GGRNA Home | Help | Advanced search

2020-10-24 06:58:32, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_015210               6092 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens SOGA family member 2 (SOGA2), mRNA.
ACCESSION   NM_015210
VERSION     NM_015210.3  GI:163644315
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6092)
  AUTHORS   Ng,D., Hu,N., Hu,Y., Wang,C., Giffen,C., Tang,Z.Z., Han,X.Y.,
            Yang,H.H., Lee,M.P., Goldstein,A.M. and Taylor,P.R.
  TITLE     Replication of a genome-wide case-control study of esophageal
            squamous cell carcinoma
  JOURNAL   Int. J. Cancer 123 (7), 1610-1615 (2008)
   PUBMED   18649358
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 6092)
  AUTHORS   Beausoleil,S.A., Villen,J., Gerber,S.A., Rush,J. and Gygi,S.P.
  TITLE     A probability-based approach for high-throughput protein
            phosphorylation analysis and site localization
  JOURNAL   Nat. Biotechnol. 24 (10), 1285-1292 (2006)
   PUBMED   16964243
REFERENCE   3  (bases 1 to 6092)
  AUTHORS   Nousiainen,M., Sillje,H.H., Sauer,G., Nigg,E.A. and Korner,R.
  TITLE     Phosphoproteome analysis of the human mitotic spindle
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 103 (14), 5391-5396 (2006)
   PUBMED   16565220
REFERENCE   4  (bases 1 to 6092)
  AUTHORS   Nusbaum,C., Zody,M.C., Borowsky,M.L., Kamal,M., Kodira,C.D.,
            Taylor,T.D., Whittaker,C.A., Chang,J.L., Cuomo,C.A., Dewar,K.,
            FitzGerald,M.G., Yang,X., Abouelleil,A., Allen,N.R., Anderson,S.,
            Bloom,T., Bugalter,B., Butler,J., Cook,A., DeCaprio,D., Engels,R.,
            Garber,M., Gnirke,A., Hafez,N., Hall,J.L., Norman,C.H., Itoh,T.,
            Jaffe,D.B., Kuroki,Y., Lehoczky,J., Lui,A., Macdonald,P.,
            Mauceli,E., Mikkelsen,T.S., Naylor,J.W., Nicol,R., Nguyen,C.,
            Noguchi,H., O'Leary,S.B., O'Neill,K., Piqani,B., Smith,C.L.,
            Talamas,J.A., Topham,K., Totoki,Y., Toyoda,A., Wain,H.M.,
            Young,S.K., Zeng,Q., Zimmer,A.R., Fujiyama,A., Hattori,M.,
            Birren,B.W., Sakaki,Y. and Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 18
  JOURNAL   Nature 437 (7058), 551-555 (2005)
   PUBMED   16177791
  REMARK    Erratum:[Nature. 2005 Dec 1;438(7068):696. O'Neill, Keith [added]]
REFERENCE   5  (bases 1 to 6092)
  AUTHORS   Brajenovic,M., Joberty,G., Kuster,B., Bouwmeester,T. and Drewes,G.
  TITLE     Comprehensive proteomic analysis of human Par protein complexes
            reveals an interconnected protein network
  JOURNAL   J. Biol. Chem. 279 (13), 12804-12811 (2004)
   PUBMED   14676191
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AK131528.1,
            AP000864.4 and AB018345.2.
