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199551427"
     exon            1572..1661
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1583
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147438767"
     variation       1592
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199806211"
     variation       1604
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373807627"
     exon            1662..1736
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1674
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202035862"
     variation       1677
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372481259"
     variation       1682
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201564019"
     variation       1690
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369366098"
     exon            1737..2026
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       1749
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7558074"
     variation       1818
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201864125"
     variation       1822
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376204155"
     variation       1832
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374825706"
     variation       1840
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370682143"
     variation       1859
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374776495"
     variation       1860
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367978098"
     variation       1862
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370463251"
     variation       1944
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373625361"
     variation       1946
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111801819"
     variation       1980
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372707233"
     variation       2005
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182287715"
     variation       2016
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149537328"
     exon            2027..2134
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2031
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192772936"
     variation       2034
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200234310"
     variation       2056
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369248628"
     variation       2061
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115723036"
     variation       2062
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11896520"
     variation       2065
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369969083"
     variation       2110..2111
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34091582"
     variation       2110
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373472515"
     exon            2135..2245
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2158
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376443"
     variation       2159
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189351546"
     variation       2182
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200683998"
     variation       2199
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370488674"
     variation       2214
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374990639"
     exon            2246..2313
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2255
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79534644"
     variation       2265
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202124160"
     variation       2282
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372037638"
     exon            2314..2455
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2351
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184913304"
     variation       2377
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374867339"
     variation       2405
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368956346"
     variation       2413
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371240650"
     variation       2416
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201277682"
     exon            2456..2587
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2464
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187237106"
     variation       2484
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200883389"
     variation       2521
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373753443"
     variation       2564
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192420726"
     variation       2565
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140396316"
     exon            2588..2770
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2593
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187135905"
     variation       2610
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373903572"
     variation       2629
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370348528"
     variation       2645
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374794095"
     variation       2736
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377542353"
     variation       2740
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371089792"
     exon            2771..2932
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2785
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367928917"
     variation       2789
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372326261"
     variation       2801
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191568464"
     variation       2803