            On Dec 20, 2007 this sequence version replaced gi:141802984.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK131528.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-866               AK131528.1         1-866
            867-867             AP000864.4         151225-151225
            868-1401            AK131528.1         868-1401
            1402-1402           AP000864.4         151760-151760
            1403-1754           AK131528.1         1403-1754
            1755-1755           AP000864.4         152113-152113
            1756-3825           AK131528.1         1756-3825
            3826-4716           AB018345.2         3743-4633
            4717-5360           AK131528.1         4717-5360
            5361-6092           AB018345.2         5278-6009
FEATURES             Location/Qualifiers
     source          1..6092
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18p11.22"
     gene            1..6092
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="SOGA family member 2"
                     /db_xref="GeneID:23255"
                     /db_xref="HGNC:29121"
                     /db_xref="HPRD:11110"
     exon            1..56
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       42
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73394581"
     exon            57..115
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    74..76
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="upstream in-frame stop codon"
     exon            116..340
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     CDS             143..4903
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="coiled-coil domain-containing protein 165;
                     coiled-coil domain containing 165"
                     /codon_start=1
                     /product="protein SOGA2"
                     /protein_id="NP_056025.2"
                     /db_xref="GI:163644316"
                     /db_xref="CCDS:CCDS11841.1"
                     /db_xref="GeneID:23255"
                     /db_xref="HGNC:29121"
                     /db_xref="HPRD:11110"
                     /translation="
MEEMRDSYLEEDVYQLQELRRELDRANKNCRILQYRLRKAEQKSLKVAETGQVDGELIRSLEQDLKVAKDVSVRLHHELKTVEEKRAKAEDENETLRQQMIEVEISKQALQNELERLKESSLKRRSTREMYKEKKTFNQDDSADLRCQLQFAKEEAFLMRKKMAKLGREKDELEQELQKYKSLYGDVDSPLPTGEAGGPPSTREAELKLRLKLVEEEANILGRKIVELEVENRGLKAEMEDMRGQQEREGPGRDHAPSIPTSPFGDSLESSTELRRHLQFVEEEAELLRRSISEIEDHNRQLTHELSKFKFEPPREPGWLGEGASPGAGGGAPLQEELKSARLQISELSGKVLKLQHENHALLSNIQRCDLAAHLGLRAPSPRDSDAESDAGKKESDGEESRLPQPKREGPVGGESDSEEMFEKTSGFGSGKPSEASEPCPTELLKAREDSEYLVTLKHEAQRLERTVERLITDTDSFLHDAGLRGGAPLPGPGLQGEEEQGEGDQQEPQLLGTINAKMKAFKKELQAFLEQVNRIGDGLSPLPHLTESSSFLSTVTSVSRDSPIGNLGKELGPDLQSRLKEQLEWQLGPARGDERESLRLRAARELHRRADGDTGSHGLGGQTCFSLELRGPPVLPEQSVSIEELQGQLVQAARLHQEETETFTNKIHKMEEEHLYALRWKELEMHSLALQNTLHERTWSDEKNLMQQELRSLKQNIFLFYVKLRWLLKHWRQGKQMEEEGEEFTEGEHPETLSRLGELGVQGGHQADGPDHDSDRGCGFPVGEHSPHSRVQIGDHSLRLQTADRGQPHKQVVENQQLFSAFKALLEDFRAELREDERARLRLQQQYASDKAAWDVEWAVLKCRLEQLEEKTENKLGELGSSAESKGALKKEREVHQKLLADSHSLVMDLRWQIHHSEKNWNREKVELLDRLDRDRQEWERQKKEFLWRIEQLQKENSPRRGGSFLCDQKDGNVRPFPHQGSLRMPRPVAMWPCADADSIPFEDRPLSKLKESDRCSASENLYLDALSLDDEPEEPPAHRPEREFRNRLPEEEENHKGNLQRAVSVSSMSEFQRLMDISPFLPEKGLPSTSSKEDVTPPLSPDDLKYIEEFNKSWDYTPNRGHNGGGPDLWADRTEVGRAGHEDSTEPFPDSSWYLTTSVTMTTDTMTSPEHCQKQPLRSHVLTEQSGLRVLHSPPAVRRVDSITAAGGEGPFPTSRARGSPGDTKGGPPEPMLSRWPCTSPRHSRDYVEGARRPLDSPLCTSLGFASPLHSLEMSKNLSDDMKEVAFSVRNAICSGPGELQVKDMACQTNGSRTMGTQTVQTISVGLQTEALRGSGVTSSPHKCLTPKAGGGATPVSSPSRSLRSRQVAPAIEKVQAKFERTCCSPKYGSPKLQRKPLPKADQPNNRTSPGMAQKGYSESAWARSTTTRESPVHTTINDGLSSLFNIIDHSPVVQDPFQKGLRAGSRSRSAEPRPELGPGQETGTNSRGRSPSPIGVGSEMCREEGGEGTPVKQDLSAPPGYTLTENVARILNKKLLEHALKEERRQAAHGPPGLHSDSHSLGDTAEPGPMENQTVLLTAPWGL
"
     misc_feature    188..679
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="Domain of unknown function (DUF4201); Region:
                     DUF4201; pfam13870"
                     /db_xref="CDD:206041"
     misc_feature    560..847
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="Protein of unknown function (DUF3166); Region:
                     DUF3166; pfam11365"
                     /db_xref="CDD:204632"
     misc_feature    947..1234
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /note="Protein of unknown function (DUF3166); Region:
                     DUF3166; pfam11365"
                     /db_xref="CDD:204632"
     variation       204
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149471544"
     variation       211
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143156505"
     variation       216
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111816432"
     variation       217
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114243008"
     variation       218
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374198736"
     variation       232
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141884978"
     variation       239
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368883249"
     variation       249
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371204761"
     variation       262
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116449409"
     variation       292
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374495993"
     variation       318
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139379863"
     variation       335
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141424283"
     exon            341..499
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       365
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150814411"
     variation       373
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73939505"
     variation       377
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376807407"
     variation       385
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114166564"
     variation       399
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371187347"
     variation       402
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374627418"
     variation       435
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115239581"
     variation       441
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370205751"
     variation       461
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150009615"
     variation       470
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199836041"
     variation       473
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147730005"
     variation       474
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373625990"
     exon            500..559
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       518
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199792443"
     exon            560..1873
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       620
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369827156"
     variation       621
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140904017"
     variation       656
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116313795"
     variation       661
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371711557"
     variation       662
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201320331"
     variation       681
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144955054"
     variation       733
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147963142"
     variation       746
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201111042"
     variation       770
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143446062"
     variation       794
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199804867"
     variation       800
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374606434"
     variation       815
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377232155"
     variation       818
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368971612"
     variation       825
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111729524"
     variation       858
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372483390"
     variation       867
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35739383"
     variation       869
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377180005"
     variation       870
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199899364"
     variation       884
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370413674"
     variation       891
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373668728"
     variation       894
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140796802"
     variation       895
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376292956"
     variation       899
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201079606"
     variation       900
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370675552"
     variation       907
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200803602"
     variation       917
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144657710"
     variation       934
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138700640"
     variation       968
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145413531"
     variation       969
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368611615"
     variation       1014
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138137244"
     variation       1018
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376670774"
     variation       1022
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373001391"
     variation       1027
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149524338"
     variation       1040
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200271750"
     variation       1051
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116805379"
     variation       1086
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144704256"
     variation       1093
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370441990"
     variation       1112
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75497676"
     variation       1118
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373564262"
     variation       1137
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200063005"
     variation       1144
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371603021"
     variation       1168
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376804537"
     variation       1177
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368351211"
     variation       1180
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141911404"
     variation       1189
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372352703"
     variation       1190
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377251478"
     variation       1206
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114316007"
     variation       1222
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201535426"
     variation       1225
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114352059"
     variation       1231
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115675641"
     variation       1240
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144831600"
     variation       1244
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147496732"
     variation       1274
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374013815"
     variation       1289
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367857172"
     variation       1290
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189338832"
     variation       1297
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139433913"
     variation       1314
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199867297"
     variation       1322
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150058526"
     variation       1329
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144910998"
     variation       1346
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149027252"
     variation       1347
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201398082"
     variation       1364
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200169088"
     variation       1365
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372469977"
     variation       1366
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375519934"
     variation       1381
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368248481"
     variation       1396
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200864672"
     variation       1402
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918272"
     variation       1405
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114624229"
     variation       1416
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367871130"
     variation       1419
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140267953"
     variation       1432
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145456770"
     variation       1434
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148033470"
     variation       1443
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201851779"
     variation       1453
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201042941"
     variation       1467
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140905139"
     variation       1468
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371686623"
     variation       1484
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150163593"
     variation       1485
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375280275"
     variation       1519
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138167149"