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138045797"
     variation       2827
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374918684"
     variation       2854..2855
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35199153"
     variation       2897
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370200231"
     exon            2933..3064
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       2949
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200197574"
     variation       2957
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3205290"
     exon            3065..3196
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       3067
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199674726"
     variation       3145
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3197957"
     variation       3148
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149654810"
     exon            3197..3273
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     STS             3208..3333
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /standard_name="RH65673"
                     /db_xref="UniSTS:64987"
     exon            3274..3438
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       3280
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371700775"
     variation       3285
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:17853071"
     variation       3295
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375923795"
     variation       3393
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:76992586"
     exon            3439..3577
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       3487
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202156696"
     variation       3494
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369417011"
     exon            3578..3739
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       3640
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200659331"
     variation       3726
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373775429"
     variation       3739
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200222538"
     exon            3740..4698
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /inference="alignment:Splign:1.39.8"
     variation       3740
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377019448"
     variation       3792
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370974935"
     variation       3888
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373279433"
     STS             3911..4202
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /standard_name="A007F15"
                     /db_xref="UniSTS:5474"
     STS             3912..4113
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /standard_name="RH45200"
                     /db_xref="UniSTS:2662"
     variation       4026
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76055063"
     variation       4036
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144790325"
     variation       4054
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:14534"
     variation       4055
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:368454588"
     variation       4168
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801874"
     polyA_signal    4181..4186
                     /gene="EIF5B"
                     /gene_synonym="IF2"
     variation       4210
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3208832"
     polyA_site      4213
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       4277
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148631083"
     variation       4285
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142123580"
     variation       4295..4296
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:72349155"
     variation       4351..4352
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72374228"
     variation       4457
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151139795"
     polyA_signal    4475..4480
                     /gene="EIF5B"
                     /gene_synonym="IF2"
     variation       4477..4478
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:113650276"
     variation       4495..4513
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="accagtaagcaagctctgt"
                     /db_xref="dbSNP:377658315"
     polyA_site      4502
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       4512
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376513968"
     variation       4588..4589
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="atca"
                     /db_xref="dbSNP:146783572"
     variation       4595
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="tgat"
                     /db_xref="dbSNP:28969552"
     variation       4682..4683
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:28382984"
     variation       4682
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201163759"
     variation       4683
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2290257"
     variation       4686..4687
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /replace=""
                     /replace="aatc"
                     /db_xref="dbSNP:28382983"
     polyA_site      4698
                     /gene="EIF5B"
                     /gene_synonym="IF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