     variation       1523
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374972089"
     variation       1527
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143858455"
     variation       1538
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115973534"
     variation       1542
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147236744"
     variation       1543
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369116879"
     variation       1550
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898483"
     variation       1551
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139142059"
     variation       1560
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143105042"
     variation       1561
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147520247"
     variation       1567
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114537770"
     variation       1587
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115077293"
     variation       1595
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200525720"
     variation       1599
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150698375"
     variation       1606
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189259523"
     variation       1614
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139950675"
     variation       1615
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115241522"
     variation       1644
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1965665"
     variation       1686
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146651585"
     variation       1690
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140313696"
     variation       1691
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181587784"
     variation       1697
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34690009"
     variation       1702
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145026398"
     variation       1714
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377495365"
     variation       1720
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200157260"
     variation       1744
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149080636"
     variation       1745
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201511046"
     variation       1749
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143118025"
     variation       1755
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3744979"
     variation       1762
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373557147"
     variation       1766
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114113780"
     variation       1771
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114888699"
     variation       1786
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377432291"
     variation       1799
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146456714"
     variation       1815
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200780094"
     variation       1816
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115087032"
     variation       1817
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201915762"
     variation       1819
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143143209"
     variation       1823
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150423289"
     variation       1824
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370769194"
     variation       1837
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138194834"
     variation       1855
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149618481"
     variation       1866
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375168888"
     exon            1874..2029
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       1895
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376052944"
     variation       1912
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201941632"
     variation       1917
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200095511"
     variation       1940
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369745361"
     variation       1941
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373511257"
     variation       1942
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201694316"
     variation       1943
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375862127"
     variation       1947
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201426677"
     variation       1952
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201927020"
     variation       1955
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373316781"
     variation       1960
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200305032"
     variation       1967
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201167430"
     variation       1968
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200755675"
     variation       1970
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200309875"
     variation       1971
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202096044"
     variation       1973
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377158398"
     variation       1987
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370837499"
     variation       1993
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138220149"
     variation       1998
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368739590"
     exon            2030..2152
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       2081
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202210164"
     variation       2104
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116633163"
     variation       2121
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142244493"
     variation       2134
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375932138"
     variation       2138
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139078896"
     exon            2153..2383
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       2164
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193207851"
     variation       2235
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375918866"
     variation       2238
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144061014"
     variation       2264
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373089010"
     variation       2276
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369991737"
     variation       2277
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150964075"
     variation       2287
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8085873"
     variation       2319
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200476048"
     variation       2320
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115426921"
     exon            2384..2578
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       2399
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367822275"
     variation       2402
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145562841"
     variation       2420
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115906443"
     variation       2445
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141478791"
     variation       2446
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368107221"
     variation       2474
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12386117"
     variation       2488
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147883454"
     variation       2497
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200863586"
     variation       2507
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141567899"
     variation       2513
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144721445"
     variation       2514
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143637147"
     variation       2541
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200421486"
     variation       2542
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200288992"
     variation       2552
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114488174"
     exon            2579..2746
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       2603
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373451225"
     variation       2604
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115687647"
     variation       2613
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34877994"
     variation       2633
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181659600"
     variation       2634
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199934266"
     variation       2645
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370454729"
     variation       2646
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372521582"
     variation       2653
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150335263"
     variation       2655
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138959291"
     variation       2664
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376928119"
     variation       2683
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370599907"
     variation       2685
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374704026"
     variation       2720
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201487723"
     variation       2722
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368388853"
     variation       2723
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114287451"
     variation       2735
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376144386"
     exon            2747..3001
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       2781
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200378431"
     variation       2787
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368463108"
     variation       2788
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372728490"
     variation       2790
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111486930"
     variation       2806
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373787674"
     variation       2816
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11874468"
     variation       2833
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115919432"
     variation       2877
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201566176"
     variation       2889
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367678396"
     variation       2912
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146388364"
     variation       2913
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371845192"
     variation       2951
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139744939"
     variation       2967
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200602137"
     variation       2984
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373862673"
     exon            3002..3298
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       3012
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375559463"
     variation       3024
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373772510"
     variation       3028
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143851805"
     variation       3031
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377486386"
     variation       3042
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371009205"
     variation       3064
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142108234"
     variation       3065
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375780014"
     variation       3066
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377316538"
     variation       3068
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371223585"
     variation       3096
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184402453"
     variation       3104
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375523319"
     variation       3107
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151203974"
     variation       3116
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201332575"
     variation       3125
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200023288"
     variation       3158
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139637772"
     variation       3179
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371682939"
     variation       3181
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374052746"
     variation       3188
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114671252"
     variation       3195
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367943286"
     variation       3259
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372696641"
     variation       3269
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145205841"
     variation       3287
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55676538"
     exon            3299..3330
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     exon            3331..4864
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       3333
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114373872"
     variation       3340
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372236045"
     variation       3341
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374469429"
     variation       3366
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367681723"
     variation       3373
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142229380"
     variation       3400
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149983879"