cttgcgcactgagaactcacaccatatgtgtcctgttccagtgcgcgggtctgtggagagccgggtgcgagcggcggcagcacgaggggaaaagagctgagcggagaccaaagtcagccgggagacagtgggtctgtgagagaccgaatagaggggctggggccacgagcgccattgacaagcaatggggaagaaacagaaaaacaagagcgaagacagcaccaaggatgacattgatcttgatgccttggctgcagaaatagaaggagctggtgctgccaaagaacaggagcctcaaaagtcaaaagggaaaaagaaaaaagagaaaaaaaagcaggactttgatgaagatgatatcctgaaagaactggaagaattgtctttggaagctcaaggcatcaaagctgacagagaaactgttgcagtgaagccaacagaaaacaatgaagaggaattcacctcaaaagataaaaaaaagaaaggacagaagggcaaaaaacagagttttgatgataatgatagcgaagaattggaagataaagattcaaaatcaaaaaagactgcaaaaccgaaagtggaaatgtactctgggagtgatgatgatgatgattttaacaaacttcctaaaaaagctaaagggaaagctcaaaaatcaaataagaagtgggatgggtcagaggaggatgaggataacagtaaaaaaattaaagagcgttcaagaataaattcttctggtgaaagtggtgatgaatcagatgaatttttgcaatctagaaaaggacagaaaaaaaatcagaaaaacaagccaggtcctaacatagaaagtgggaatgaagatgatgacgcctccttcaaaattaagacagtggcccaaaagaaggcagaaaagaaggagcgcgagagaaaaaagcgagatgaagaaaaagcgaaactgcggaagctgaaagaaaaagaagagttagaaacaggtaaaaaggatcagagtaaacaaaaggaatctcaaaggaaatttgaagaagaaactgtaaaatccaaagtgactgttgatactggagtaattcctgcctctgaagagaaagcagagactcccacagctgcagaagatgacaatgaaggagacaaaaagaagaaagataagaagaaaaagaaaggagaaaaggaagaaaaagagaaagagaagaaaaaaggacctagcaaagccactgttaaagctatgcaagaagctctggctaagcttaaagaggaagaagaaagacagaagagagaagaggaagaacgtataaaacggcttgaagaattagaagccaagcgtaaagaagaggaacgattggaacaagaaaaaagagaaaggaaaaagcaaaaagaaaaagaaagaaaagaacgcttgaaaaaagaagggaaacttttaactaaatcccagagagaagccagagccagagccgaagctactcttaaactgctacaagctcagggtgttgaagtgccatcaaaagactctttgccaaagaagaggccaatttatgaagataaaaagaggaaaaaaataccacagcagctagaaagtaaagaagtgtctgaatcaatggaattatgtgctgctgtagaagttatggaacaaggagtaccagaaaaggaagagacaccacctcctgttgaaccagaagaagaagaagatactgaggatgctggattggatgattgggaagctatggccagtgatgaggagacagaaaaagtagaaggaaacaaagttcatatagaagtaaaagaaaaccctgaagaggaggaggaggaggaagaagaggaagaagaagatgaagaaagtgaagaagaggaggaagaggagggagaaagtgaaggcagtgaaggtgatgaggaagatgaaaaggtgtcagatgagaaggattcagggaagacattagataaaaagccaagtaaagaaatgagctcagattctgaatatgactctgatgatgatcggactaaagaagaaagggcttatgacaaagcaaaacggaggattgagaaacggcgacttgaacatagtaaaaatgtaaacaccgaaaagctaagagcccctattatctgcgtacttgggcatgtggacacagggaagacaaaaattctagataagctccgtcacacacatgtacaagatggtgaagcaggtggtatcacacaacaaattggggccaccaatgttcctcttgaagctattaatgaacagactaagatgattaaaaattttgatagagagaatgtacggattccaggaatgctaattattgatactcctgggcatgaatctttcagtaatctgagaaatagaggaagctctctttgtgacattgccattttagttgttgatattatgcatggtttggagccccagacaattgagtctatcaaccttctcaaatctaaaaaatgtcccttcattgttgcactcaataagattgataggttatatgattggaaaaagagtcctgactctgatgtggctgctactttaaagaagcagaaaaagaatacaaaagatgaatttgaggagcgagcaaaggctattattgtagaatttgcacagcagggtttgaatgctgctttgttttatgagaataaagatccccgcacttttgtgtctttggtacctacctctgcacatactggtgatggcatgggaagtctgatctaccttcttgtagagttaactcagaccatgttgagcaagagacttgcacactgtgaagagctgagagcacaggtgatggaggttaaagctctcccggggatgggcaccactatagatgtcatcttgatcaatgggcgtttgaaggaaggagatacaatcattgttcctggagtagaagggcccattgtaactcagattcgaggcctcctgttacctcctcctatgaaggaattacgagtgaagaaccagtatgaaaagcataaagaagtagaagcagctcagggggtaaagattcttggaaaagacctggagaaaacattggctggtttacccctccttgtggcttataaagaagatgaaatccctgttcttaaagatgaattgatccatgagttaaagcagacactaaatgctatcaaattagaagaaaaaggagtctatgtccaggcatctacactgggttctttggaagctctactggaatttctgaaaacatcagaagtgccctatgcaggaattaacattggcccagtgcataaaaaagatgttatgaaggcttcagtgatgttggaacatgaccctcagtatgcagtaattttggccttcgatgtgagaattgaacgagatgcacaagaaatggctgatagtttaggagttagaatttttagtgcagaaattatttatcatttatttgatgcctttacaaaatatagacaagactacaagaaacagaaacaagaagaatttaagcacatagcagtatttccctgcaagataaaaatcctccctcagtacatttttaattctcgagatccgatagtgatgggggtgacggtggaagcaggtcaggtgaaacaggggacacccatgtgtgtcccaagcaaaaattttgttgacatcggaatagtaacaagtattgaaataaaccataaacaagtggatgttgcaaaaaaaggacaagaagtttgtgtaaaaatagaacctatccctggtgagtcacccaaaatgtttggaagacattttgaagctacagatattcttgttagtaagatcagccggcagtccattgatgcactcaaagactggttcagagatgaaatgcagaagagtgactggcagcttattgtggagctgaagaaagtatttgaaatcatctaattttttcacatggagcaggaactggagtaaatgcaatactgtgttgtaatatcccaacaaaaatcagacaaaaaatggaacagacgtatttggacactgatggacttaagtatggaaggaagaaaaataggtgtataaaatgttttccatgagaaaccaagaaacttacactggtttgacagtggtcagttacatgtccccacagttccaatgtgcctgttcactcacctctcccttccccaacccttctctacttggctgctgttttaaagtttgcccttccccaaatttggatttttattacagatctaaagctctttcgattttatactgattaaatcagtactgcagtatttgattaaccaagcttctgcagattttgtgattcttgggacttttttgacgtaagaaatacttctttatttatgcatattcttcccacagtgatttttccagcattcttctgccatatgcctttagggcttttataaaatagaaaattaggcattctgatatttctttagctgctttgtgtgaaaccatggtgtaaaagcacagctggctgctttttactgcttgtgtagtcacgagtccattgtaatcatcacaattctaaaccaaactaccaataaagaaaacagacatccaccagtaagcaagctctgttaggcttccatgttagtgtagcttctctcccacaagttgtcctcctaggacaagaattatcttacaaactaaactatcatcacactaccttgtatgccagcacctggtaacagtagagatttttatacattaatcttgatctgttttaatcttgatctgttttagtagagatttttatacattaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9669 -> Molecular function: GO:0003743 [translation initiation factor activity] evidence: IDA
            GeneID:9669 -> Molecular function: GO:0003743 [translation initiation factor activity] evidence: NAS
            GeneID:9669 -> Molecular function: GO:0003924 [GTPase activity] evidence: IEA
            GeneID:9669 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9669 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
            GeneID:9669 -> Biological process: GO:0006412 [translation] evidence: TAS
            GeneID:9669 -> Biological process: GO:0006413 [translational initiation] evidence: TAS
            GeneID:9669 -> Biological process: GO:0006446 [regulation of translational initiation] evidence: IDA
            GeneID:9669 -> Biological process: GO:0006446 [regulation of translational initiation] evidence: NAS
            GeneID:9669 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:9669 -> Biological process: GO:0044267 [cellular protein metabolic process] evidence: TAS
            GeneID:9669 -> Cellular component: GO:0005829 [cytosol] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.