     variation       3408
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145193610"
     variation       3409
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372260226"
     variation       3440
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374849559"
     variation       3462
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371811754"
     variation       3469
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151273618"
     variation       3483
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371815051"
     variation       3495
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112747828"
     variation       3516
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149175996"
     variation       3522
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143281645"
     variation       3528
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115963216"
     variation       3532
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140677462"
     variation       3540
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145762591"
     variation       3541
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138485784"
     variation       3550
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373407188"
     variation       3560
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141975395"
     variation       3561
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376123444"
     variation       3569
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377093360"
     variation       3572
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202151461"
     variation       3589
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201573119"
     variation       3590
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199690043"
     variation       3595
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150519905"
     variation       3599
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201208323"
     variation       3600
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116814140"
     variation       3609
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138372811"
     variation       3637
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114022207"
     variation       3654
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149277971"
     variation       3664
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115043055"
     variation       3675
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139524026"
     variation       3680
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145244362"
     variation       3681
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115859324"
     variation       3697
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147180038"
     variation       3706
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199663245"
     variation       3713
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369805144"
     variation       3715
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148702862"
     variation       3716
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369375200"
     variation       3730
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113084211"
     variation       3736
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199872444"
     variation       3737
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151045980"
     variation       3739
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115172009"
     variation       3748
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201888726"
     variation       3749
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115256052"
     variation       3759
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377453546"
     variation       3760
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200633031"
     variation       3762
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370222270"
     variation       3808
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78887585"
     variation       3810
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140924221"
     variation       3811
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149764588"
     variation       3826
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:581894"
     variation       3830
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373969568"
     variation       3832
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199536616"
     variation       3859
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200631414"
     variation       3862
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140575175"
     variation       3867
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200700286"
     variation       3904
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145801367"
     variation       3905
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115783507"
     variation       3906
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149227195"
     variation       3920
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200977312"
     variation       3923
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143381223"
     variation       3932
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201932131"
     variation       3938
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373385826"
     variation       3945
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377502555"
     variation       3957
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148368877"
     variation       3990
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141158729"
     variation       4005
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144118759"
     variation       4033
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16954339"
     variation       4034
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138014945"
     variation       4043
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114965084"
     variation       4082
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78759113"
     variation       4086
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371036341"
     variation       4089
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375774425"
     variation       4090
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147203549"
     variation       4095
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200248938"
     variation       4113
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116556506"
     variation       4141
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114960932"
     variation       4144
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377635610"
     variation       4153
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149752902"
     variation       4163
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144633551"
     variation       4214
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116331286"
     variation       4218
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116291960"
     variation       4219
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148473485"
     variation       4264
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78834168"
     variation       4326
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201454813"
     variation       4351
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367711662"
     variation       4352
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371275636"
     variation       4401
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146773283"
     variation       4419
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374048104"
     variation       4430
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201132962"
     variation       4471
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114723075"
     variation       4489
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367931106"
     variation       4490
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114538532"
     variation       4493
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146614505"
     variation       4501
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73400414"
     variation       4531
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375236050"
     variation       4535
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61753867"
     variation       4536
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369594159"
     variation       4540
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112364860"
     variation       4541
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114602899"
     variation       4547
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372807917"
     variation       4553
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372525674"
     variation       4554
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114846609"
     variation       4568
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370154697"
     variation       4569
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137897581"
     variation       4571
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377363502"
     variation       4580
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72942342"
     variation       4596
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113092517"
     variation       4617
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114381054"
     variation       4621
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145849851"
     variation       4629
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148212855"
     variation       4644
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114122418"
     variation       4658
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112450691"
     variation       4678
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369341171"
     variation       4684
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115327884"
     variation       4694
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374646453"
     variation       4714
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141267454"
     variation       4717
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3744977"
     variation       4724
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139202553"
     variation       4729
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368395280"
     variation       4753
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142663598"
     variation       4772
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372356633"
     variation       4798
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146312067"
     variation       4802
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139490722"
     variation       4831
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377258454"
     variation       4847
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199835005"
     exon            4865..4921
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       4877
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144186015"
     variation       4893
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199932072"
     variation       4898
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199571389"
     variation       4903
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200381483"
     variation       4911
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2242273"
     variation       4916
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377684041"
     variation       4919
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370656574"
     exon            4922..6092
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /inference="alignment:Splign:1.39.8"
     variation       4925
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199685634"
     variation       4932
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11665124"
     variation       4975
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145457722"
     variation       4992
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201909742"
     variation       5002
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373027846"
     variation       5015
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181786619"
     variation       5040
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:55662834"
     variation       5050
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147690676"
     variation       5161
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142583120"
     variation       5201
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11545975"
     variation       5249..5250
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace=""
                     /replace="gct"
                     /db_xref="dbSNP:139445974"
     variation       5321..5325
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace=""
                     /replace="aattt"
                     /db_xref="dbSNP:368153195"
     variation       5390
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3186500"
     variation       5400
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144799239"
     variation       5414
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:115567028"
     variation       5465
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4798693"
     variation       5559
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185169527"
     variation       5585
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3744975"
     variation       5728
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112917926"
     variation       5744
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114725394"
     variation       5795
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370204547"
     variation       5801
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:16954382"
     variation       5824
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112463785"
     variation       5841
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189577762"
     variation       5853
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181118932"
     variation       5865
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78916023"
     variation       5911
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149013526"
     variation       6058
                     /gene="SOGA2"
                     /gene_synonym="CCDC165; KIAA0802"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370694147"
ORIGIN      
gagtgttttcagaagtgggaatagcaggcgaggtcttgaggcctgaagaagcaaagcgtcgcttagtcaatgctgagatgcgtcttgtggaacagaatttttgggacatttgcaggatgagttagatgaactccgtgctgagatggaagagatgagagacagttatttagaggaagatgtttaccagctgcaggaacttcggcgagaactggaccgcgctaataaaaactgccgaatcctgcagtaccgtcttcggaaagccgagcagaaaagcctgaaagtggctgagacgggtcaggtggatggtgagcttattcgaagcctggagcaggacttgaaggtagccaaagatgtatctgtcagattgcaccacgaacttaagacggtggaggaaaagcgcgctaaagctgaggatgaaaacgaaactctccgacagcagatgattgaagtggaaatatccaaacaggccctccagaatgagctggagagactgaaagagagttccctaaaaagaagaagcactcgggaaatgtacaaggagaagaaaacctttaaccaggatgacagtgccgatttgaggtgccagctccagtttgccaaagaggaagccttcctgatgcgcaaaaagatggccaagctaggaagggagaaggacgagctggagcaggagctccagaagtacaagtccctctatggggatgtggacagtcccctgcccacgggggaagcaggcgggccccccagcacccgggaggccgagctgaagctgcggctaaagctggtggaggaggaagccaacatcttgggccggaagatcgtggagctggaggtggagaaccgtggcctcaaggcagagatggaggacatgcggggccagcaggagcgggagggcccgggtcgggaccacgcacccagcattcctacctcacccttcggtgactccctggagtcctccactgagctccgccgccacctgcagtttgtagaagaggaagcggagttgctccggaggtccatctccgagatcgaagaccacaaccggcaactgacccacgagctcagcaagtttaagtttgagcctccccgggagccgggctggctaggagagggtgcaagtcctggtgccgggggtggggcccccctgcaggaggagctgaagtcagccaggctgcagatcagcgagctcagcggcaaggtgctcaaactgcagcacgagaaccacgcgctgctgtccaacatccagcgctgcgacctggcagcccacctggggctgcgtgcccccagtccccgggacagcgatgccgagagtgatgcgggcaagaaggagagtgatggggaggagagccgcctgccccagcccaagcgggaagggcctgttggcggggagagtgactcggaggaaatgtttgagaagacgtcgggcttcgggagcgggaagccatcggaggccagcgagccatgccccacggagctcctgaaggcccgggaggactctgagtacctagtgaccctaaaacacgaggcccagcggctagagcggacggtggagcgcctcatcacggacaccgacagcttcctccatgatgcggggctgcggggtggtgcgcccttaccggggcctggcctccagggcgaagaggagcagggtgagggggaccagcaggagccccagctgctggggaccatcaacgccaagatgaaggctttcaagaaagagctgcaggccttcctggagcaggtgaaccgcattggggatggcctatcccccttgccccacctcacagagtcctctagcttcctctccactgtgacttccgtgtcccgggactcccccatcgggaacctggggaaggagctgggcccagacttgcagtccagactgaaagagcagctggagtggcagctcgggccggcccgaggggacgagcgggagagcctgcgcctccgagccgcgcgggagctgcaccgccgcgcagacggggacaccgggagccacgggctgggaggccagacctgcttcagcctggagctcaggggcccccccgttttacctgagcagagtgtatccatagaggagctacagggtcagctcgtgcaggcggccagactgcatcaagaggagacagagacatttacaaacaagatccataagatggaggaggagcacctctatgccttgaggtggaaagaactggaaatgcacagcctggctttgcaaaacaccctccatgagcgaacctggagtgatgagaagaatctgatgcagcaggagctccggtccttgaagcagaacattttcctcttctacgtcaaactcaggtggctgctgaaacactggcggcaagggaagcagatggaggaggaaggagaggagttcactgagggtgaacatccagagaccctctccaggctcggggagcttggagtccaggggggtcaccaggcggatggcccagaccacgacagtgaccgaggctgtggctttccagtgggggagcactccccacactcccgggtgcagattggagatcacagcttgcggctgcagaccgcggacaggggacagccccacaaacaggtggtggaaaaccagcagctgttcagcgccttcaaggccttgctggaggacttccgtgcggagctgcgggaggatgagcgtgcccgactacggctgcagcagcaatatgccagcgacaaggcggcctgggacgtggagtgggccgtgctcaagtgccgtctggaacagctggaagagaagactgagaacaagttgggagaactaggctcctccgctgagagcaagggggccttgaagaaggagagagaggtgcaccagaagctcctggcagacagtcacagcctggtcatggacctgcgctggcagatccatcacagcgagaagaactggaaccgggagaaggtggaacttctcgaccgcctggacagagatcggcaggagtgggagcggcagaagaaggaattcttgtggaggatagagcagttgcagaaagagaacagtccccggagaggtggcagtttcctctgtgatcaaaaagacggcaacgttcgcccctttccccaccagggaagcctccgcatgccccgtccagtggccatgtggccttgtgcagatgctgactccatcccgtttgaagaccggccgctgtccaagctgaaggagtcggacaggtgctcggccagtgagaatctctacctggatgccttgtccctggatgacgagccagaagagccaccagcccacaggcccgagagggagttcaggaaccgcctccctgaggaagaagaaaatcacaaaggaaatcttcaaagggcggtgtccgtgtcctccatgtctgagttccagcgtctaatggacatctcccccttcctgcctgagaagggcctgccgtccaccagcagcaaggaggatgtcaccccacccctgtctccagacgacctcaagtacatcgaggagttcaacaagagctgggactacacacccaacaggggccacaatggtggggggccggacctttgggccgacaggaccgaggtggggcgggcagggcacgaggacagcacagagcctttccccgactcctcctggtacctaaccacaagtgtcaccatgaccacggacaccatgaccagcccagagcactgccagaagcagccactgcggagccacgtcctcaccgagcagtcggggttgcgcgtgttacacagcccgcctgccgtgcgcagggtcgacagcatcacggcggcaggtggtgagggtccctttcccacaagcagagccagagggagcccgggagacaccaagggaggccctccagaacccatgctcagcaggtggccttgcacctcccccaggcactcccgggactatgtggagggggcacggcgcccccttgatagtcccctctgtacctccctggggtttgcctccccactgcacagcctggagatgtccaagaacttgagtgatgacatgaaggaggtggccttctctgtcaggaatgccatctgctccggccctggcgagctgcaagtcaaggacatggcctgccagaccaatgggtcccggacgatggggacccagactgttcagaccatcagtgtgggcttgcagactgaagccctgcgtggcagcggtgtcaccagcagcccccacaagtgtctcactccaaaggctgggggcggtgctacacccgtgtcgtctccttcccggagccttaggagcagacaggtggcccctgccatcgagaaggtgcaggccaagtttgaacgcacatgctgctcccccaagtatggttctcccaagctgcagaggaagcccctccccaaagccgaccagccaaataacaggacgtcaccagggatggcccagaaagggtacagtgagtcagcctgggcccgctccaccaccacaagggagagccccgtgcacaccaccattaatgatggcctctccagcctcttcaacatcattgaccacagccccgtggtgcaggaccccttccagaaggggctgcgggccggcagtcggtctcgctcagcagagccccgaccagagctgggcccaggccaggaaacaggcaccaattcccgaggaaggtcgcctagccccattggggtggggtcagagatgtgcagggaggaagggggagagggcacgccagtgaagcaggacttatctgctccccctggctacacgctcactgagaacgtggcccggatcctcaacaagaagctgctggaacatgccttaaaggaggagaggaggcaggctgcccacgggcccccgggtctccacagtgacagccactcgctgggggacacagccgagccagggcccatggagaaccaaactgtcttgctaactgccccctggggactctagccctgcccgcctcacgctgaactaccttgttctgcactagctccatccctagagccctgcttctccaggcccgagagaccagcaaaccgtcgccctccgtcccgttgggccccacattcccccactgcctcacagcctcagtcacccggagacccgacgtccttggaggagcatggtggcgaggagccgcccgaggagcagccacaccgagatgcaagcttgcatggattatcacagtataattcactgtaatttgcataaccacaccatcaccatgaacaaaactctgcccaacaggagagatctagttttctcaaggtcaaagaatgttttttaaaaacacaaagctgctgaatgttcaacctgtgaaactgagatgtttctagaatgaaacagtaaatgtgcctgtaataacttaatttttttcatagctcagaaaactatttttgtctccatcttttttacacacagtatattaaacgaaaaggtaaataaggtataaatagatttaaaaaataaaagttttaaaaaatgtacattttaagagattctgaacaccctcgctgtcaatacctgactgcctctgttaaatttgcactgttacattttggttcagtttatttccatgttgaattagagtggattaagttaattttattttgtcagtgttactgttttttacgaattttttaatgcttcagactgtctgattcagtgaactttttgtagtgaaaaagccatgaagccagtagacaagacagatattctgtatgctggaggggatacaggatgattttgaaaaggtacaaagtcctcagtgggcttagaaaattcactgtatgatccttatattatcctacttggcttgcacgtcttcgggtgcatgtatataccgctactgtgtcctcgccatcacctaaatgtgactcagtctgttccactgtaatatgttgtgaatttccttgtactgtacttttattgttggtcttcttgcatcgatgatccaacagcaacaccatttttaaattattgtgaaaagattaactggcaatgtacagagtttactcaaagttttcttaagggaaaacactacaaaaagtcacaaggataccaaatggaaacacatgatgatgcctctgggtctgtatgagaccgtgatgaagtagaaataaagcccttctgagatggc
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.